Application of ZmD8 mutant gene in reduction of corn plant height and thickening of corn stalks
By gene editing the corn D8 gene and introducing the ZmD8 mutant gene, the problems of fertility damage and stem fineness are solved, the corn plant height is reduced and the stem thickening is achieved, the risk of lodging is reduced, and the corn tolerance and yield is improved.
Patent Information
- Application Number
- CN202510532623.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-25
- Publication Date
- 2025-08-12
AI Technical Summary
In existing corn breeding, dwarf stalk mutations are physically damaged and cumbersome, making it difficult to effectively reduce plant height and thicken the stems under high-density planting, resulting in a high risk of lodging and affecting yield.
The D8 gene of corn is specifically modified through gene editing technology, and the ZmD8 mutant gene is introduced, resulting in the deletion of DELLA protein, achieving semi-dominal dwarfing and stalk thickening, and keeping fertility unaffected.
It has achieved significant reduction in corn plant height and thickening of stems without affecting fertility, reducing the risk of lodging, and improving density and yield.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The present invention relates to the field of crop genetic breeding technology, and in particular to ZmD8 Application of mutant genes in reducing corn plant height and thickening corn stalks. Background Art
[0002] Corn is a major food crop. Currently, corn yield growth relies primarily on modern agricultural technologies such as molecular breeding, genetic engineering, and high-density planting. Among these, planting density is the most crucial factor for increasing corn yield. High-density planting conditions trigger a shade avoidance response (SAR) in corn, a process involving a signaling cascade mediated by the phytochrome (phyB). When the red-to-far-red light ratio (R / FR) within the canopy falls below 1.0, phyB switches from its active state (Pfr) to its inactive state (Pr), triggering downstream regulatory networks. This manifests as upregulation of gibberellin (GA) and brassinosteroid (BR) biosynthesis genes (such as ZmGA3ox1 and ZmDWF4) in the stem, increasing internode cell elongation by 30%-50%. This ultimately leads to an abnormal increase in plant height, an upward shift in ear locus, and a decrease in stem bending strength. Statistics show that for every 10% increase in planting density, the risk of lodging increases by 8.3%, resulting in yield losses of up to 15%-20%. That is, when plants sense shade from neighboring plants, they typically elongate their stems to increase their height, attempting to break through the shade layer to gain more light. This shade avoidance response causes corn stalks to become thinner, ears to rise, and are more susceptible to lodging.
[0003] Dwarf corn has significant advantages in high-density planting environments due to its shorter plant height and stronger stalks. Studies have shown that dwarf corn has stronger stalks, which can effectively reduce the risk of lodging and maintain good growth potential in limited spaces. Dwarf corn breeding relies on dwarf germplasm resources. Existing dwarf corn mutants are mostly recessive mutants, and the breeding process is cumbersome and often accompanied by defects in important agronomic traits, which limits their application in breeding. Creating excellent dwarf mutants with breeding application potential is the key to breeding breakthrough new dwarf corn varieties.
[0004] DELLA proteins are inhibitors of the gibberellin (GA) signaling pathway, and GA promotes plant growth by degrading DELLA proteins. D8 Extreme dwarfing and impaired fertility cannot meet the needs of actual production, and we still need to find a more ideal method of corn dwarfing. Summary of the Invention
[0005] One of the objects of the present invention is to provide a novel method for effectively dwarfing plants without affecting fertility.
[0006] The present invention provides a ZmD8 mutant gene, which is wild type ZmD8 The nucleotide sequence of the gene is a reference sequence, and the mutant gene comprises a mutation in which bases 30 to 175 are deleted in the CDS region.
[0007] The mutant gene of the present invention has a nucleotide sequence as shown in SEQ ID NO.2.
[0008] The present invention uses gene editing technology to modify corn D8 Genes have been modified to obtain new ZmD8 Mutant gene. Corn containing this mutant gene has a dwarf phenotype while its fertility is not affected, which can effectively reduce the risk of lodging.
[0009] Specifically, mutants containing this mutant gene exhibited significantly reduced plant and ear height, significantly thickened stalks, and no significant difference in fertility compared to the wild type. The mutant's semi-dominant nature makes it easy to select in the field and significantly reduces the height of F1 plants. Its use could help improve plant height and density tolerance in maize varieties, and has significant potential for breeding applications.
[0010] In the present invention, a "semi-dominant mutant" refers to a mutant that exhibits phenotypic characteristics between the wild type and the homozygous mutant in the heterozygous state.
[0011] In the present invention, ZmD8 The mutant gene exhibits a semi-dominant trait, that is, the plant height and ear height of the heterozygous plant (ZmD8 / +) are between the wild type (+ / +) and the homozygous mutant (ZmD8 / ZmD8), and the reduction is about half of that of the homozygous mutant. This semi-dominant trait makes ZmD8 Mutant genes have higher practicality and selection efficiency in corn breeding.
[0012] The present invention also provides the protein encoded by the mutant gene.
[0013] The present invention also provides a biological material comprising the mutant gene, wherein the biological material is an expression cassette, a vector or a host cell.
[0014] The present invention also provides the use of the mutant gene or protein or biological material in regulating plant height, ear height and / or stalk diameter; preferably, the plant is corn.
[0015] The present invention also provides the application of the mutant gene, protein or biological material in improving corn germplasm resources.
[0016] The present invention also provides a method for reducing corn plant height and / or thickening corn stalks, so that the corn contains the above-mentioned mutant gene or protein.
[0017] In the method of the present invention, the corn is made to contain the above-mentioned mutant gene by gene knockout, hybridization, backcrossing, selfing or asexual reproduction.
[0018] The present invention also provides a method for identifying whether corn contains ZmD8 A method for mutating a gene, comprising: (1) Extracting DNA from the corn to be identified; (2) Using the DNA extracted in step (1) as a template, perform PCR amplification using a primer combination; if the length of the amplified fragment is 216 bp, it is determined that the corn to be identified contains ZmD8 Mutated genes; The primer combination has the sequences shown in SEQ ID NOs. 5 and 6; described ZmD8 The mutant genes are as described above.
[0019] The primer combination of the present invention can effectively determine whether the corn to be tested contains ZmD8 Mutated gene.
[0020] The beneficial effects of the present invention are at least: The present invention provides a new method for effectively dwarfing plants and thickening their stems without affecting plant fertility. ZmD8 Transforming wild-type corn with mutant genes can make it more resistant to lodging, which is beneficial to production. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Figure 1 Schematic diagram of the CRIPSR / Cas9 vector structure.
[0022] Figure 2 The results of target sequence mutation type analysis.
[0023] Figure 3 The phenotypic observation results of the wild-type maize inbred line KN5585, the mutant ΔN-D8 (mutant), and the backcross material BC1F1 plants; A is the plant height result, B is the ear height result, C is the stalk diameter result, D is the ear diameter result, E is the ear length result, and F is the 100-grain weight result. a, b, and c represent Turkey tests. P <0.05.
[0024] Figure 4 Figure 5. Plant height and ear phenotypes (obtained after self-pollination) of the wild-type maize inbred line KN5585, the mutant ΔN-D8 (mutant), and the hybrid (backcross material BC1F1). The scale bar represents 20 cm.
[0025] Figure 5The results of electrophoresis detection are shown in Figure 1. Lanes 1, 2, 3, and 4 represent the wild type, heterozygote (backcross material BC1F1), mutant ΔN-D8, and marker, respectively. DETAILED DESCRIPTION
[0026] The preferred embodiments of the present invention will be described in detail below with reference to the examples. It should be understood that the following examples are provided for illustrative purposes only and are not intended to limit the scope of the present invention. Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.
[0027] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods. Unless otherwise specified, the materials, reagents, etc. used in the following examples are all commercially available or prepared according to conventional methods in the art.
[0028] Example 1 Preparation of N-terminal deletion mutant material of D8 gene The present invention uses D8 in corn as the target gene and uses the CRISPR / Cas9 system to edit the N-terminal sequence of D8 to obtain an N-terminal deletion mutant of D8.
[0029] 1. Target gene The genomic sequence and 5' noncoding region (5' UTR) of the D8 gene were obtained from NCBI (https: / / www.ncbi.nlm.nih.gov). The D8 gene (Zm00001d033680) is located on chromosome 1 of the maize genome and has only one exon. Its coding region (CDS) is 1893 bp long and encodes 630 amino acids. The sequence of the wild-type D8 gene is shown in SEQ ID No. 1.
[0030] Wild-type D8 gene DNA sequence, SEQ ID No. 1:
[0031] 2. Target design sgRNA design was performed using the Huazhong Agricultural University CRISPR-P website (http: / / crispr.hzau.edu.cn / CRISPR2 / ). Targets with high on-target scores, low off-target rates, and appropriate locations were selected. Two highly specific sgRNA target sequences, sgRNA 1 and sgRNA 2, were designed targeting the upstream sequence of the DELLA domain of the D8 gene.
[0032] sgRNA1 (SEQ ID No. 3): TACCAAGACGCCGGCGGGAGTGG, located at positions 13-35 of CDS.
[0033] sgRNA 2 (SEQ ID No. 4): GGCGGACGTCGCGCAGAAGCTGG, located at positions 159-181 of CDS.
[0034] 3. CRIPSR / Cas9 vector construction The specific construction method is as follows: 1) Amplify the target fragments sgRNA-1 (Target 1) and sgRNA-2 (Target 2) using primer pairs, recover the target fragments and digest them with BsaI; 2) Digesting the CRIPSR / Cas9 backbone vector (see paragraphs 0095-0097 of the specification of Chinese patent CN 113215156 A) with BsaI and recovering the large fragment after digestion; 3) Ligate sgRNA-1 and sgRNA-2 to the linearized backbone vector; 4) The ligation product was transformed into competent E. coli Trans-T1, spread on Kan plates for culture, and 8 colonies were selected for liquid culture for 2 hours. The culture solution was tested by PCR, and 2 correct monoclonal clones were selected and sent for testing.
[0035] 5) Select the single clone with the correct sequencing results for expansion, bacterial preservation, and plasmid extraction to obtain the CRIPSR / Cas9 vector containing both sgRNAs.
[0036] Schematic diagram of CRIPSR / Cas9 vector structure Figure 1 .
[0037] 4. Obtaining gene-edited positive plants The constructed CRIPSR / Cas9 vector was used to transform Agrobacterium EHA105. Five single colonies were selected for culture. After PCR testing, the bacteria were preserved for future use. The positive Agrobacterium strain was used to transform the callus tissue of the maize inbred line KN5585. The specific transformation steps were referred to the method in the literature "ISHIDA Y, HIEI Y, KOMARI T. Agrobacterium-mediated transformation of maize. Nature Protocols, 2007.2(7):1614-21." The regenerated tissue culture maize seedlings obtained by Basta screening were the T0 generation plants. The genomic DNA of the T0 generation plants was extracted and PCR amplified using Basta-specific primers. The plants that could amplify the target fragment were the T0 generation gene-edited positive seedlings.
[0038] The specific process is as follows: 1) Preparation of Agrobacterium culture solution.
[0039] A single Agrobacterium colony carrying the binary vector was selected and inoculated into YEB liquid medium (containing 50 mg / L streptomycin, 50 mg / L rifampicin, and the appropriate antibiotics). Culture was shaken at 28°C and 220 rpm for 12-16 hours until the OD600 value reached 0.6-0.8. The logarithmic growth phase culture was collected by centrifugation at 4000 × g for 10 minutes, resuspended in an equal volume of infection solution (MS salts + 100 μM acetosyringone AS + 10 mM MES pH 5.6), and incubated in the dark for 1 hour to induce Vir gene expression.
[0040] 2) Pretreatment of corn callus.
[0041] Immature embryos of KN5585 10-12 days after pollination were sterilized with 70% ethanol (30 s) and 20% sodium hypochlorite (15 min), and then inoculated into N6 induction medium (2 mg / L 2,4-D + 30 g / L sucrose + 0.5 g / L hydrolyzed casein). Type I callus was obtained by culture at 25°C in the dark for 2 weeks.
[0042] 3) Agrobacterium-callus co-culture.
[0043] Immerse type II callus (subcultured once) in the induced Agrobacterium culture solution (OD600=0.3-0.5), gently shake for 10-15 min, aspirate the excess culture solution, and transfer to co-culture medium (MS+100 μM AS+2 mg / L 2,4-D+0.8% agar).
[0044] 4) Degerming and screening culture.
[0045] After co-cultivation, the calli were blotted dry with sterile filter paper and washed three times with MS liquid medium containing 500 mg / L cefotaxime for 5 min each time to completely remove Agrobacterium on the surface.
[0046] Calli were transferred to recovery medium (N6 medium with 250 mg / L cephalexin and 0.5 mg / L 2,4-D) and incubated in the dark at 25°C for 5-7 days to promote wound repair. The selection pressure was then gradually increased, with primary screening (N6 medium containing 1 / 2 critical concentration of antibiotics for 2 weeks) and secondary screening (full concentration antibiotic medium, subcultured every 2 weeks for 6 weeks to eliminate non-transformed cells).
[0047] 5) Regeneration and molecular characterization.
[0048] The resistant calli were transferred to regeneration medium (MS + 1 mg / L 6-BA + 0.5 mg / L NAA + 30 g / L sucrose) and cultured at 25°C under illumination (16 h light / 8 h dark) for 3-4 weeks to induce bud differentiation.
[0049] Cut 2-3 cm regenerated shoots, inoculate them into rooting medium (1 / 2 MS + 0.1 mg / L NAA), and culture for 10-15 days to form a complete root system.
[0050] The PCR amplification method was used to verify the transgenic positive plants. The genomic DNA of the T0 generation plants was extracted and PCR amplified using Basta-specific primers (Bar-F and Bar-R). The plants that could amplify the target fragment were the T0 generation gene-edited positive seedlings.
[0051] Bar-F: CCATCGTCAACCACTACATCGAGACA (SEQ ID No. 7); Bar-R: CTTCAGCAGGTGGGTGTAGAGCGT (SEQ ID No. 8).
[0052] The PCR reaction system is shown in Table 1.
[0053] Table 1 Example 2 Analysis of target sequence mutation types in T0 generation positive plants and development of molecular markers In order to detect the mutation of the target sequence, primer pairs were designed on both sides of the target site, and conventional PCR amplification was performed on the genomic DNA of the T0 generation transgenic positive plants. The target amplification primers are: D8-genotyping-F and D8-genotyping-R. The results showed that the amplified fragment of the wild type KN5585 was 362bp in length, and the amplified fragment of the mutant was 216bp. The use of 2% agarose gel electrophoresis (120 V constant voltage electrophoresis for 40 min, with a low-temperature (4°C) circulating water cooling system) for detection clearly distinguished the difference in band size, and the product specificity was high (Primer-BLAST was used to exclude cross-reactions between the primers and non-target genes (such as D9, DWRF1), confirming that the primers of the present invention have high specificity), and there were no mixed bands ( Figure 5 ).
[0054] D8-genotyping-F: CCAAGCTATCCCAGAACCGA (SEQ ID No. 5); D8-genotyping-R: GATTGTAGTGCACGGTGTCC (SEQ ID No. 6).
[0055] The mutant PCR product was recovered by gel excision and then Sanger sequencing was performed. The editing results of this mutant showed a 146 bp deletion in the CDS coding region from positions 30 to 175 (SEQ ID No. 2). The mutation caused a frameshift, and protein translation terminated at amino acid position 80. This mutant was named ΔN-D8. The results of target sequence mutation type analysis are shown in Figure 2 .
[0056] Mutant DNA sequence, SEQ ID No. 2:
[0057] The wild-type maize inbred line KN5585 and the mutant ΔN-D8 were backcrossed to obtain the backcross material BC1F1. PCR electrophoresis was performed using the above-mentioned target amplification primers D8-genotyping-F and D8-genotyping-R. The results are shown in Figure 2. Figure 5 Lane 2 in the .
[0058] Example 3 Analysis of plant height and agronomic traits of mutant materials At the same time, wild-type maize inbred line KN5585, mutant ΔN-D8 plants, and backcross material BC1F1 (KN5585×ΔN-D8) were planted and phenotypic observations were performed ( Figure 4 ).
[0059] The details are as follows: The wild type KN5585, mutant ΔN-D8 and BC1F1 heterozygotes were planted in Hainan, with each material planted in one row. The sowing date was recorded and normal field management was given during the growth period.
[0060] The survey methods for each trait are as follows: Plant height: The height of the main stem from the ground to the top of the tassel. 15 plants of each material were surveyed.
[0061] Ear height: The height of the main stem from the ground to the node where the topmost effective female ear (the first ear from the top) is attached. 15 plants of each material were surveyed.
[0062] Stem diameter: The stem diameter was measured using a vernier caliper at the middle of the third internode above the ground of each plant. Fifteen plants of each material were surveyed.
[0063] Ear diameter: The diameter of the ear was measured at the thickest part in the middle of the ear using a vernier caliper. Fifteen plants of each material were surveyed.
[0064] Ear length: Fifteen well-pollinated female ears were selected from each material, and the straight-line length from the top to the base was measured, and the average value was taken as the ear length data.
[0065] Hundred-grain weight: Randomly select 2 groups of 100 seeds, weigh them separately, and take the average value as the hundred-grain weight.
[0066] Compared with wild-type KN5585 plants, the plant height of mutant ΔN-D8 plants was reduced by 42% ( Figure 3 A in the figure), the ear height decreased by about 53% ( Figure 3 B in the figure), the stem diameter increased by about 26% ( Figure 3 C in the figure). The backcross material BC1F1 is heterozygous, and its plant height is 19.6% lower than that of the wild type, indicating that this mutant is a semi-dominant dwarf mutant ( Figure 3A in Figure 4 In addition, the ear position of the BC1F1 heterozygote was significantly reduced compared with the wild type, and the stem diameter was significantly thickened ( Figure 3 B and C in ).
[0067] Compared with the wild type, the length and diameter of the ear of the mutant ΔN-D8 were slightly smaller than those of the wild type, but the length and diameter of the ear of the BC1F1 heterozygote were not significantly different from those of the wild type ( Figure 3 D and E in Figure 4 ), there was no significant difference in 100-grain weight among the wild type, mutant ΔN-D8, and BC1F1 heterozygote ( Figure 3 F in ).
[0068] Specific phenotypic statistical results are shown in Tables 2 to 7.
[0069] Table 2 Table 3 Table 4 Table 5 Table 6 Table 7 During the variety breeding process, the semi-dominant dwarfing trait can be easily identified and selected in the field, showing the great potential of this material in industrial application.
[0070] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made based on the present invention. Therefore, such modifications and improvements, which do not depart from the spirit of the present invention, are intended to be within the scope of protection claimed herein.
Claims
1. A ZmD8 The mutant gene is characterized by Wild type ZmD8 The nucleotide sequence of the gene is a reference sequence, and the mutant gene comprises a mutation in which bases 30 to 175 are deleted in the CDS region.
2. The mutant gene according to claim 1, characterized in that It has the nucleotide sequence shown in SEQ ID NO.
2.
3. The protein encoded by the mutant gene according to claim 1 or 2.
4. A biological material comprising the mutant gene according to claim 1 or 2, wherein the biological material is an expression cassette, a vector or a host cell.
5. Use of the mutant gene according to claim 1 or 2, the protein according to claim 3, or the biological material according to claim 4 in regulating plant height, ear height, and / or stem diameter.
6. The use according to claim 5, characterized in that The plant is corn.
7. Use of the mutant gene according to claim 1 or 2, the protein according to claim 3, or the biological material according to claim 4 in improving corn germplasm resources.
8. A method for reducing corn plant height and / or thickening corn stalks, characterized in that: The corn contains the mutant gene according to claim 1 or 2.
9. The method according to claim 8, characterized in that The corn contains the mutant gene according to claim 1 or 2 by gene knockout, hybridization, backcrossing, selfing or asexual reproduction.
10. A method for identifying whether corn contains ZmD8 A method for mutating a gene, characterized in that include: (1) Extracting DNA from the corn to be identified; (2) Using the DNA extracted in step (1) as a template, perform PCR amplification using a primer combination; If the length of the amplified fragment is 216 bp, it is determined that the corn to be identified contains ZmD8 Mutated genes; The primer combination has the sequences shown in SEQ ID NOs. 5 and 6; described ZmD8 The mutant gene is as described in claim 1 or 2.
Citation Information
Patent Citations
Method for efficiently creating fragrant corn by using CRISPR / Cas9 technology
CN113215156A