High-temperature-resistant gene RE4 in heading and flowering periods of rice and application thereof

Abstract

The invention relates to a high-temperature-resistant gene RE4 in the heading and flowering period of rice. The gene comprises (a) a nucleotide sequence as shown in SEQ ID No: 1; and (b) a nucleotide sequence which is generated by adding, substituting or deleting one or more basic groups in the nucleotide sequence as shown in SEQ ID No: 1 and is used for coding high-temperature resistance in the heading and flowering period of rice. The invention belongs to the technical field of gene engineering. By overexpressing the gene, the high-temperature resistance of the rice in the heading and flowering periods is improved.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to a rice high-temperature-resistant gene RE4 during the heading and flowering period and an application thereof. Background Art

[0002] Rich rice resources harbor numerous heat-tolerant genes. Discovering and identifying superior genes can broaden the gene pool and enrich the genetic background for rice breeding. Discovering and utilizing heat-tolerant genes in rice is a pressing challenge. However, heat-tolerant genes require verification through transgenic testing or by constructing populations and near-isogenic lines. Discovering heat-tolerant genes from naturally occurring rice variation presents challenges. Summary of the Invention

[0003] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a rice high temperature resistance gene RE4 during heading and flowering period and its application.

[0004] To achieve the above object, the technical solution adopted by the present invention is:

[0005] In a first aspect, the present invention provides a rice high temperature tolerance gene RE4 during heading and flowering, wherein the gene has the following nucleotide sequence (a) or (b):

[0006] (a) the nucleotide sequence shown in SEQ ID No: 1;

[0007] (b) The nucleotide sequence shown in SEQ ID No: 1 is generated by adding, substituting or deleting one or more bases, and encodes a nucleotide sequence of a functional protein for high temperature resistance during the heading and flowering stages of rice.

[0008] In a second aspect, the present invention provides the use of the RE4 gene described in the first aspect in regulating the high temperature resistance and fruit setting rate of rice during the heading and flowering period.

[0009] As a preferred embodiment of the second aspect, the seed setting rate of rice during the heading and flowering stages is increased by overexpressing the RE4 gene.

[0010] In a third aspect, the present invention provides a protein for improving the rice seed setting rate during the heading and flowering stages of rice, wherein the protein is encoded by the gene described in the first aspect.

[0011] In a fourth aspect, the present invention provides use of the protein described in the third aspect in improving the fruit set rate of rice during the heading and flowering period.

[0012] In a fifth aspect, the present invention provides a recombinant vector comprising the gene as described in the first aspect.

[0013] In a sixth aspect, the present invention provides a biomaterial comprising the recombinant vector described in the fifth aspect.

[0014] As a preferred embodiment of the sixth aspect, the biological material is a recombinant microorganism, a transgenic plant cell line or a transgenic plant tissue; the recombinant microorganism is a bacterium, a yeast, an algae or a fungus; the bacterium is one of Escherichia, Erwinia, Agrobacterium tumefaciens, Flavobacterium, Alcaligenes, Pseudomonas or Bacillus.

[0015] In a seventh aspect, the present invention provides use of the recombinant vector described in the fifth aspect or the recombinant microorganism described in the sixth aspect in improving the fruit set rate of rice during the heading and flowering period.

[0016] In an eighth aspect, the present invention provides a method for cultivating transgenic rice that improves the fruit set rate during the heading and flowering stages of rice. The method comprises using transgenic technology to transform a nucleotide sequence encoding the RE4 gene into a recipient rice, thereby increasing the expression level of the RE4 gene in the recipient rice, and obtaining a transgenic rice that is resistant to high temperatures during the heading and flowering stages.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] The present invention identifies the encoding gene RE4 associated with high temperature resistance during the heading and flowering stages of rice. When the function of this gene is enhanced or its expression is increased, heat-tolerant rice can be obtained. The present invention experimentally demonstrates that the gene RE4 or the protein it encodes plays an important role in controlling high temperature resistance during the heading and flowering stages of rice. The present invention not only provides a basis for further elucidating the molecular mechanism of rice heat resistance, but also provides new genetic resources and breeding resources for rice breeding. The transgenic rice with the RE4 gene enhanced obtained by the present invention, as a new rice germplasm material, can be used to study the mechanism of high temperature resistance during the heading and flowering stages of rice and to discover more genes that regulate high temperature resistance during the heading and flowering stages of rice. This has important application value for effectively regulating rice heat resistance through genetic breeding and genetic engineering methods using this genetic resource. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Schematic diagram of the comparison of RE4 gene expression levels in different plants;

[0020] Figure 2 Schematic diagram of the comparison results of the fruit set rate of different plants under high temperature environment (A is a bar graph of fruit set rate, B is a photo of fruit set rate). DETAILED DESCRIPTION

[0021] In order to better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0022] Example 1 Construction of Overexpression Vector of Rice High-Temperature Tolerance Gene RE4 During Heading and Flowering

[0023] 1. Acquisition of RE4 gene

[0024] Using the DNA of LOC_Os04g52870 from the heat-tolerant rice N22 as a template, the target gene was amplified by PCR using the following primers: primer1 and primer2:

[0025] primer1: 5'ATGGACTTTGATTGCAAAA3' (SEQ ID No: 2);

[0026] primer2: 5'CTAAGACTTGACCTTATCATT 3' (SEQ ID No: 3).

[0027] The PCR product was recovered and purified, and then connected to the Zero sequencing vector (purchased from Beijing Quanshijin Company). The Zero sequencing vector was transformed into DH5α competent cells, and positive clones were selected and sequenced.

[0028] 2. Sequencing

[0029] The sequencing results showed that the nucleotide sequence of the amplified PCR product was shown in SEQ ID No: 1, with a length of 1689 bp. It is named as RE4 gene in the present invention, and its specific nucleotide sequence is as follows:

[0030]

[0031] 3. Construction of RE4 overexpression vector (recombinant expression vector PMDC32-RE4)

[0032] 1. The cDNA of the heat-resistant rice N22 was amplified using primers 1 and 2 to obtain the RE4 gene sequence, which was then ligated into the Zero vector to obtain the Zero-RE4 recombinant vector. The Zero-RE4 recombinant vector was then digested with the restriction endonucleases KpnI and PacI to obtain the RE4 gene fragment.

[0033] 2) Digesting the expression vector PMDC32 with the restriction endonucleases Kpn I and Pac I to obtain a linear expression vector PMDC32, and recovering the linear fragment; integrating the RE4 gene fragment into the linear expression vector PMDC32 using homologous recombination directional cloning (for specific methods, refer to the PMDC32 instruction manual) to obtain homologous recombination product 1, and then transforming the homologous recombination product 1 into DH5α competent cells and culturing at 37°C overnight to obtain the recombinant vector PMDC32-RE4;

[0034] 3) The recombinant vector PMDC32-RE4 obtained in step 2) was sequenced. The results showed that the recombinant vector PMDC32-RE4 was a nucleotide sequence as shown in SEQ ID No: 1 inserted in the forward direction of the Kpn I restriction site of the expression vector PMDC32, that is, the DNA sequence between the Kpn I and PacI recognition sites (recognition sequence) of PMDC32 was successfully replaced with the DNA sequence as shown in SEQ ID No: 1, indicating that the recombinant vector PMDC32-RE4 was successfully constructed.

[0035] 4) Heat shock transformation of Escherichia coli

[0036] Take 5 μL of the recombinant vector PMDC32-RE4 and transform Escherichia coli using the heat shock method. The specific steps refer to the Tiangen transformation kit.

[0037] 5) Bacterial liquid PCR verification

[0038] Single colonies were picked as templates for PCR amplification in an ultra-clean workbench, using the Taq DNA polymerase PCR amplification system and procedure.

[0039] 6) Plasmid extraction assay: Refer to the instructions of the Tiangen Plasmid Extraction Kit to extract the plasmid and detect the concentration.

[0040] Example 2 Cultivation and identification of transgenic plants overexpressing the RE4 gene

[0041] 1. Cultivation of genetically modified plants:

[0042] The recombinant vector PMDC32-RE4 was transformed into 9311 rice through Agrobacterium tumefaciens EHA105. The specific method is as follows:

[0043] 1. The recombinant vector PMDC32-RE4 obtained in Example 1 was introduced into Agrobacterium tumefaciens EHA105 by heat shock method to obtain recombinant Agrobacterium tumefaciens EHA105;

[0044] Recombinant Agrobacterium tumefaciens EHA105 was cultured at 28°C for 16 h, and the cells were collected. The cells were diluted with N6 liquid medium (Sigma, catalog number C1416) containing 100 μM acetosyringone to obtain a diluted bacterial solution with an OD600 of ≈0.5.

[0045] 2. Mixing embryogenic callus of 9311 rice mature embryos cultured for one month with the diluted bacterial solution obtained in step 1, infecting for 30 minutes, absorbing the bacterial solution with filter paper, and transferring to N6 solid co-cultivation medium, co-cultivating at 24° C. for 3 days to obtain co-cultivated callus;

[0046] 3. The callus tissue from step 2 was inoculated onto N6 solid screening medium containing 150 mg / L hygromycin (hygromycin was added to N6 solid screening medium to obtain N6 solid screening medium, and the mass concentration of hygromycin in N6 solid screening medium was 150 mg / L) for the first screening;

[0047] 4. On the 16th day after the first screening, healthy calli were selected and transferred to N6 solid screening medium containing 200 mg / L hygromycin (hygromycin was added to N6 solid screening medium to obtain N6 solid screening medium, and the mass concentration of hygromycin in N6 solid screening medium was 200 mg / L) for a second screening. Subculture was performed every 15 days for a total of one subculture to obtain resistant calli;

[0048] 5. Select the resistant callus obtained in step 4 and transfer it to differentiation medium containing 150 mg / L hygromycin (differentiation medium: 2 mg 6-BA, 0.2 mg NAA, 4 g N6, 1 g casein hydrolyzate, 0.1 g inositol, 25 g sucrose, 2.4 g sorbitol, 7 g agar powder, 1 L deionized water) for differentiation. Culture at 24°C for 45 days (at which point the plant's aerial height is approximately 15 cm). Open the bottle cap and harden the seedlings for 3 days. Then transplant them to the greenhouse for cultivation. These are the PMDC32-RE4-transformed plants (T0 generation). Different transformation events are designated N-OE1, N-OE2, and N-OE3, representing overexpression-positive plants transformed with the recombinant vector PMDC32-RE4, respectively.

[0049] 2. Identification of transgenic plant genotypes

[0050] Genomic DNA was extracted from the T0 generation seedlings of the above-mentioned N-OE1, N-OE2, and N-OE3 plants and the seedlings of the recipient parent 9311 rice plants, respectively, and PCR molecular detection was performed using the following primers to identify positive seedlings: homozygous plants with sequence mutations were positive seedlings of the above-mentioned N-OE1, N-OE2, and N-OE3 plants.

[0051] primer3: 5'ATTTCCGACCCAAAGAAAAAATG 3' (SEQ ID No: 4)

[0052] primer4: 5'CCCCCCACCTTTCACAGTAGA 3' (SEQ ID No: 5)

[0053] PCR system:

[0054] PCR SuperMix (+dye) 5μl, 100ng / ml primer3 1μl, primer4 1μl, DNA 1μl, ddH2O 2μl;

[0055] Amplification procedure:

[0056] 94℃2min;

[0057] ↓

[0058] 98℃10sec;

[0059] 55℃30sec;

[0060] 68℃1min. / kb 25~40cycles.

[0061] 3. Identification of RE4 gene expression levels in transgenic plants:

[0062] RNA was extracted from the leaves of the above-mentioned N-OE1, N-OE2, N-OE3 plants and the recipient parent 9311 plant, respectively. Actin was set as the internal reference. Fluorescence quantitative PCR reaction was performed using the internal reference primers Actin-F and Actin-R, and the RE4 gene-specific quantitative primers primer3 and primer4 to detect changes in the expression level of the RE4 gene in transgenic plants.

[0063] The results showed that Figure 1 As shown, the expression levels of the RE4 gene in the positive plants N-OE1, N-OE2, and N-OE3 transformed with the recombinant vector PMDC32-RE4 were significantly higher than that of the control (9311). The internal reference primers are as follows:

[0064] Actin-F: 5'-ATTTGGCACCACACATTCTAC-3' (SEQ ID No: 6)

[0065] Actin-R: 5'-ATAACCTTCGTAGATTGGGACT-3' (SEQ ID No: 7)

[0066] 4. Phenotypic identification of transgenic plants

[0067] The above-mentioned N-OE1, N-OE2, N-OE3 transgenic plants and the recipient parent rice 9311 plants were planted at the base respectively. There were 2 seedlings per hole, and the plant spacing was 16.7cm×20cm. When the rice began to panicle, the single ears (3 to 5 per hole, not flowering) with relatively consistent growth were marked with labels and moved into plastic pots for planting, with 3 holes per pot and three repetitions. Three pots of each variety were moved into an artificial climate chamber for high temperature stress treatment. The high temperature was 38.0±0.5℃, the relative humidity was maintained at about 75%, and the light duration was 12h (7:00-19:00). Plants grown under natural conditions were used as controls for each high temperature treatment variety. The high temperature treatment time was 9:30-15:30 every day, and the temperature was maintained at 28℃ during other time periods. After 3 days of high temperature treatment, the seeds were moved from the artificial climate chamber to the field to continue growing until maturity. After maturity, the marked single ears were tested, and the fruit set rate was measured and the observation results were as follows. Figure 2 Compared with the recipient parent rice 9311 plants, PMDC32-RE4 overexpressing plants (N-OE1, N-OE2, N-OE3) all showed a phenotype of higher rice fruit set rate than the control, which proved that the RE4 gene is involved in controlling the high temperature resistance of rice during the heading and flowering periods, that is, the RE4 gene is a gene related to high temperature resistance during the heading and flowering periods of rice.

[0068] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A rice gene RE4 for high temperature tolerance during heading and flowering, characterized in that: The gene has the following nucleotide sequence (a) or (b): (a) the nucleotide sequence shown in SEQ ID No: 1; (b) The nucleotide sequence shown in SEQ ID No: 1 is generated by adding, substituting or deleting one or more bases, and encodes a nucleotide sequence of a functional protein for high temperature resistance during the heading and flowering stages of rice.

2. Use of the RE4 gene according to claim 1 in regulating the high temperature resistance and fruit setting rate of rice during the heading and flowering stages.

3. The use according to claim 2, characterized in that The seed setting rate of rice during the heading and flowering stages is increased by overexpressing the RE4 gene.

4. A protein for increasing the rice seed setting rate during the heading and flowering stages of rice, characterized in that: The protein is encoded by the gene according to claim 1.

5. Use of the protein according to claim 4 in improving the rice seed setting rate during the heading and flowering stages.

6. A recombinant vector, characterized in that Contains the gene according to claim 1.

7. A biomaterial, characterized in that Contains the recombinant vector according to claim 6.

8. The biomaterial according to claim 7, characterized in that The biological material is a recombinant microorganism, a transgenic plant cell line or a transgenic plant tissue; the recombinant microorganism is a bacterium, yeast, algae or fungus; the bacterium is one of Escherichia, Erwinia, Agrobacterium tumefaciens, Flavobacterium, Alcaligenes, Pseudomonas or Bacillus.

9. Use of the recombinant vector according to claim 6 or the recombinant microorganism according to claim 7 for increasing the seed setting rate of rice during the heading and flowering period.

10. A method for cultivating transgenic rice for improving the rice seed setting rate during the heading and flowering stages, characterized in that: The method comprises the steps of utilizing transgenic technology to transform a nucleotide sequence encoding the RE4 gene into a recipient rice, thereby increasing the expression level of the RE4 gene in the recipient rice and obtaining a transgenic rice that is resistant to high temperatures during the heading and flowering stages.

Images