Grape gene VlPAT2, method for improving grape gray mold resistance and application of grape gene VlPAT2
By cloning and overexpressing the grape gene VlPAT2, the problem of insufficient resistance to gray mold to grape varieties is solved, the plants are enhanced in oxidation resistance and disease resistance, and genetic resources and theoretical support are provided for grape disease-resistant molecular breeding.
Patent Information
- Application Number
- CN202510674229.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-23
- Publication Date
- 2025-08-12
AI Technical Summary
The existing grape varieties have poor resistance to grey mold, resulting in serious production losses and lack of effective genetic resources and molecular breeding methods to enhance disease resistance.
The grape gene VlPAT2 was cloned and overexpressed, and introduced it into grapes and Arabidopsis through Agrobacterium-mediated genetic transformation, using the antioxidant ability of this gene to enhance the resistance of plants to grey mold.
It significantly enhances the resistance of plants to grey mold, reduces the degree of leaf necrosis, provides the theoretical basis and genetic resources for molecular breeding, and promotes the cultivation of grape disease-resistant varieties.
Smart Images

Figure CN120464643A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of plant genetic engineering, and in particular relates to a grape gene VlPAT2 and a method and application thereof for enhancing the grape gray mold resistance. Background Art
[0002] Gray mold is one of the most common fungal diseases in grape production, significantly hindering the healthy development of the grape industry. The disease can infect grape leaves, inflorescences, and fruit, causing widespread fruit drop and yield reductions of up to 50%. Currently, most widely cultivated varieties worldwide are high-quality European grapes, but these have poor disease resistance and are susceptible to gray mold. Therefore, identifying key genes that confer resistance to gray mold in grapes and studying their functions and regulatory mechanisms is crucial for molecular breeding of grape varieties for disease resistance.
[0003] PAT transcription factors are a class of plant-specific transcription factors in the transcription factor family, and their GRAS (Gene-associated Activated Transcription Factors) have attracted considerable attention. PAT transcription factors are widely distributed in plants and play important roles in rhizome development, meristem formation, gibberellin signaling, light signaling, and biotic and abiotic stress responses. PAT transcription factors integrate multiple hormone signals, such as auxin and gibberellin, and interact with ABA signaling to regulate plant growth and development and stress tolerance, ensuring appropriate growth and physiological responses under diverse environmental conditions. For example, in wild grape (Vitis amurensis), VaPAT1 is induced by low temperatures, and heterologous expression of VaPAT1 enhances cold tolerance in Arabidopsis. Overexpression of VaPAT1 in grape callus also enhances cold tolerance. The GRAS transcription factor gene BpPAT1 in birch (Betula platyphylla) confers salt tolerance. Studies have shown that overexpression of BpPAT1 in birch significantly enhances peroxidase (POD) and superoxide dismutase (SOD) activities, increases proline content in birch tissue, decreases electrolyte permeability and malondialdehyde content, and thus improves ROS scavenging capacity, effectively enhancing salt tolerance. NtGRAS1 participates in signal transduction pathways in tobacco (Nicotiana tabacum) and regulates stress tolerance by increasing reactive oxygen species (ROS) levels under various environmental stresses (Czikkel and Maxwell, 2007). These results demonstrate that different GRAS transcription factors have distinct functions in plants, and the discovery of novel transcription factors and the elucidation of their biological functions are of great research significance. Grape, as an important fruit crop, is more susceptible to adverse stresses than other fruit trees. However, research on the role of grape PAT gene in plant stress response is still in its infancy, especially in enhancing plant disease resistance, with few reports.
[0004] In view of the above factors, a grape gene VlPAT2 and a method and application thereof for controlling the gray mold resistance of grapes are provided. The cloned VlPAT2 gene of the present invention has the function of controlling plant resistance to gray mold and can be applied to grape disease resistance research, molecular marker-assisted breeding and improvement of genetic traits in the field of genetic engineering, laying the foundation for molecular breeding of grape disease resistance. Summary of the Invention
[0005] The object of the present invention is to provide a grape gene VlPAT2 and a method and application thereof for enhancing the grape gray mold resistance, so as to solve the problems raised in the above background technology.
[0006] The object of the present invention is achieved by the following technical scheme: a grape gene VlPAT2 is isolated and identified from grapes, and the gene VlPAT2 is constructed into an overexpression vector, the grape gene VlPAT2 is inserted into the overexpression vector, and the gene VlPAT2 is introduced into "Red Globe" grape leaves and Arabidopsis thaliana through Agrobacterium-mediated genetic transformation to obtain transgenic plants;
[0007] The DNA sequence of the gene V1PAT2 is shown in SEQ ID NO.1;
[0008] The amino acid sequence of the protein encoded by the isolated grape gene V1PAT2 is shown in SEQ ID NO.2.
[0009] A primer for overexpression of the grape gene V1PAT2 amplified gene, the primer sequence is as follows:
[0010] VlPAT2-2300-F:
[0011] ATCCAAAGAATTCCCCGGTACCATGGCATCGGGGGATTACTCGCAGG;
[0012] VlPAT2-2300-R:
[0013] CATGATCTTTGTAATCCTCGAGTTAATAAAAAGGAGGGTGAGAAGAA.
[0014] A recombinant vector comprising the grape gene VlPAT2 is constructed by inserting the grape gene VlPAT2 into an overexpression vector, and the vector is a plant overexpression vector.
[0015] Furthermore, the plant expression vector is a pCAMBIA-2300 series vector.
[0016] Furthermore, the host cell of the recombinant vector is an Agrobacterium cell, and the Agrobacterium cell is Agrobacterium tumefaciens.
[0017] A method for improving the gray mold resistance of grapes based on the grape gene VlPAT2 comprises introducing the grape gene VlPAT2 into grape cells, tissues or plants to express the gene, thereby obtaining grape cells, tissues or plants with improved gray mold resistance.
[0018] Furthermore, a method for improving the gray mold resistance of grapes based on the grape gene VlPAT2 includes a method for subcellular localization of the gene VlPAT2, specifically comprising: designing specific primers with restriction enzyme sites to amplify the CDS sequence of the gene VlPAT2, integrating the gene VlPAT2 into the subcellular localization vector pCAMBIA2300-35S-GFP by homologous recombination, constructing the pCAMBIA2300-35S-VlPAT2-GFP recombinant plasmid, and transforming it into Agrobacterium GV3101 by heat shock method;
[0019] The primer sequences are as follows:
[0020] VlPAT2-2300-GFP-F:
[0021] ACGGGGGACGAGCTCGGTACCATGGCATCGGGGGATTACTCGCAGG;
[0022] VlPAT2-2300-GFP-R:
[0023] GGTGTCGACTCTAGAGGATCCATAAAAAGGAGGGTGAGAAGAAGTT.
[0024] A method for cultivating plants resistant to gray mold, comprising the following steps:
[0025] Constructing an overexpression vector containing the gene V1PAT2;
[0026] Transforming the overexpression vector containing the gene V1PAT2 into competent cells, culturing and then transplanting the cells onto plants via Agrobacterium to obtain a plant strain resistant to gray mold;
[0027] The above-mentioned plant is grape or Arabidopsis thaliana.
[0028] A use of the grape gene VlPAT2, wherein the gene VlPAT2 or the protein encoded by the grape gene VlPAT2 is used to improve plant resistance to gray mold. The gene VlPAT2 or the protein encoded by the grape gene VlPAT2 can promote the removal of active oxygen and improve antioxidant capacity.
[0029] Compared with the prior art, the present invention has the following beneficial effects:
[0030] The present invention discloses a gene VlPAT2 and its application in regulating gray mold resistance, and analyzes the gene in different resistant grape materials.
[0031] The researchers investigated the expression patterns of the VlPAT2 gene in the cultured material after induction by Botrytis cinerea. Using heterologous and transient overexpression, they verified the role of the VlPAT2 gene in regulating resistance to Botrytis cinerea. They found that compared with control leaves, grape leaves overexpressing the VlPAT2 gene exhibited significantly reduced reactive oxygen species bursts and enhanced antioxidant capacity, thereby reducing leaf necrosis and enhancing resistance to Botrytis cinerea. This suggests that the gene can regulate resistance to Botrytis cinerea in grape leaves, providing valuable guidance for the development of new disease-resistant grape varieties. This study will help elucidate the molecular mechanism of the role of the grape transcription factor VlPAT2 in regulating Botrytis cinerea resistance, providing a theoretical basis and genetic resources for molecular breeding of disease-resistant grape varieties.
[0032] For some grape varieties that are extremely susceptible to gray mold during cultivation and production, new disease-resistant varieties can be bred by overexpressing the transcription factor VlPAT2 gene or homologous genes. BRIEF DESCRIPTION OF THE DRAWINGS
[0033] Figure 1 The expression of GRAS family genes in grapes in different resistant materials after treatment with Botrytis cinerea;
[0034] Figure 2 To quantitatively analyze the resistance genes in grape leaves after inoculation with Botrytis cinerea;
[0035] Figure 3 Effects of exogenous H2O2 and SA treatments on 'Beida' grape leaves;
[0036] Figure 4 This is the electrophoresis diagram of the full-length PCR amplification of the VlPAT2 gene;
[0037] Figure 5 For the subcellular localization analysis of VlPAT2 gene;
[0038] Figure 6Figure 1 shows transgenic Arabidopsis lines overexpressing VlPAT2 obtained through genetic transformation. Figure A shows the screening and identification of transgenic positive plants using screening medium. Figure B shows the transplantation of positive plants. Figure C shows the seed collection of transgenic positive lines. Figure D shows the identification of three transgenic positive lines obtained through gene expression analysis at the transcriptional level. Figure E shows the phenotype of Arabidopsis plants inoculated with Botrytis cinerea and the analysis of reactive oxygen species after histochemical staining. The first row, from left to right, shows the genetically transformed empty vectors. Phenotypic diagram of negative control plants obtained after inoculation with Botrytis cinerea and three transgenic Arabidopsis lines (#1, #2, #3) overexpressing VlPAT2 (Vector, EV); the second row shows the results of identifying the O2-type reactive oxygen species content in the leaves of EV-negative control plants and transgenic-positive plants after inoculation with Botrytis cinerea using NBT staining; the third row shows the results of identifying the H2O2-type reactive oxygen species content in the leaves of EV-negative control plants and transgenic-positive plants after inoculation with Botrytis cinerea using DAB staining; Figure F is a quantitative analysis of the specific H2O2 content in the leaves of each plant;
[0039] Figure 7 Figure 1 shows the effect of overexpressing the grape VlPAT2 gene in 'Red Globe' grape leaves on their resistance to gray mold. Figure A shows the disease resistance phenotype of transgenic grape leaves overexpressing OE-VlPAT2 after inoculation with gray mold. Figure B analyzes the expression levels of the grape VlPAT2 gene in leaves of transgenic 'Red Globe' overexpressing VlPAT2, EV negative control, and non-transgenic wild-type 'Red Globe' grapes using quantitative real-time PCR (qRT-PCR). Figure C shows the H2O2 reactive oxygen species content in leaves of the OE-VlPAT2 and EV negative control groups after inoculation with gray mold. Figure D shows the reactive oxygen species content in leaves of the OE-VlPAT2 and EV negative control groups after inoculation with gray mold. The DAB method was used to measure H2O2 reactive oxygen species, while the NBT method was used to measure O2- reactive oxygen species. DETAILED DESCRIPTION
[0040] The present invention will be further described below with reference to specific examples, and the advantages and features of the present invention will become more apparent as the description proceeds. However, the specific experimental methods involved in the following examples, unless otherwise specified, are all conventional methods or are performed under the conditions recommended by the manufacturer's instructions.
[0041] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. The experimental methods in the following examples are all conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can be purchased from the market.
[0042] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those familiar to those skilled in the art. Furthermore, any methods and materials similar or equivalent to those described herein can be applied to the present invention. The preferred embodiments and materials described herein are for illustrative purposes only.
[0043] Unless otherwise indicated, the practice of the present invention will utilize conventional techniques of botany, microbiology, tissue culture, molecular biology, chemistry, biochemistry, DNA recombination, and bioinformatics that are apparent to those skilled in the art and are fully explained in the published literature.
[0044] As used herein, the terms "nucleic acid", "nucleic acid sequence", "nucleotide", and "nucleic acid molecule" are meant to include isolated DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., messenger RNA), natural types, mutant types, synthetic DNA or RNA molecules, DNA or RNA molecules composed of nucleotide analogs, and single-stranded or double-stranded structures. These nucleic acids or polynucleotides include gene coding sequences, antisense sequences, and regulatory sequences of non-coding regions, but are not limited to these. These terms include a gene. "Gene" or "gene sequence" is widely used to refer to a functional DNA nucleic acid sequence. Therefore, a gene may include introns and exons in a genomic sequence, and / or include coding sequences in a cDNA, and / or include cDNA and its regulatory sequences. In specific embodiments, such as with respect to isolated nucleic acid sequences, it is preferably assumed to be cDNA.
[0045] like Figure 1-7 As shown, a grape gene VlPAT2 that confers resistance to gray mold in grapes was isolated and identified from grapes, and an overexpression vector was constructed for the gene VlPAT2. The grape gene VlPAT2 was inserted into the overexpression vector, and the gene VlPAT2 was introduced into "Red Globe" grape leaves and Arabidopsis thaliana via Agrobacterium-mediated genetic transformation to obtain transgenic plants.
[0046] The DNA sequence of the gene V1PAT2 is shown in SEQ ID NO.1;
[0047] The amino acid sequence of the protein encoded by the isolated grape gene V1PAT2 is shown in SEQ ID NO.2.
[0048] A primer for overexpression of the grape gene V1PAT2 amplified gene, the primer sequence is as follows:
[0049] VlPAT2-2300-F:
[0050] ATCCAAAGAATTCCCCGGTACCATGGCATCGGGGGATTACTCGCAGG;
[0051] VlPAT2-2300-R:
[0052] CATGATCTTTGTAATCCTCGAGTTAATAAAAAGGAGGGTGAGAAGAA.
[0053] A recombinant vector comprising the grape gene VlPAT2 is constructed by inserting the grape gene VlPAT2 into an overexpression vector, and the vector is a plant overexpression vector.
[0054] Furthermore, the plant expression vector is a pCAMBIA-2300 series vector.
[0055] Furthermore, the host cell of the recombinant vector is an Agrobacterium cell, and the Agrobacterium cell is Agrobacterium tumefaciens.
[0056] A method for improving the gray mold resistance of grapes based on the grape gene VlPAT2 comprises introducing the grape gene VlPAT2 into grape cells, tissues or plants to express the gene, thereby obtaining grape cells, tissues or plants with improved gray mold resistance.
[0057] Furthermore, a method for improving the gray mold resistance of grapes based on the grape gene VlPAT2 includes a method for subcellular localization of the gene VlPAT2, specifically comprising: designing specific primers with restriction enzyme sites to amplify the CDS sequence of the gene VlPAT2, integrating the gene VlPAT2 into the subcellular localization vector pCAMBIA2300-35S-GFP by homologous recombination, constructing the pCAMBIA2300-35S-VlPAT2-GFP recombinant plasmid, and transforming it into Agrobacterium GV3101 by heat shock method;
[0058] The primer sequences are as follows:
[0059] VlPAT2-2300-GFP-F:
[0060] ACGGGGGACGAGCTCGGTACCATGGCATCGGGGGATTACTCGCAGG;
[0061] VlPAT2-2300-GFP-R:
[0062] GGTGTCGACTCTAGAGGATCCATAAAAAGGAGGGTGAGAAGAAGTT.
[0063] A method for cultivating plants resistant to gray mold, comprising the following steps:
[0064] Constructing an overexpression vector containing the gene V1PAT2;
[0065] Transforming the overexpression vector containing the gene V1PAT2 into competent cells, culturing and then transplanting the cells onto plants via Agrobacterium to obtain a plant strain resistant to gray mold;
[0066] The above-mentioned plant is grape or Arabidopsis thaliana.
[0067] A use of the grape gene VlPAT2, wherein the gene VlPAT2 or the protein encoded by the grape gene VlPAT2 is used to improve plant resistance to gray mold. The gene VlPAT2 or the protein encoded by the grape gene VlPAT2 can promote the removal of active oxygen and improve antioxidant capacity.
[0068] "Gene expression vector" refers to a vector that adds expression elements (such as promoters, terminators, etc.) to the basic skeleton of a cloning vector to enable the expression of the target gene.
[0069] "Agrobacterium-mediated transformation" refers to the technology of inserting the target gene into the modified T-DNA region, using the infection of Agrobacterium to achieve the transfer and integration of exogenous genes into plant cells, and then regenerating transgenic plants through cell and tissue culture technology.
[0070] This study used transcriptome sequencing and qRT-PCR in the disease-resistant grape variety 'Beida' and the susceptible European grape variety 'Red Globe' to screen and analyze highly significantly differentially expressed genes involved in the response to Botrytis cinerea. Candidate genes were cloned and overexpression vectors constructed. Gene function was then verified in tobacco and grape leaves. The results revealed that overexpression of VlPAT2 can alleviate reactive oxygen species (ROS) bursts, enhance antioxidant capacity, and activate the expression of disease-resistance-related genes. The specific experiments are as follows:
[0071] Example 1: Analysis of GRAS gene expression in grapes after treatment with Botrytis cinerea
[0072] This study systematically analyzed the response of 53 GRAS family genes to the inoculation of grape leaves with Botrytis cinerea by analyzing the transcriptome data of the disease-resistant grape variety 'Beida' and the susceptible European grape variety 'Red Globe' obtained in the early stage. qRT-PCR technology was used to detect the expression of these genes in 'Beida' and 'Red Globe' induced by Botrytis cinerea, and the results were displayed in the form of a heat map. Figure 1 As shown, the results preliminarily indicate that VlPAT2 has the strongest response to Botrytis cinerea inoculation in the GRAS gene family and the highest induced up-regulated expression level.
[0073] Example 2: Real-time fluorescence quantitative PCR technology
[0074] Total RNA was extracted from low-temperature treated grape leaves using a plant total RNA extraction kit. HiScript II Q Select RT SuperMix (Novagen, Nanjing) was used for reverse transcription and cDNA synthesis. Detailed procedures were performed according to the kit's instructions.
[0075] qRT-PCR analysis was performed using the SYBR-qPCR-Mix-kit (Novizan, Nanjing) and gene-specific primers. A 20 μL reaction system included: 10 μL 5× qPCR-Mix, 0.4 μL each of upstream and downstream primers, 2 μL cDNA template (diluted 6-fold), and 7.2 μL deionized water.
[0076] The sequences of gene-specific primers (PAT2-F, PAT2-R) and internal reference gene primers (Actin1-F, Actin1-R) are shown below:
[0077] PAT2-F: CTTGAGCTTCGACCAGGAGA;
[0078] PAT2-R:AACCAGCCTCAACAGTCTGT;
[0079] Actin1-F:CAAGAGCGGAAACTGCAAAGA;
[0080] Actin1-R:AATGAGAGATGGCTGGAAGAGG.
[0081] The expression of GRAS family genes in grapes after treatment with Botrytis cinerea Figure 1 As shown in Figure 2, the expression of VlPAT2 gene is relatively high after inoculation with Botrytis cinerea. Among them, the expression of VlPAT2 in grapes is the most prominent and is considered to be the key GRAS gene in grapes in response to Botrytis cinerea infection. In addition, the present invention analyzed the expression of PAT2 in the leaves of 'Beida' and 'Red Globe' grapes after Botrytis cinerea infection. Figure 2 As shown, at different stages of Botrytis cinerea infection, 'Beida' and 'Red Globe' showed similar expression trends. PAT2 expression peaked before 48 hours, reaching 14-fold its initial level. After 48 hours, it gradually declined back to its initial level. The relative expression of PAT2 in 'Beida' differed significantly from that in 'Red Globe'.
[0082] Example 3: Expression analysis of grape transcription factor gene VlPAT2 in response to exogenous H2O2 induction
[0083] The present invention analyzed the expression of VlPAT2 in 'Beida' and 'Red Globe' grape leaves 0-10 hours after H2O2 treatment. The real-time fluorescence quantitative PCR steps, reaction system, procedure and primer sequences were the same as those described in 1.
[0084] The expression of VlPAT2 in response to exogenous H2O2 is shown in Figure 3 As shown, VlPAT2 transcription was activated by H2O2, with its expression significantly increasing 1 hour after treatment and reaching a peak 2 hours after treatment, 22 times higher than the control at the same time. Although it declined thereafter, it still maintained an upward expression trend. This indicates that VlPAT2 can respond to H2O2 and also suggests that VlPAT2 may play a role in disease resistance through the ROS signaling pathway.
[0085] Example 4: Expression analysis of the grape transcription factor gene VlPAT2 in response to exogenous SA induction
[0086] The present invention analyzed the expression of VlPAT2 in 'Beida' and 'Red Globe' grape leaves 0-10 hours after SA treatment. The real-time fluorescence quantitative PCR steps, reaction system, procedure and primer sequences were the same as those described in 1.
[0087] The expression of VlPAT2 in response to exogenous H2O2 is shown in Figure 4 As shown, VlPAT2 transcription was activated by H2O2, with its expression significantly increasing 0.5 h after treatment and reaching a peak 1 h after treatment, 10-fold higher than the control at the same time. Although it subsequently declined, it still maintained an upward trend. This indicates that VlPAT2 can respond to SA and also suggests that VlPAT2 may play a role in disease resistance through the SA signaling pathway.
[0088] Example 5: Sequence analysis of the grape transcription factor gene VlPAT2
[0089] According to the annotation information of Vitis vinifera in the NCBI database, the CDS sequence of Vitis vinifera VvPAT2 was used as a reference and the cDNA of 'Beida' was used as a template. Specific primers were designed using Primer Premier 5.0 to amplify the full-length gene.
[0090] PCR reaction system 50 μL: 2× PhantaFlash MasterMix 25 μL, template cDNA 2 μL, upstream and downstream primers 2 μL each, primer concentration of 10 μmol / L, deionized water 19 μL.
[0091] RCR reaction program: 98°C for 30 s; 35 cycles: 98°C for 10 s, 58°C for 5 s, 72°C for 5 s; 72°C for 2 min.
[0092] The full-length sequence of gene VlPAT2 was obtained by PCR, and the electrophoresis diagram of PCR amplification was shown in FIG. Figure 3 The PCR product was purified and recovered, then ligated with the 2300 vector. The ligation product was heat-shocked into competent E. coli DH5α cells. The bacteria with the correct sequencing results were selected for amplification and culture, and the recombinant plasmid was extracted. The full length of this gene is 1632 bp, and its sequence is shown in SEQ ID NO. 1, encoding 544 amino acids. The amino acid sequence of the transcription factor VlPAT2 encoded by this gene is shown in SEQ ID NO. 2.
[0093] SEQ ID NO.1:
[0094]
[0095] SEQ ID NO.2:
[0096] .
[0097] Example 6: Subcellular Localization Analysis of Grape Transcription Factor VlPAT2
[0098] The present invention uses the pCAMBIA2300-35S-GFP vector for subcellular localization. Specific primers with restriction enzyme cutting sites are designed to amplify the CDS sequence of the VlPAT2 gene, and the VlPAT2 gene is integrated into the pCAMBIA2300-35S-GFP using homologous recombination.
[0099] Vector construction was performed according to the instructions of the Homologous Recombination Kit II One-Step Cloning Kit (Vazyme, China). The pCAMBIA2300-35S-VlPAT2-GFP subcellular localization vector plasmid was transformed into Agrobacterium GV3101. The primer sequences are as follows:
[0100] VlPAT2-2300-GFP-F:
[0101] GAGCTCGGTACCCGGGGATCCATGCAAGCCTCTCAGAAACATGGAA;
[0102] VlPAT2-2300-GFP-R:
[0103] CTTGCTCACCATGGTGTCGACACTCCATGCACAAGCAGCAAC.
[0104] The OD value of the Agrobacterium liquid containing the recombinant plasmid was adjusted to 0.7-0.8, and a 5-week-old Nicotiana benthamiana plant with good growth status was taken and the leaves were covered with
[0105] Injection was performed at 440 nm. After 48 h of incubation at 22°C, 16 h light / 8 h dark, and 60% relative humidity, the cells were observed and photographed using a laser confocal microscope. The subcellular localization of VlPAT2 was investigated using an empty vector (GFP) as a control and pBi221-mCherry red fluorescence as a nuclear localization marker.
[0106] The results of VlPAT2 subcellular localization analysis were as follows: Figure 5 As shown, detection of red fluorescence signals revealed that all cell nuclei were labeled red. Green fluorescence was detected in both the nuclei and cell membranes of control tobacco leaves, while green fluorescence was detected only in the nuclei of tobacco mesophyll cells transiently expressing VlPAT2. In the mixed field, the nuclei of cells transiently expressing VlPAT2 appeared yellow, coinciding with the location of mCherry staining. This indicates that the VlPAT2 gene is localized to the nucleus and functions there.
[0107] Example 7: Verification of the Grape Transcription Factor VlPAT2's Function in Regulating Plant Disease Resistance To investigate whether the VlPAT2 gene regulates grape resistance to gray mold, its function was analyzed and identified by heterologous overexpression in Arabidopsis and transient overexpression and transient silencing in grape leaves.
[0108] 7.1. Construction of plant overexpression vectors
[0109] Specific primers with restriction enzyme sites were designed to amplify the CDS sequence of the VlPAT2 gene. The VlPAT2 gene was then integrated into the overexpression vector 2300 using homologous recombination. Specific vector construction methods were performed according to the instructions for the Homologous Recombination Kit II OneStep Cloning Kit (Vazyme, China). The 2300-VlPAT2 recombinant plasmid was then transformed into Agrobacterium tumefaciens GV3101.
[0110] The primer sequences are as follows:
[0111] VlPAT2-2300-GFP-F:
[0112] GAGCTCGGTACCCGGGGATCCATGCAAGCCTCTCAGAAACATGGAA;
[0113] VlPAT2-2300-GFP-R:
[0114] CTTGCTCACCATGGTGTCGACACTCCATGCACAAGCAGCAAC.
[0115] 7.2. Obtaining transgenic Arabidopsis lines overexpressing VlPAT2
[0116] The present invention integrates 2300-VlPAT2 into Arabidopsis thaliana by Agrobacterium-mediated transformation, and obtains VlPAT2 overexpression candidate plants after resistance screening. Then, the genome level and transcriptional expression level of positive plants are detected by PCR and real-time fluorescence quantitative PCR to obtain a batch of Arabidopsis thaliana plants stably transformed with VlPAT2. Three overexpression lines (OE#1, #2 and #3) with higher expression levels were selected, as shown in FIG. Figure 6 As shown, the empty vector strain (EV) was used as a control to study the resistance of VlPAT2 to gray mold.
[0117] 7.3. Identification of Botrytis Cinerea Resistance in Transgenic Arabidopsis Lines
[0118] Plants of the overexpressing strains OE#1, #2, and #3, as well as the empty vector control EV, were inoculated with Botrytis cinerea and sprayed with a spore suspension. The control was sprayed with sterile water. Samples were collected at 0 and 72 hours after inoculation, and disease resistance was assessed through phenotypic analysis, histochemical staining, and H2O2 enzyme activity.
[0119] The phenotype of Arabidopsis thaliana after overexpression of VlPAT2 gene is as follows Figure 6 As shown in middle E, 72 hours after inoculation with gray mold, EV showed more severe water-soaked symptoms than VlPAT2-OE. At this time, the size of its lesions was significantly larger than that of OE#1, #2, #3 and the empty vector control EV leaves, and large areas of soft rot appeared.
[0120] The results of NBT and DAB tissue staining are as follows Figure 6 As shown in Figure E, the cell death of Arabidopsis leaves was observed 72 hours after inoculation with Botrytis cinerea. The results showed that compared with EV, the leaves of OE group showed darker blue and yellow-brown color. This indicates that after Botrytis cinerea infection, the overexpression of VlPAT2 in Arabidopsis plants produced more ROS, which enhanced the resistance of Arabidopsis leaves to Botrytis cinerea. The quantitative detection results of antioxidant indicators are shown in Figure E. Figure 6As shown in Figure F, at 0 hours after inoculation, the OE strain accumulated significantly more H2O2, significantly higher than the EV strain at the same time, and 1.2 times the amount. Subsequently, at 72 hours, H2O2 accumulation in the OE strain increased significantly and was significantly higher than that in the EV strain at the same time. This result is consistent with the DAB staining results, suggesting that the accumulation of reactive oxygen species may be a specific disease resistance response triggered by the VlPAT2 gene.
[0121] 7.4 Effect of Overexpression of the VlPAT2 Gene on Gray Mold Resistance in Transgenic Grape Leaves
[0122] Agrobacterium GV3101 containing the target gene plasmid and an empty plasmid were activated and cultured, then centrifuged and harvested. The bacterial suspension was resuspended in grapes at an OD600 concentration of 0.7-0.8. Healthy grape leaves were cleaned, air-dried, and then immersed, dorsally facing up, in the resuspended bacterial suspension. A control was treated with the empty bacterial suspension. The leaves were then vacuumed at 0.085 MPa for 30 minutes, then slowly deflated. The bacterial suspension on the leaf surface was wiped dry with sterile filter paper. The petioles were wrapped with damp cotton and placed on a tray, covered with plastic wrap, and placed in a lighted incubator for 24 hours. These leaves were then inoculated with Botrytis cinerea. Grape leaves transformed with the empty vector plasmid, pCAMBIA2300-GFP (EV), served as controls. Disease resistance was assessed by phenotypic analysis, histochemical staining, and H2O2 enzyme activity.
[0123] Phenotypic observation of leaves of grape VlPAT2-overexpressing 'Red Globe' after inoculation with Botrytis cinerea Figure 7 As shown, at 72 hours, distinct lesions were observed on leaves in the EV control group, whereas lesions were less pronounced and significantly smaller on leaves in the OE group. By 120 hours, although the diseased area in the OE group increased, it remained significantly smaller than that in the EV control group. After infection with Botrytis cinerea, not only did the OE group develop disease later than the control, but the lesion area was also consistently significantly smaller than that in the control. This suggests that overexpression of VlPAT2 significantly enhances grapevine resistance to Botrytis cinerea.
[0124] The embodiments described above are only preferred embodiments of the present invention and are only used to explain the present invention, not to limit the scope of implementation of the present invention. For those skilled in the art, it is of course possible to easily make other implementation methods by replacing or changing the technical content disclosed in this specification. Therefore, all changes and improvements made on the principles of the present invention should be included in the scope of the patent application of the present invention.
[0125] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above and that the invention can be embodied in other specific forms without departing from the spirit or essential characteristics of the invention. Therefore, the embodiments should be considered in all respects as illustrative and non-restrictive, and the scope of the invention is defined by the appended claims, not the foregoing description, and all variations within the meaning and range of equivalents of the claims are intended to be included therein. Any reference sign in a claim should not be construed as limiting the claim to which it relates.
[0126] In addition, it should be understood that although this specification is described in terms of implementation methods, not every implementation method contains only one independent technical solution. This narrative method of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment can also be appropriately combined to form other implementation methods that can be understood by those skilled in the art.
Claims
1. A grape gene V1PAT2, characterized in that: The gene VlPAT2, which confers resistance to gray mold in grapes, was isolated and identified from grapes, and an overexpression vector was constructed for the gene VlPAT2. The grape gene VlPAT2 was inserted into the overexpression vector, and the gene VlPAT2 was introduced into "Red Globe" grape leaves and Arabidopsis thaliana through Agrobacterium-mediated genetic transformation to obtain transgenic plants. The DNA sequence of the gene V1PAT2 is shown in SEQ ID NO.1; The amino acid sequence of the protein encoded by the isolated grape gene V1PAT2 is shown in SEQ ID NO.
2.
2. A primer for amplifying the V1PAT2 gene of grape according to claim 1, characterized in that: The primer sequences are as follows: VlPAT2-2300-F: ATCCAAAGAATTCCCCGGTACCATGGCATCGGGGGATTACTCGCAGG; VlPAT2-2300-R: CATGATCTTTGTAATCCTCGAGTTAATAAAAAGGAGGGTGAGAAGAA.
3. A recombinant vector comprising the grape gene V1PAT2 according to claim 1, characterized in that: The recombinant vector is constructed by inserting the grape gene V1PAT2 into an overexpression vector, and the vector is a plant overexpression vector.
4. The recombinant vector of grape gene V1PAT2 according to claim 3, characterized in that: The plant expression vector is a pCAMBIA-2300 series vector.
5. The recombinant vector of grape gene V1PAT2 according to claim 4, characterized in that: The host cell of the recombinant vector is an Agrobacterium cell, and the Agrobacterium cell is Agrobacterium tumefaciens.
6. A method for improving the resistance of grapes to gray mold based on the grape gene V1PAT2, characterized in that: The method comprises introducing the grape gene VlPAT2 according to claim 1 into grape cells, tissues or plants, causing the gene to be expressed, and obtaining grape cells, tissues or plants with improved resistance to gray mold.
7. The method for improving the resistance of grapes to gray mold based on the grape gene V1PAT2 according to claim 6, characterized in that: The invention comprises a method for subcellular localization of gene VlPAT2, specifically comprising: designing specific primers with restriction enzyme cutting sites to amplify the CDS sequence of gene VlPAT2, integrating gene VlPAT2 into subcellular localization vector pCAMBIA2300-35S-GFP by homologous recombination method, constructing pCAMBIA2300-35S-VlPAT2-GFP recombinant plasmid, and transforming into GV3101 Agrobacterium by heat shock method; The primer sequences are as follows: VlPAT2-2300-GFP-F: ACGGGGGACGAGCTCGGTACCATGGCATCGGGGGATTACTCGCAGG; VlPAT2-2300-GFP-R: GGTGTCGACTCTAGAGGATCCATAAAAAGGAGGGTGAGAAGAAGTT.
8. A method for cultivating plants resistant to gray mold, characterized by: The specific steps include: Constructing an overexpression vector containing the gene V1PAT2; Transforming the overexpression vector containing the gene V1PAT2 into competent cells, culturing and then transplanting the cells onto plants via Agrobacterium to obtain a plant strain resistant to gray mold; The above-mentioned plant is grape or Arabidopsis thaliana.
9. A use of the grape gene V1PAT2 according to claim 1, characterized in that: The gene VlPAT2 or the protein encoded by the grape gene VlPAT2 is used to improve plant resistance to gray mold. The gene VlPAT2 or the protein encoded by the grape gene VlPAT2 has the ability to promote the removal of active oxygen and improve antioxidant capacity.