XsARF06.1 gene of xanthoceras sorbifolia bunge and application thereof

Abstract

The invention discloses a xanthoceras sorbifolia XsARF06.1 gene and application thereof, the nucleotide sequence of the xanthoceras sorbifolia XsARF06.1 gene is as shown in SEQ ID NO: 1, and the nucleotide sequence as shown in SEQ ID NO: 1 is introduced into a plant cell; the plant cells are cultured, and the XsARF06.1 gene is over-expressed, so that the content of the auxin in the plant is increased, the growth and development of the xanthoceras sorbifolia bunge are effectively promoted, and the yield and the economic benefit of the xanthoceras sorbifolia bunge are increased. The method comprises the following steps: introducing an RNA (Ribonucleic Acid) interference sequence aiming at the XsARF06.1 gene into a plant cell; according to the present invention, the plant cells are cultured, such that the XsARF06.1 gene is silenced so as to reduce the auxin content of the plant, the effective gene silencing tool is provided for the plant growth and development regulation, the method is particularly suitable for the fine regulation of the auxin content and the related gene function research, and the application of the RNAi technology in the gene function analysis of the xanthoceras sorbifolia bunge is expanded.

Description

Technical Field

[0001] The present invention belongs to the field of plant molecular biology and genetic engineering technology, and specifically relates to an isolated nucleotide sequence of the Xanthoceras sorbifolia XsARF06.1 gene, a recombinant vector containing the sequence, a recombinant host cell containing the recombinant vector, a method for regulating the auxin content of Xanthoceras sorbifolia plants using the gene sequence, and related primer combinations. Background Art

[0002] Xanthoceras sorbifolia Xanthoceras sorbifolium Bunge (Bunge) is a woody oilseed tree endemic to China, possessing significant economic and ecological value. Its low female flower ratio results in a low fruit set rate, severely impacting fruit yield and industrial development. Auxin (IAA), a key plant hormone, significantly regulates plant growth and development, including pistil morphogenesis. Genetic engineering techniques, including the regulation of gene expression related to the auxin signaling pathway, can influence auxin content and distribution, thereby altering plant growth and developmental characteristics.

[0003] The auxin response factor (ARF) encoded by the XsARF06.1 gene responds to auxin signals and regulates the expression of downstream genes, thereby influencing plant growth and development. Studies have shown that the expression level of the XsARF06.1 gene is closely correlated with auxin content. Modulating the expression of the XsARF06.1 gene can alter auxin content and signaling within plant cells, thereby influencing plant growth and development, such as increasing the proportion of female flowers and fruit yield.

[0004] However, there are few reports on the detailed functional studies and applications of the XsARF06.1 gene in Xanthoceras sorbifolia. Developing a method to effectively regulate the expression of the XsARF06.1 gene in Xanthoceras sorbifolia is of great practical significance for improving the yield and quality of Xanthoceras sorbifolia. Furthermore, providing corresponding primer combinations provides important technical support for experimental procedures such as gene detection and cloning, and the construction of RNAi silencing vectors, TRV silencing vectors, and overexpression vectors. Summary of the Invention

[0005] In view of this, the present invention aims to regulate the content of Xanthoceras sorbifolia auxin (IAA) through genetic manipulation to promote plant growth and increase yield. At the same time, primer combinations for corresponding gene detection, cloning, RNAi silencing vector construction, TRV silencing vector construction, and overexpression vector construction are provided.

[0006] The inventors have continuously innovated and explored the above technical problems through long-term exploration and attempts, as well as multiple experiments and efforts. The technical solution provided by the present invention is to provide an isolated nucleotide sequence, wherein the sequence is selected from any one of the following: (1) the nucleotide sequence shown in SEQ ID NO: 1, (2) a nucleotide sequence complementary to SEQ ID NO: 1; (3) A variant having more than 90% homology with SEQ ID NO: 1 and capable of regulating the auxin content of Xanthoceras sorbifolia.

[0007] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides an isolated nucleotide sequence of the XsARF06.1 gene from Xanthoceras sorbifolia. By regulating the expression of this gene, the content of auxin (IAA) in Xanthoceras sorbifolia can be effectively altered. Specifically, by overexpressing the XsARF06.1 gene, the auxin content can be significantly increased, thereby promoting the growth and development of Xanthoceras sorbifolia, increasing the proportion of female flowers and fruit yield. This innovative gene regulation method provides a new technical means for the genetic improvement of Xanthoceras sorbifolia, helping to address the issues of low female flower proportion and low fruit set rate in Xanthoceras sorbifolia, and is of great significance for increasing the agricultural output value and ecological benefits of Xanthoceras sorbifolia.

[0008] The present invention also provides a recombinant vector comprising the nucleotide sequence shown in SEQ ID NO: 1 and a vector backbone.

[0009] Compared with the prior art, the present invention has the following beneficial effects: The recombinant vector provided by the present invention achieves efficient expression or silencing of the XsARF06.1 gene of Xanthoceras sorbifolia by combining the nucleotide sequence shown in SEQ ID NO: 1 with the vector backbone, providing a powerful tool for precisely regulating the auxin content of Xanthoceras sorbifolia, and helping to improve the growth and development efficiency and fruit yield of Xanthoceras sorbifolia.

[0010] The present invention also provides a recombinant host cell, which contains the recombinant vector.

[0011] Compared with the prior art, the present invention has the following beneficial effects: The recombinant host cell provided by the present invention achieves efficient expression or silencing of the XsARF06.1 gene of Xanthoceras sorbifolia by carrying a recombinant vector, providing a stable cell platform for conducting research on the precise regulation of auxin content in Xanthoceras sorbifolia, and helping to promote genetic improvement and functional genomics research of Xanthoceras sorbifolia.

[0012] The present invention also provides a method for changing the auxin content of a plant by regulating the expression of the Xanthoceras sorbifolia XsARF06.1 gene, comprising the following steps: introducing the nucleotide sequence shown in SEQ ID NO: 1 into a plant cell; The plant cells are cultured to overexpress the XsARF06.1 gene, thereby increasing the plant auxin content.

[0013] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides a method for changing the auxin content of Xanthoceras sorbifolia by regulating the expression of the XsARF06.1 gene. By introducing the nucleotide sequence shown in SEQ ID NO: 1 into plant cells and overexpressing it, the auxin content can be significantly increased, thereby effectively promoting the growth and development of Xanthoceras sorbifolia and improving its yield and economic benefits.

[0014] The present invention also provides a method for reducing the auxin content of a plant by silencing the expression of the Xanthoceras sorbifolia XsARF06.1 gene through RNA interference, comprising the following steps: introducing an RNA interference sequence targeting the XsARF06.1 gene into plant cells; The plant cells are cultured to silence the XsARF06.1 gene, thereby reducing the plant auxin content.

[0015] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides a new method for silencing the expression of the XsARF06.1 gene in Xanthoceras sorbifolia by RNA interference technology, which achieves the precise reduction of plant auxin content and provides an effective gene silencing tool for regulating plant growth and development. It is particularly suitable for fine regulation of auxin content and research on related gene functions, and expands the application of RNAi technology in the analysis of Xanthoceras sorbifolia gene functions.

[0016] The present invention also provides a second primer combination for detecting the expression of the Xanthoceras sorbifolia XsARF06.1 gene, wherein the primer combination comprises the following primer sequences: Second upstream primer: 5′-tgctatgccacagttcacttcagtc-3′; Second downstream primer: 5'-atagggctcgtcacagggttcc-3'.

[0017] Compared with the prior art, the present invention has the following beneficial effects: This primer combination is highly specific and can accurately identify and amplify the XsARF06.1 gene of Xanthoceras sorbifolia, providing a reliable tool for gene expression research and promoting research progress in the field of auxin regulation and gene function analysis of Xanthoceras sorbifolia.

[0018] The present invention also provides a third primer combination for constructing a Xanthoceras sorbifolia XsARF06.1 gene overexpression vector, wherein the primer combination comprises the following primer sequences: Third upstream primer: 5'-acgggggactctagaggatccATGAGGCTCTCTTCGGCTGG-3'; The third downstream primer: 5'-gcccttgctcaccatggtaccGTAATCCAGAGACCCCACCGA-3'.

[0019] Compared with the prior art, the present invention has the following beneficial effects: This primer combination can efficiently and specifically amplify the sequence of the XsARF06.1 gene of Xanthoceras sorbifolia, ensuring that the constructed overexpression vector is stably and efficiently expressed in plant cells, providing key technical support for increasing the auxin content of Xanthoceras sorbifolia and promoting its growth and development.

[0020] The present invention also provides a fourth primer combination for cloning the Xanthoceras sorbifolia XsARF06.1 gene, wherein the primer combination comprises the following primer sequences: Fourth upstream primer: 5′-gatgaatctggtttcctgca-3′; Fourth downstream primer: 5'-ggcggtgagagtattttgat-3'.

[0021] Compared with the prior art, the present invention has the following beneficial effects: This primer combination has strong specificity and high amplification efficiency, and can quickly and accurately amplify the XsARF06.1 gene of Xanthoceras sorbifolia, providing an efficient tool for subsequent gene cloning and functional research, and significantly improving the accuracy and repeatability of the experiment.

[0022] The present invention also provides a primer combination for constructing an RNAi silencing vector for the Xanthoceras sorbifolia XsARF06.1 gene, wherein the primer combination comprises the following primer sequences: Sense fragment Cis primer set: Cis-F: 5'-gcaggtatttggatcGATGAATCTGGTTTCCTGCA-3'; Cis-R: 5'-taattaactctctagGGCGGTGAGAGTATTTTGAT-3'; Antisense fragment Anti primer set: Anti-F: 5'-catcgattgggcgcgGATGAATCTGGTTTCCTGCA-3'; Anti-R: 5'-gctcggtaccggatcGGCGGTGAGAGTATTTTGAT-3'.

[0023] Compared with the prior art, the present invention has the following beneficial effects: This primer combination is cleverly designed and can efficiently amplify specific fragments used to construct RNAi silencing vectors, ensuring the efficiency and specificity of the RNAi system in silencing the XsARF06.1 gene in Xanthoceras sorbifolia. It provides a powerful tool for studying gene function and regulatory mechanisms, and promotes the application of Xanthoceras sorbifolia genetic engineering in controlling auxin content.

[0024] The present invention also provides a fifth primer combination for constructing a TRV silencing vector for the XsARF06.1 gene of Xanthoceras sorbifolia, wherein the primer combination comprises the following primer sequences: Fifth upstream primer: 5′-taccgaattctctagGATGAATCTGGTTTCCTGCA-3′; Fifth downstream primer: 5′-gctcggtaccggatcGGCGGTGAGAGTATTTTGAT-3′.

[0025] Compared with the prior art, the present invention has the following beneficial effects: This primer combination has high specificity and efficiency, and can accurately amplify specific fragments used to construct TRV silencing vectors. It provides a powerful tool for studying the function of the XsARF06.1 gene in Xanthoceras sorbifolia through virus-induced gene silencing technology, enhancing the gene silencing efficiency and research accuracy. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. It should be understood that the following drawings only illustrate certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without paying any creative work.

[0027] Figure 1 This is the RNA electrophoresis diagram of Xanthoceras sorbifolia flower buds.

[0028] Figure 2 It is the clone of XsARF06.1 gene. Figure 2 In the figure, lane M is DL1,000 DNA Marker, and lanes 1 and 2 represent XsARF06.1 gene.

[0029] Figure 3This is the result of gene expression detection in XsARF06.1-OE transgenic tobacco leaves.

[0030] Figure 4 is the IAA and JA content in the leaves of XsARF06.1 transgenic tobacco; Figure 4 In the figure, A is the IAA content in the leaves of XsARF06.1 transgenic tobacco; B is the JA content in the leaves of XsARF06.1 transgenic tobacco.

[0031] Figure 5 This is a schematic diagram of the restriction enzyme cutting sites of the pFGC5941 vector.

[0032] Figure 6 This is a TRV2 plasmid map.

[0033] Figure 7 This is the electrophoresis diagram of XsARF06.1-RNAi Agrobacterium colony PCR detection. Figure 7 In the figure, M stands for DL1,000 DNA Marker.

[0034] Figure 8 This is the electrophoresis diagram of PCR detection of XsARF06.1-TRV Agrobacterium colonies. Figure 8 In the figure, M stands for DL1,000 DNA Marker.

[0035] Figure 9 is the gene expression level in the kernel of XsARF06.1 transgenic Xanthoceras sorbifolia. Figure 9 In the figure, A is the gene expression level in the seed kernel of Xanthoceras sorbifolia with XsARF06.1 silenced; B is the gene expression level in the seed kernel of Xanthoceras sorbifolia with XsARF06.1 overexpressed.

[0036] Figure 10 It is the IAA content of XsARF06.1 transgenic Xanthoceras sorbifolia seed kernels. Figure 10 In the figure, A is the IAA content in the kernels of Xanthoceras sorbifolia overexpressing XsARF06.1; B is the IAA content in the kernels of Xanthoceras sorbifolia after VIGS virus silencing XsARF06.1; C is the IAA content in the kernels of Xanthoceras sorbifolia after RNA interference silencing XsARF06.1. DETAILED DESCRIPTION

[0037] The following describes the details in conjunction with specific embodiments.

[0038] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention. Therefore, the following detailed description of the embodiments of the present invention is not intended to limit the scope of the invention claimed for protection, but merely represents selected embodiments of the present invention.

[0039] In the present invention, unless otherwise specified, all equipment and raw materials can be purchased from the market or are commonly used in the industry. The methods in the following embodiments, unless otherwise specified, are all conventional methods in the art.

[0040] In this embodiment, the Xanthoceras sorbifolia XsARF06.1 gene sequence is shown as SEQ ID NO: 1.

[0041] In this example, a series of primers were designed for the Xanthoceras sorbifolia XsARF06.1 gene and used in this example, as shown in Table 1.

[0042] Table 1: In Table 1, the first primer set is used for gene cloning, the second primer set is used for overexpression vector construction, the third primer set is used for real-time fluorescence quantitative PCR of Xanthoceras sorbifolia mRNA, the fourth primer set is used for target fragment cloning (silencing), the Cis primer set is used for RNAi silencing vector construction (sense fragment Cis), the Anti primer set is used for RNAi silencing vector construction (antisense fragment Anti), and the fifth primer set is used for TRV silencing vector construction.

[0043] (1) Plant materials In this embodiment, the Xanthoceras sorbifolia flower buds used were collected from the Xanthoceras sorbifolia base (120°16′E, 41°25′N) in Chaoyang City, Liaoning Province from April 15 to May 3, 2022. The region has a temperate continental monsoon climate with an average annual temperature of 8.5°C, a minimum temperature of -28°C, a maximum temperature of 39°C, a large temperature difference between day and night, an average annual precipitation of 489 mm, an average annual sunshine duration of 2860 hours, a frost-free period of 158 days, and a soil type dominated by brown soil. During sampling, the top and lateral flower buds of Xanthoceras sorbifolia were collected from the east, west, south, and north directions, mixed evenly, and placed in tinfoil bags with detailed collection information. The mixed flower buds were quickly frozen with liquid nitrogen and placed in a -80°C ultra-low temperature freezer for long-term storage.

[0044] The research team previously observed the tissue morphology and structure of the pistil (M) of male flowers and the pistil (F) of female flowers through paraffin sections. The results showed that: before April 22 was the early stage of pistil abortion, at this time, there was no significant structural difference in the pistil in the male and female flower buds of Xanthoceras sorbifolia; from April 24 to April 29 was the middle stage of pistil abortion, at this time, the pistil of the male flower of Xanthoceras sorbifolia gradually degenerated and aborted, the stigma, ovary and ovules gradually atrophied, while the pollen was plump and germination pores appeared, while the ovary and ovules of the female flower pistil further developed, obvious papillary cells appeared on the stigma, the pollen was vacuolated and decayed, and some pollen grains did not have formed and visible nuclei; after April 30 was the late stage of pistil abortion, at this time the pistil of the male flower completely degenerated and the ovules were invisible, while the pistil of the female flower was well developed, and the ovary and ovules were plump.

[0045] The Nicotiana benthamiana seeds and wild Xanthoceras sorbifolia seeds used in this example were stored in a seed cabinet by the research team. Wild Xanthoceras sorbifolia grows between 40°25′N and 42°22′N, and 118°50′E and 121°17′E.

[0046] Example 1 This example describes RNA extraction and reverse transcription from Xanthoceras sorbifolia flower buds.

[0047] 1. Total RNA Extraction Take an appropriate amount of Xanthoceras sorbifolia flower bud tissue and grind it into powder with liquid nitrogen.

[0048] Follow the instructions of the Universal Plant RNA Rapid Extraction Kit. The specific steps are as follows: Pipette 500 μL of RPA lysis buffer into a 1.5 mL sterile centrifuge tube. Transfer the ground sample material to the lysis system and immediately vortex for 20 seconds to ensure complete tissue lysis and form a homogenous suspension.

[0049] The lysate mixture was centrifuged at 13,000 × g for 10 min, and 400 μL of the clear supernatant was transferred to a new centrifuge tube.

[0050] Add 200 μL of anhydrous ethanol and immediately mix by pipetting repeatedly.

[0051] The mixture was transferred to an RA adsorption column and centrifuged at 13,000 × g for 3 minutes. The waste liquid was discarded. 350 μL of RW1 deproteinization buffer was then added. After standing at room temperature for 1 minute, the mixture was centrifuged at 13,000 × g for 30 seconds to remove residual impurities.

[0052] Prepare a working solution at a ratio of 9:1 (45 μL DNase buffer + 5 μL RNase-free DNase I). Evenly add 50 μL of the working solution to the center of the RA membrane of the adsorption column and let it stand at room temperature for 15 minutes.

[0053] Add 350 μL of RW1 deproteinized buffer, centrifuge at 12,000 × g for 30 seconds, and discard the waste liquid.

[0054] RW wash buffer was added twice (500 μL / time), and the cells were centrifuged at 13,000 × g for 30 seconds each time before discarding the waste liquid.

[0055] Centrifuge the empty column at 13,000 × g for 2 minutes to remove any residual ethanol. Add 50 µL of RNase-free water to the center of the adsorption membrane, let stand at room temperature for 1 minute, and centrifuge at 12,000 × g for 1 minute. Repeat this step by adding the first eluate back to the adsorption column.

[0056] The extracted RNA was placed on ice until detection.

[0057] 2. RNA quality testing Electrophoresis: Take an appropriate amount of extracted RNA sample and perform electrophoresis on a 1% agarose gel in 1×TAE buffer at 150V for 15 minutes. Observe the RNA electrophoresis pattern to determine RNA integrity and degradation.

[0058] Concentration and purity detection: The concentration and purity of RNA were detected using NanoDrop2000 ultramicro-volume spectrophotometer. The absorbance values of A260 and A280 were measured, and the A260 / A280 ratio was calculated to evaluate the purity of RNA and protein contamination.

[0059] 3. RNA reverse transcription Perform the reverse transcription reaction according to the instructions of the PrimeScript FAST RT reagent Kit with gDNA Eraser. The specific steps are as follows: Prepare the reaction mixture: Place the above reaction solution in a PCR instrument, set the reaction temperature and time to 42°C and 2 minutes, and quickly cool it on ice after the program is completed.

[0060] Use the above reaction solution to prepare the reverse transcription reaction solution on ice. The system is as follows: The reaction temperature and time were set in the PCR instrument to 37°C for 10 minutes, 85°C for 5 seconds, and long-term storage in a -80°C refrigerator.

[0061] The cDNA obtained by reverse transcription was stored in a -80°C refrigerator for long-term storage and used for subsequent gene cloning and expression analysis experiments.

[0062] RNA electropherogram (see Figure 1 ) showed that the electrophoresis bands of total RNA from Xanthoceras sorbifolia flower buds were complete and clear, with distinct 28S and 18S rRNA bands and a visible 5S band. This indicates that the extracted RNA was of good integrity and showed no obvious degradation, meeting the requirements of subsequent experiments.

[0063] The NanoDrop 2000 ultra-micro-volume spectrophotometer showed that the A260 / A280 ratio of the extracted RNA sample was 2.13. This indicates high purity, low protein contamination, and good RNA quality, making it suitable for subsequent reverse transcription and PCR experiments.

[0064] The cDNA obtained by reverse transcription was tested and found to meet the required concentration and purity, and could be used for subsequent gene cloning and expression analysis experiments. The high-quality RNA sample used for reverse transcription and the appropriate reverse transcription reaction conditions ensured the effectiveness of cDNA synthesis.

[0065] The quality and purity of the extracted RNA and synthesized cDNA meet the experimental requirements and can be used for subsequent PCR amplification, gene expression analysis and other experiments.

[0066] Example 2 This example describes the cloning of the XsARF06.1 gene and the construction of the cloning vector.

[0067] Template DNA: Xanthoceras sorbifolia flower bud cDNA (obtained by reverse transcription of Xanthoceras sorbifolia flower bud RNA).

[0068] Primers: The first primer set (upstream primer: ATGAGGCTCTCTTCGGCTGG; downstream primer: GTAATCCAGAGACCCCACCGA) was synthesized by Beijing Ruibo Xingke Biotechnology Co., Ltd.

[0069] Reagents: PrimeSTAR Max DNA Polymerase (purchased from Takara Biotechnology (Beijing) Co., Ltd.), pTOPO-Blunt cloning kit (purchased from Sangon Biotechnology (Shanghai) Co., Ltd.), 1% agarose gel electrophoresis reagent, LB medium, kanamycin, etc.

[0070] Strains and vectors: Top10 Escherichia coli competent cells (purchased from Beijing Adelaide Biotechnology Co., Ltd.) and pTOPO-Blunt vector.

[0071] Instruments and equipment: PCR instrument, electrophoresis instrument, gel imaging system, pipette, constant temperature incubator, etc.

[0072] PCR reaction system and procedure for amplifying the XsARF06.1 gene: The PCR products were subjected to 1% agarose gel electrophoresis to observe the position and size of the target bands.

[0073] Cut out the target gene band under UV light and transfer it to a 1.5 mL sterile centrifuge tube.

[0074] Follow the instructions of the agarose gel purification and recovery kit to recover the correct target fragment.

[0075] Using the zero-background pTOPO-Blunt cloning kit, ligate the purified target fragment to the cloning vector in a PCR instrument at 35°C for 5 minutes. The system is as follows: Transfer the ligation product to an ice box, take Top10 E. coli competent cells and thaw them on ice for 2 minutes, immediately add 5 μL of the ligation product, gently pipette to mix, and perform heat shock, ice bath and room temperature in sequence.

[0076] Add LB medium and incubate at 37℃ in a constant temperature shaker for 30 minutes.

[0077] Spread on LB solid medium containing Amp and culture inverted in the dark at 37℃ for about 12 hours.

[0078] Single clones were picked for bacterial liquid PCR identification using the following system and reaction procedure: The PCR products were subjected to agarose gel electrophoresis to observe whether there were target bands and to screen out the expected positive clones.

[0079] The positive clones were sent to Beijing Ruibo Xingke Biotechnology Co., Ltd. for sequencing verification to confirm the accuracy of the sequence.

[0080] The PCR amplification product was detected by 1% agarose gel electrophoresis, and the results showed a single and clear band at the expected size (see Figure 2Lanes 1 and 2 show a length consistent with the CDS sequence of the XsARF06.1 gene, indicating successful amplification of the target gene fragment. The absence of nonspecific amplification products indicates good primer specificity and appropriate PCR amplification conditions.

[0081] The target fragment recovered from the agarose gel was purified and its concentration and purity were measured using a NanoDrop 2000 ultramicro-spectrophotometer. The results showed that the recovered DNA fragment was of high purity, meeting the requirements of subsequent experiments.

[0082] The recovered target fragment was ligated to the pTOPO-Blunt vector and transformed into Top10 competent E. coli cells. After overnight culture on LB solid medium containing Amp, multiple colonies were observed to grow. PCR identification of the bacterial solution by randomly selecting some colonies revealed the presence of target bands of the expected size in some colonies (see Figure 2 Lanes 1 and 2) indicate that the recombinant cloning vector was successfully constructed and the target gene was correctly inserted into the vector.

[0083] The positive clones screened were sent to a professional sequencing company for sequencing. The sequencing results showed that the insert sequence in the recombinant plasmid was completely consistent with the originally designed XsARF06.1 gene sequence, with no mismatches, insertions, or deletions, confirming the successful cloning of the XsARF06.1 gene and the correct construction of the cloning vector.

[0084] Example 3 This example describes the construction of an XsARF06.1 gene overexpression vector and Agrobacterium transformation. An XsARF06.1 gene overexpression vector was constructed and transformed into Agrobacterium to prepare for subsequent plant genetic transformation and functional verification experiments.

[0085] Recombinant plasmid: sequenced correctly pTOPO-Blunt-XsARF06.1 recombinant plasmid.

[0086] Vector: pBI121 plant expression vector (containing CaMV35S promoter and NOS terminator).

[0087] Bacterial strain: GV3101 Agrobacterium competent cells (purchased from Sangon Biotech (Shanghai) Co., Ltd.).

[0088] Primer: The third primer set.

[0089] Reagents: PrimeSTAR Max DNA Polymerase, DNA recovery kit, restriction endonucleases BamH I and Sac I, T4 DNA ligase, LB medium, antibiotics (kanamycin, rifampicin), etc.

[0090] Instruments and equipment: PCR instrument, electrophoresis instrument, gel imaging system, pipette, constant temperature shaker, centrifuge, etc.

[0091] 1. Double enzyme digestion reaction The pBI121 vector was double-digested with BamHI and SacI. The reaction system was as follows: The reaction system was placed in a 37°C constant temperature water bath for 50 minutes.

[0092] The digested product was subjected to 1% agarose gel electrophoresis, the target band was cut out and the linearized vector was recovered.

[0093] 2. Amplification and recovery of target fragments The pTOPO-Blunt clone plasmid containing the XsARF06.1 gene that had been sequenced correctly was used as a template and PCR amplification was performed using the second primer set. The reaction system and procedure were the same as before.

[0094] The PCR products were subjected to 1% agarose gel electrophoresis, and the target bands were cut out and recovered and purified.

[0095] 3. Homologous recombination and ligation The recovered target fragment and linearized vector were mixed in proportion, and Uniclone One Step Seamless Cloning Mix was added to perform homologous recombination reaction. The reaction conditions were 50°C water bath for 30 minutes.

[0096] After the reaction, the recombination mixture was used to transform Top10 E. coli competent cells.

[0097] 4. Screening and identification of recombinant vectors The transformed Top10 E. coli was spread on LB solid medium containing kanamycin and cultured in an inverted manner at 37°C for 12 hours.

[0098] Single clones were picked for bacterial liquid PCR identification to screen out positive clones containing the correct inserted fragments.

[0099] The positive clones were sent to Beijing Ruibo Xingke Biotechnology Co., Ltd. for sequencing verification to confirm the correctness of the sequence.

[0100] 5. Transformation of recombinant vector into Agrobacterium Take 3 tubes of GV3101 Agrobacterium competent cells and add 10 μL of the correctly sequenced overexpression vector plasmid to each tube.

[0101] Follow the Agrobacterium transformation steps: ice bath for 5 minutes, quick freeze in liquid nitrogen for 5 minutes, heat activation at 37°C for 5 minutes, and ice bath for 5 minutes.

[0102] Add 800 μL of LB liquid medium and resuscitate in a 28°C constant temperature shaker for 2 hours.

[0103] The cells were collected by centrifugation at 5000 × g for 2 minutes, 100 μL of the supernatant was retained and mixed by pipetting, and then spread on LB solid medium containing kanamycin and rifampicin, and cultured in the dark at 28°C for 48 hours.

[0104] Single clones were picked for bacterial liquid PCR detection, positive clones were screened out, and stored in a -80℃ refrigerator for future use.

[0105] Double-enzyme digestion results: 1% agarose gel electrophoresis of the double-enzyme digestion products revealed that the pBI121 vector was cleaved at the expected BamHI and SacI restriction sites, generating the correct linearized vector bands. This indicates that the double-enzyme digestion reaction was successful and the linearized vector is ready for subsequent homologous recombination.

[0106] Amplification and recovery of the target fragment: 1% agarose gel electrophoresis of the PCR amplification product revealed a clear band consistent with the size of the XsARF06.1 gene. The recovered target fragment was tested for concentration and purity and met experimental requirements, allowing for subsequent homologous recombination reactions.

[0107] Screening and identification of the recombinant vector: After transformation into Top10 E. coli, screening revealed several positive colonies. PCR analysis of the bacterial culture revealed the presence of a target band of the expected size in the positive clones, confirming the successful construction of the XsARF06.1 gene overexpression vector. Sequencing further confirmed the correctness of the recombinant vector, with the insertion orientation and sequence of the target gene consistent with expectations.

[0108] Transformation of the recombinant vector into Agrobacterium: Screening results after transformation of the recombinant vector into GV3101 Agrobacterium revealed the successful acquisition of positive Agrobacterium clones containing the recombinant vector. PCR analysis of the bacterial solution revealed the presence of the target gene in the positive clones, indicating that the recombinant vector had been successfully transformed into the Agrobacterium.

[0109] Example 4 This example measured the expression level of the XsARF06.1 gene in transgenic tobacco leaves and its effect on plant hormone content to verify the gene function and provide a basis for subsequent research.

[0110] Plant materials: Wild type (WT), empty vector control (EV), and transgenic tobacco plants overexpressing the XsARF06.1 gene.

[0111] Reagents: TB Green Premix Ex Taq II FAST qPCR reagent (purchased from Takara Biotechnology (Beijing) Co., Ltd.), RNA extraction kit, reverse transcription kit, etc.

[0112] Instruments and equipment: real-time fluorescence quantitative PCR instrument, centrifuge, pipette, etc.

[0113] 1. Sample preparation Thirty-day-old Nicotiana benthamiana plants were selected to ensure that the plants were in good and uniform growth condition.

[0114] The control group was injected with empty infection solution, and the experimental group was injected with Agrobacterium infection solution containing XsARF06.1 gene.

[0115] After injection, the cells were cultured in the dark for 1 day and then under normal conditions for 1 day.

[0116] 2. RNA extraction and reverse transcription Total RNA was extracted from tobacco leaves using an RNA extraction kit.

[0117] The integrity and quality of RNA were detected by 1% agarose gel electrophoresis and NanoDrop2000 ultramicro-spectrophotometer.

[0118] Reverse transcribe RNA into cDNA using a reverse transcription kit.

[0119] 3. Real-time fluorescence quantitative PCR Real-time quantitative PCR was performed using TB Green Premix Ex Taq II FAST qPCR reagent.

[0120] 4. Hormone content determination The tobacco leaves that have completed the experimental treatment were collected and stored in a -80°C refrigerator for later use.

[0121] Shanghai ELISA Biotechnology Co., Ltd. was commissioned to use ELISA enzyme-linked immunosorbent assay to detect the IAA and JA contents respectively.

[0122] Gene expression measurement results: Real-time fluorescence quantitative PCR detection results showed that the expression level of XsARF06.1 gene was significantly upregulated in the three tobacco lines overexpressing XsARF06.1 gene compared with WT and EV (see Figure 3 ). This indicates that the XsARF06.1 gene overexpression vector was successfully constructed and highly expressed in tobacco plants.

[0123] Hormone content measurement results: IAA content: Figure 4 As shown in Figure A, the IAA content in transgenic tobacco leaves was significantly lower in the XsARF06.1-OE group than in the WT and EV groups, suggesting that overexpression of the XsARF06.1 gene may have an inhibitory effect on the synthesis or metabolism of IAA.

[0124] JA content: Figure 4 As shown in Figure 3B, the JA content in the XsARF06.1-OE group was significantly higher than that in the WT and EV groups, indicating that overexpression of the XsARF06.1 gene may promote JA synthesis or signal transduction.

[0125] Example 5 This example analyzes the function of the XsARF06.1 gene during pistil abortion in Xanthoceras sorbifolia, silences the gene expression through RNA interference, and studies its role in the growth and development of Xanthoceras sorbifolia and hormone regulation.

[0126] Plant material: Xanthoceras sorbifolia seeds (wild species).

[0127] Vector and strain: pFGC5941 vector (used to construct RNAi silencing vector, enzyme cutting site diagram see Figure 5 ), TRV2 vector (used to construct VIGS viral silencing vector, plasmid map see Figure 6 ), GV3101 Agrobacterium competent cells.

[0128] Primers: Cis primer set and Anti primer set (used to construct sense and antisense fragments of RNAi silencing vector), fifth primer set (used to construct TRV silencing vector).

[0129] Reagents: restriction endonucleases (BamHI, XbaI, NcoI, AscI, etc.), DNA ligase, PCR reagents, plant hormone analysis reagents, etc.

[0130] Instruments and equipment: PCR instrument, gel imaging system, constant temperature incubator, centrifuge, syringe, etc.

[0131] 1. Construction of silencing vector Sense fragment construction: Use Cis-F and Cis-R primers to amplify the sense fragment using the pFGC5941 vector as a template. Recover the PCR product and ligate it into the linearized vector.

[0132] Antisense fragment construction: Anti-F and Anti-R primers were used to amplify the antisense fragment using the pFGC5941 vector as a template. The PCR product was recovered and ligated into the linearized vector.

[0133] Vector linearization: Double-digest the pFGC5941 vector with restriction endonucleases (such as BamHI and XbaI) and recover the linearized vector.

[0134] Homologous recombination: The sense and antisense fragments were homologously recombined with the linearized vector and transformed into Top10 E. coli competent cells.

[0135] Positive clone screening: Positive clones containing the correct insert were screened out through colony PCR and sequencing verification.

[0136] 2. Construction of VIGS viral silencing vector TRV vector preparation: PCR amplification was performed using the fifth primer set with TRV2 plasmid as the template.

[0137] Vector linearization: Double-digest the TRV2 vector with restriction endonucleases (such as BamHI and XbaI) and recover the linearized vector.

[0138] Homologous recombination: The amplified TRV vector fragment was homologously recombined with the linearized vector and transformed into Top10 E. coli competent cells.

[0139] Positive clone screening: Positive clones containing the correct insert were screened out through colony PCR and sequencing verification.

[0140] 3. Agrobacterium transformation The constructed RNAi silencing vector and TRV silencing vector were transformed into GV3101 Agrobacterium competent cells, respectively.

[0141] After transformation, the cells were plated on LB solid medium containing the corresponding antibiotics and positive clones were screened.

[0142] 4. Instantaneous transformation of Xanthoceras sorbifolia Agrobacterium culture: The positive Agrobacterium clones screened were expanded and cultured in LB liquid medium containing corresponding antibiotics.

[0143] Preparation of infection solution: Collect the Agrobacterium culture solution by centrifugation, resuspend it in buffer, and adjust the OD600 value to the appropriate range.

[0144] Infection methods: Xanthoceras sorbifolia seedlings were infected using root hydroponics, leaf injection, stem segment injection, and vacuum infiltration. A control group treated with pure water and a GUS-containing Agrobacterium-infected solution were used as the experimental group.

[0145] Cultivation and observation: After infection, place the Xanthoceras sorbifolia seedlings in suitable conditions for cultivation and observe the growth status of the plants regularly.

[0146] 5. Determination of gene expression Total RNA was extracted from infected Xanthoceras sorbifolia kernels and reverse transcribed into cDNA.

[0147] Real-time fluorescence quantitative PCR was used to detect the expression of the XsARF06.1 gene, and the data were normalized using the internal reference gene of Xanthoceras sorbifolia.

[0148] 6. Hormone content determination The infected Xanthoceras sorbifolia kernel samples were collected and stored in a -80°C refrigerator.

[0149] The IAA content was determined using ELISA.

[0150] Results of silencing vector construction: The RNAi silencing vector and TRV silencing vector for the XsARF06.1 gene were successfully constructed through colony PCR and sequencing verification. Sequencing results showed that both the sense and antisense fragments were correctly inserted into the vector, and the vector construction was successful (see Figure 7 and Figure 8 ).

[0151] Agrobacterium transformation results: After the constructed silencing vector was transformed into GV3101 Agrobacterium, the positive clones screened were tested by bacterial liquid PCR to confirm that they contained the correct recombinant vector.

[0152] Transient transformation results of Xanthoceras sorbifolia: After infection of Xanthoceras sorbifolia seedlings using various methods, the plants showed healthy growth, with no obvious abnormalities. GUS staining revealed successful expression of the GUS gene at the infection site, demonstrating high Agrobacterium infection efficiency.

[0153] Gene expression measurement results: Real-time fluorescence quantitative PCR detection results show (see Figure 9), compared with the control group, the expression level of XsARF06.1 gene in the XsARF06.1-RNAi group was significantly downregulated, indicating that RNA interference successfully silenced the expression of this gene; while the gene expression level in the XsARF06.1-TRV group did not change significantly, indicating that the TRV vector had no obvious effect on the expression of the XsARF06.1 gene.

[0154] Hormone content determination results: IAA content determination results (see Figure 10 ) showed that the IAA content in the kernels of X. sorbifolia seeds in the XsARF06.1-RNAi group was significantly lower than that in the control group, indicating that silencing the XsARF06.1 gene can reduce IAA content in the kernels. However, the IAA content in the XsARF06.1-TRV group was similar to that in the control group, further demonstrating that the TRV vector has no significant effect on XsARF06.1 gene expression. The IAA content in the XsARF06.1-OE group was significantly higher than that in the control group, indicating that overexpressing the XsARF06.1 gene can increase IAA content in the kernels of X. sorbifolia seeds.

[0155] In the description of the present invention, it should be understood that "-" and "~" represent a range between two values, and the range includes the endpoints. For example, "AB" represents a range greater than or equal to A and less than or equal to B. "A~B" represents a range greater than or equal to A and less than or equal to B.

[0156] In the description of the present invention, the term "and / or" is merely a description of the association relationship of associated objects, indicating that three relationships may exist. For example, A and / or B may represent three situations: A exists alone, A and B exist at the same time, and B exists alone.

[0157] In the description of the invention, the numerical values of time, temperature, ratio and mass involved may be based on actual measurements, standard parameters of equipment, simplified rounding results, or within an acceptable error range, ensuring the practicality and repeatability of the invention.

[0158] In the description of the present invention, the term "about" or "approximately" is used to express the approximate value of a numerical value or range, allowing a certain error to ensure the flexibility and practicality of the description while remaining within an acceptable error range, with the maximum error range not exceeding 10% of the corresponding numerical value or numerical range.

[0159] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be construed as limiting the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. Persons skilled in the art will appreciate that improvements and modifications may be made without departing from the spirit and scope of the present invention, and such improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. An isolated nucleotide sequence, characterized in that The sequence is selected from any one of the following: (1) the nucleotide sequence shown in SEQ ID NO: 1, (2) a nucleotide sequence complementary to SEQ ID NO: 1; (3) A variant having more than 90% homology with SEQ ID NO: 1 and capable of regulating the auxin content of Xanthoceras sorbifolia.

2. A recombinant vector, characterized in that The recombinant vector comprises the nucleotide sequence according to claim 1 and a vector backbone.

3. A recombinant host cell, characterized in that The recombinant host cell contains the recombinant vector according to claim 2.

4. A method for changing the auxin content of plants by regulating the expression of Xanthoceras sorbifolia XsARF06.1 gene, characterized in that: The following steps are involved: introducing the nucleotide sequence of claim 1 into a plant cell; The plant cells are cultured to overexpress the XsARF06.1 gene, thereby increasing the plant auxin content.

5. A method for reducing plant auxin content by silencing the expression of Xanthoceras sorbifolia XsARF06.1 gene by RNA interference, characterized in that: The following steps are involved: introducing an RNA interference sequence targeting the XsARF06.1 gene into plant cells; The plant cells are cultured to silence the XsARF06.1 gene, thereby reducing the plant auxin content.

6. A second primer combination for detecting the expression of Xanthoceras sorbifolia XsARF06.1 gene, characterized in that: The primer combination comprises the following primer sequences: Second upstream primer: 5′-tgctatgccacagttcacttcagtc-3′; Second downstream primer: 5'-atagggctcgtcacagggttcc-3'.

7. A third primer combination for constructing a Xanthoceras sorbifolia XsARF06.1 gene overexpression vector, characterized in that: The primer combination comprises the following primer sequences: The third upstream primer: 5′-acgggggactctagaggatccATGAGGCTCTCTTCGGCTGG-3′; The third downstream primer: 5′-gcccttgctcaccatggtaccGTAATCCAGAGACCCCACCGA-3′.

8. A fourth primer combination for cloning the Xanthoceras sorbifolia XsARF06.1 gene, characterized in that: The primer combination comprises the following primer sequences: Fourth upstream primer: 5′-gatgaatctggtttcctgca-3′; Fourth downstream primer: 5'-ggcggtgagagtattttgat-3'.

9. A primer combination for constructing an RNAi silencing vector for the XsARF06.1 gene of Xanthoceras sorbifolia, characterized in that: The primer combination comprises the following primer sequences: Sense fragment Cis primer set: Cis-F: 5'-gcaggtatttggatcGATGAATCTGGTTTCCTGCA-3'; Cis-R: 5'-taattaactctctagGGCGGTGAGAGTATTTTGAT-3'; Antisense fragment Anti primer set: Anti-F: 5'-catcgattgggcgcgGATGAATCTGGTTTCCTGCA-3'; Anti-R: 5'-gctcggtaccggatcGGCGGTGAGAGTATTTTGAT-3'.

10. A fifth primer combination for constructing a TRV silencing vector for the XsARF06.1 gene of Xanthoceras sorbifolia, characterized in that: The primer combination comprises the following primer sequences: Fifth upstream primer: 5′-taccgaattctctagGATGAATCTGGTTTCCTGCA-3′; Fifth downstream primer: 5′-gctcggtaccggatcGGCGGTGAGAGTATTTTGAT-3′.

Images