SbMYB86 gene related to salt stress of scutellaria baicalensis and application of SbMYB86 gene in cultivation of salt-tolerant transgenic plant

Abstract

The invention belongs to the technical field of plant biology, and discloses a SbMYB86 gene related to salt stress of scutellaria baicalensis and application of the SbMYB86 gene in cultivation of salt-tolerant transgenic plants, and the nucleotide sequence of the SbMYB86 gene related to salt stress of scutellaria baicalensis is shown as SEQ ID NO: 1. The invention provides a protein coded by the SbMYB86 gene related to scutellaria baicalensis salt stress. The amino acid sequence of the protein is shown as SEQ ID NO: 2. The invention also provides a recombinant vector and a recombinant host cell carrying the gene and the protein. Based on positive adjustment of the SbMYB86 gene on the salt tolerance of plants, the gene can be applied to cultivation of high-quality salt-tolerant crops or traditional Chinese medicinal materials, a new direction is provided for planting of the traditional Chinese medicinal materials in saline-alkali areas, sustainable development of the medicinal material industry is assisted, and the gene has important significance on ecological protection of saline-alkali soil and improvement of agricultural productivity.

Description

Technical Field

[0001] The present invention relates to the field of plant biotechnology, and in particular to a SbMYB86 gene related to salt stress of Scutellaria baicalensis and application thereof in cultivating salt-tolerant transgenic plants. Background Art

[0002] Scutellaria baicalensis Georgi is a perennial herbaceous plant of the genus Scutellaria in the Lamiaceae family. It is cold in nature and bitter in taste, and possesses significant anti-inflammatory, antibacterial, antiviral, and antioxidant activities. The core medicinal value of Scutellaria baicalensis stems from the active ingredients contained in its roots, namely flavonoids such as baicalin and baicalein. These compounds effectively inhibit the release of inflammatory factors and have inhibitory effects against various bacteria and viruses, supporting its use in the treatment of infectious diseases. Scutellaria baicalensis also has the potential to lower blood sugar and protect the liver, improving liver cell function and combating oxidative stress, protecting cells from damage. These pharmacological properties make Scutellaria baicalensis a promising clinical treatment, particularly as an adjunctive treatment for respiratory infections, liver diseases, and other inflammatory conditions. Scutellaria baicalensis holds a prominent position in traditional medicine, and modern pharmacological research provides a solid theoretical foundation for its clinical application.

[0003] Land salinization poses a serious challenge to agricultural production and plant ecosystems. Studies have shown that the area affected by salinization is expanding annually, and it is estimated that by 2050, half of the world's land may be severely salinized (Farsaraei et al., 2020; Javed et al., 2020).

[0004] Research has shown that Scutellaria baicalensis has a certain tolerance to low salt levels and can survive in moderately saline-alkali soils (Tian Shuhui et al., 2017; Wu Ruotong et al., 2021). The unique properties of saline-alkali soils may enhance the medicinal efficacy and quality of Scutellaria baicalensis to a certain extent, thus providing new opportunities for its market development. However, in high-salt environments, the growth and reproductive capacity of Scutellaria baicalensis is significantly reduced, which affects its cultivation and medicinal value in coastal areas. Therefore, studying the salt tolerance of Scutellaria baicalensis is crucial. However, there are currently no effective means or cultivation methods to improve the salt tolerance of Scutellaria baicalensis.

[0005] Therefore, the existing technology needs to be further improved. Summary of the Invention

[0006] In response to the problem that Scutellaria baicalensis has insufficient salt tolerance and is difficult to adapt to high-salt environments, which affects its planting range and medicinal value, the present invention provides a Scutellaria baicalensis salt stress-related SbMYB86 gene and its application in cultivating salt-tolerant transgenic plants.

[0007] To solve the above problems, this application provides the following technical solutions:

[0008] In a first aspect, the present application provides a SbMYB86 gene related to salt stress in Scutellaria baicalensis, the nucleotide sequence of which is shown in SEQ ID NO: 1.

[0009] MYB transcription factors are a class of DNA-binding proteins, representing one of the largest families of transcription factors in plants. They are highly conserved. The MYB domain consists of a stretch of approximately 51-52 highly conserved amino acid residues, including three conserved tryptophan residues separated by 18-19 amino acid residues. Based on the number of conserved domains present, MYB proteins are divided into four subfamilies: 1R-MYB, R2R3-MYB, R1R2R3-MYB / 3R-MYB, and 4R-MYB. This family participates in regulating life processes such as growth, differentiation, and stress response in plants, animals, and fungi. The R2R3-MYB subfamily, in particular, plays a crucial role. For example, the GaMYB85 transcription factor of the cotton R2R3 subfamily contains 257 amino acid residues, and the cold, drought and salt tolerance of transgenic Arabidopsis plants are significantly improved, which is of great significance for the development of new cotton varieties; the R2R3-MYB transcription factor MMYBSI isolated from alfalfa was transferred into Arabidopsis thaliana and found to be sensitive to ABA and effectively activate a gene encoding proline synthesis, indicating that MIMYBSI may be an effective gene for regulating salt tolerance in legumes.

[0010] This application screened differentially expressed R2R3-MYB transcription factors through the salt-treated transcriptome of Scutellaria baicalensis, constructed a phylogenetic tree with the R2R3-MYB transcription factors involved in adverse stress in Arabidopsis, and analyzed the expression levels before and after NaCl and MeJA treatment to obtain the candidate gene SbMYB86. Then, through bioinformatics analysis, subcellular localization, expression pattern analysis, and analysis of the salt resistance phenotype (including physiological indicators) and expression levels of salt stress-related genes in Arabidopsis thaliana overexpressing SbMYB86 and Scutellaria baicalensis plants with gene silencing of SbMYB86, the gene function of this transcription factor was identified.

[0011] The results showed that the expression levels of this gene varied significantly in different tissues of Scutellaria baicalensis, with the highest expression in the stem. Furthermore, the gene showed an increasing trend followed by a decreasing trend during salt stress. Subcellular localization revealed that SbMYB86 was expressed in the nucleus.

[0012] The results also showed that under salt stress conditions, the expression levels of salt stress-related genes NHX1, RD20, SOS1, SOS4, and SOS5 were significantly upregulated in T3 transgenic Arabidopsis plants heterologously expressing SbMYB86, suggesting that SbMYB86 may participate in the salt stress response by affecting the salt stress signal transduction pathway, thereby enhancing the salt tolerance of Arabidopsis. The salt tolerance of transgenic Scutellaria baicalensis plants with SbMYB86 gene silenced was significantly reduced, and the relative expression levels of salt stress-related genes were significantly lower than those in the control group. These results indicate that silencing the SbMYB86 gene reduced the salt tolerance of Scutellaria baicalensis.

[0013] Therefore, the above-mentioned SbMYB86 gene related to salt stress in Scutellaria baicalensis can be used to cultivate high-quality salt-tolerant plants, which not only provides a new direction for the cultivation of Chinese medicinal materials in saline-alkali areas, but also contributes to the sustainable development of the medicinal materials industry. It is of great significance to the ecological protection of saline-alkali land and the improvement of agricultural production capacity.

[0014] Because the above-mentioned gene is prone to mutation during the replication of the plant genome, mutants of the above-mentioned SbMYB86 gene are also within the scope of protection requested in this application. The above-mentioned gene SbMYB86 gene, as shown in the nucleotide sequence of Seq ID No: 1 or its complementary sequence, also includes mutant sequences that have greater than 98% homology to Seq ID No: 1 and can encode proteins with the same activity or function. The above-mentioned mutant sequence can be a point mutation, a deletion mutation, or an addition mutation, and one, two, three, four, five, six, seven, eight, nine, ten, or more nucleotides can change relative to the original nucleotide sequence.

[0015] In a second aspect, the present application provides a protein encoded by the SbMYB86 gene related to salt stress in Scutellaria baicalensis, the amino acid sequence of which is shown in SEQ ID NO: 2.

[0016] In a third aspect, the present application also provides a recombinant vector carrying the aforementioned polynucleotide sequence of the SbMYB86 gene related to salt stress of Scutellaria baicalensis. The recombinant vector is a cloning vector or an expression vector for expressing the polynucleotide.

[0017] In a fourth aspect, the present application also provides a recombinant vector, the original vector of which is a pGBKT7 vector.

[0018] In a fifth aspect, the present application also provides a recombinant host cell comprising the aforementioned polynucleotide sequence of the SbMYB86 gene related to salt stress of Scutellaria baicalensis or the aforementioned recombinant vector, or a polynucleotide sequence of the aforementioned tobacco axillary bud development-related gene integrated into its genome.

[0019] Optionally, the recombinant host cell is an Escherichia coli or Agrobacterium cell.

[0020] In a sixth aspect, the present application also provides the use of the SbMYB86 gene or the protein related to salt stress of Scutellaria baicalensis in cultivating salt-resistant transgenic plants.

[0021] Optionally, in the application, the plant is Arabidopsis thaliana or Scutellaria baicalensis.

[0022] By breeding salt-tolerant varieties, Scutellaria baicalensis can be grown in saline-alkali soils and its medicinal value can be improved. The application of this gene will promote the improvement of environmental adaptability and resource utilization in the traditional Chinese medicine industry.

[0023] In a seventh aspect, the present application further provides the use of the SbMYB86 gene or protein related to salt stress in Scutellaria baicalensis to reduce salt resistance in plants. This gene can also be used on specific salt-tolerant weeds to reduce their ability to adapt to saline-alkali environments.

[0024] In an eighth aspect, the present application further provides a specific primer pair for identifying the SbMYB86 gene related to salt stress in Scutellaria baicalensis, wherein the specific primer pair comprises SbMYB86-F1 and SbMYB86-R1, whose sequences are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively.

[0025] In a ninth aspect, the present application further provides a method for preparing a salt-alkali resistant transgenic plant, the preparation method comprising:

[0026] S1. Constructing the aforementioned SbMYB86 gene overexpression recombinant plant expression vector;

[0027] S2. The SbMYB86 gene overexpression recombinant plant expression vector is transformed into plants to overexpress the SbMYB86 gene in the plants, and the salt tolerance of the resulting transgenic plants is improved.

[0028] Further optionally, the preparation method is:

[0029] First, the CDS sequence of the SbMYB86 gene was obtained from the transcriptome database. Primers were designed and amplified using high-fidelity PCR. After gel electrophoresis verification and gel recovery, the expression vector was ligated to pMD18-T and pSuper1300 vectors to complete the construction.

[0030] Next, the constructed pSuper1300-SbMYB86 vector was transformed into Agrobacterium competent cells GV3101;

[0031] Then, wild-type Arabidopsis seeds were sterilized, sown, vernalized, and then transferred to soil culture. They were transformed with activated Agrobacterium resuspension by inflorescence infection, cultured in the dark for 24 hours, then cultured in long-day conditions, and repeatedly infected to harvest T0 generation seeds.

[0032] Finally, T0 generation seeds were screened on a culture medium containing HYG, and plants with good growth were cultured in soil and identified by PCR. Positive plants were screened for three generations to obtain the T3 generation. RNA from T3 generation leaves was extracted and reverse transcribed into cDNA, and the expression level was identified by qRT-PCR to verify whether overexpression plants were successfully obtained.

[0033] Optionally, the transgenic plant is Scutellaria baicalensis. After its salt tolerance is improved, not only can the planting range of Scutellaria baicalensis be expanded, but its medicinal value can also be further exerted, and the yield and quality of Scutellaria baicalensis planting can be improved.

[0034] The present invention has the following beneficial effects:

[0035] 1. This study identified a salt-stress-related gene, SbMYB86, in Scutellaria baicalensis. SbMYB86 is involved in the plant's response to salt stress, with its expression pattern showing regular changes with increasing salt stress duration. Experiments have shown that Arabidopsis thaliana heterologously expressing SbMYB86 significantly outperforms wild-type plants in saline-alkali conditions. This suggests that SbMYB86 may participate in the salt stress response by influencing salt stress signal transduction pathways, thereby enhancing the plant's salt tolerance.

[0036] 2. This application also provides the use of the above-mentioned SbMYB86 gene and the protein it encodes in the cultivation of high-quality salt-tolerant crops or Chinese medicinal materials (such as Scutellaria baicalensis). This not only provides a new direction for the cultivation of Chinese medicinal materials in saline-alkali areas, but also contributes to the sustainable development of the medicinal materials industry. It is of great significance to the ecological protection of saline-alkali land and the improvement of agricultural production capacity.

[0037] 3. The above genes and methods can be used to cultivate high-quality salt-tolerant Scutellaria baicalensis. By improving the salt tolerance of Scutellaria baicalensis, the planting range of Scutellaria baicalensis can be expanded and its medicinal value can be fully utilized, thereby improving the yield and quality of Scutellaria baicalensis cultivation. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 To screen for differentially expressed R2R3-MYB transcription factors;

[0039] Figure 2 This is the NJ phylogenetic tree of R2R3-MYB transcription factors with stress-related functions based on Scutellaria baicalensis and Arabidopsis thaliana;

[0040] Figure 3 The expression changes of four R2R3-MYB genes before and after NaCl and MeJA treatment;

[0041] Figure 4 The amino acid sequence alignment of Sbai1A319T89 with Arabidopsis AtMYB86, AtMYB55, AtMYB50, and AtMYB61;

[0042] Figure 5 The results of PCR amplification of the CDS region of SbMYB86 and its verification by bacterial solution PCR are shown;

[0043] Figure 6 Comparison of CDS clone sequencing results and transcriptome sequences of SbMYB86;

[0044] Figure 7 Prediction of secondary and tertiary structures of SbMYB86 protein;

[0045] Figure 8 for the subcellular localization of SbMYB86;

[0046] Figure 9 To verify the transcriptional activation activity of SbMYB86;

[0047] Figure 10 Analysis of the expression pattern of SbMYB86. (A) Analysis of the tissue expression pattern of SbMYB86. (B) Analysis of the salt response pattern of SbMYB86.

[0048] Figure 11 Figure 2 is the phenotype of Arabidopsis thaliana (T3) heterologously expressing SbMYB86 after salt treatment;

[0049] Figure 12 To measure physiological indicators of Arabidopsis thaliana (T3) heterologously expressing SbMYB86;

[0050] Figure 13 is the expression level of salt stress-related genes in Arabidopsis thaliana (T3) heterologously expressing SbMYB86;

[0051] Figure 14 To measure the physiological indexes of Scutellaria baicalensis silencing SbMYB86 gene;

[0052] Figure 15 The expression levels of salt stress-related genes in Scutellaria baicalensis silencing SbMYB86. DETAILED DESCRIPTION

[0053] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those skilled in the art without making creative work are within the scope of protection of the present invention. In the present invention, unless otherwise specified, the equipment and raw materials used can be purchased from the market or are commonly used in this field. The methods in the following embodiments, unless otherwise specified, are conventional methods in this field.

[0054] Materials: Scutellaria baicalensis seeds used in this experiment were purchased from Baoding, Hebei Province and identified as such by Associate Professor Gao Ting of Qingdao Agricultural University. Wild-type Arabidopsis thaliana (Col-0) and Nicotiana benthamiana seeds were stored in the inventors' laboratory.

[0055] Example 1 Acquisition of R2R3-MYB Gene Related to Salt Stress in Scutellaria Baicalensis

[0056] 1. Experimental methods

[0057] In the early stage, the optimal concentration and time of salt stress for Scutellaria baicalensis were obtained through experiments. The Scutellaria baicalensis materials treated with 0.5% NaCl for 60 hours were sent to the company for transcriptome sequencing. Based on the obtained transcriptome database, differentially expressed R2R3-MYB transcription factors were screened. R2R3-MYB transcription factors related to adverse stress in Arabidopsis thaliana were downloaded from NCBI. These R2R3-MYB transcription factors with differences in Scutellaria baicalensis R2R3-MYB transcription factors screened from the transcriptome were used to construct a phylogenetic tree using the New Joint method of MEGA software to screen out R2R3-MYB transcription factors in Scutellaria baicalensis that may respond to salt stress.

[0058] A 200 μmol / L methyl jasmonate (MeJA) solution was prepared and sprayed on the leaves of Scutellaria baicalensis to induce the expression of related genes. After treatment, samples were collected within 16 hours and quickly frozen with liquid nitrogen to maintain the integrity of the samples. RNA was extracted and cDNA was reverse transcribed. Quantitative PCR primers were designed, and SbActin was used as the internal reference gene to perform quantitative expression analysis on the four candidate genes screened out. Four Scutellaria baicalensis plants were planted in each pot, and 12 pots of plants were placed in the same tray. 0.5% NaCl solution was applied to the tray, 250 ml was watered, and sampling was performed after 6 hours. RNA was extracted and cDNA was synthesized, and then the expression changes of candidate genes before and after salt treatment were analyzed by qRT-PCR. Candidate genes with significant changes in expression were screened out. BLAST sequence alignment was performed on NCBI and the screened genes were named.

[0059] 2. Experimental results and analysis

[0060] Based on the previously available salt-treated Scutellaria baicalensis transcriptome data, 745 differentially expressed transcription factors were screened, including 9 R2R3-MYB transcription factors. These 9 transcription factors were combined with the R2R3-MYB transcription factors in Arabidopsis thaliana known to be related to stress to construct a phylogenetic tree (see Figure 1 、 Figure 2 Combining the results of the phylogenetic tree and relevant literature, we finally identified four R2R3-MYB transcription factors, namely Sbai1A319T89, Sbai1A32T68, Sbai3A431T59 and Sbai3A287T114 (see Figure 3). Quantitative expression analysis of the above four Scutellaria baicalensis R2R3-MYB genes before and after NaCl and MeJA treatment was carried out. The results showed that Sbai1A319T89 and Sbai1A32T68 showed obvious induction responses to NaCl and MeJA, suggesting that they may be involved in the response mechanism of salt stress and play an important role in the synthesis and accumulation of secondary metabolites in Scutellaria baicalensis. This application selected the former as the target gene for subsequent experiments. Amino acid sequence alignment was performed from the NCBI database (see Figure 4 The alignment results showed that Sbai1A319T89 had the highest similarity with AtMYB86 of Arabidopsis thaliana, so it was named SbMYB86.

[0061] Example 2 Cloning and bioinformatics analysis of the SbMYB86 gene from Scutellaria baicalensis

[0062] 1. Experimental methods

[0063] RNA was extracted from Scutellaria baicalensis and reverse transcribed to synthesize cDNA. The SbActin sequence was downloaded from the NCBI database. Based on the transcriptome data, primers for cloning the SbMYB86 gene were designed and PCR amplified using the extracted cDNA (see Table 1 for the amplification reaction system and Table 2 for the reaction procedure).

[0064] The primer sequences are: F: ATGGGACGCGGTTCTTGTTGT; R: CATATTGAACATGTCCATGTTTGG.

[0065] Amplified products were identified by agarose gel electrophoresis, and expected fragments were selected for gel excision and recovery. The recovered PCR product was ligated with the pMD18-T vector and transformed into DH5α competent cells. Single colonies were identified by PCR, and positive clones were sent for sequencing. The sequenced gene sequence was subjected to bioinformatics analysis, using tools such as NCBI, ExPASy, ProtParam, TMHMM, SOPMA, and SWISS-MODEL to assess protein hydrophilicity and hydrophobicity, analyze physicochemical properties, and predict domain structure.

[0066] Table 1 qRT-PCR reaction system

[0067]

[0068] Table 2 qRT-PCR reaction procedure

[0069]

[0070] 2. Experimental results and analysis

[0071] (1) The full-length coding region (CDS) of the SbMYB86 gene in Scutellaria baicalensis was obtained by PCR amplification. The full-length CDS sequence is 888 bp and encodes 295 amino acids.

[0072] (2) The conserved domains of SbMYB86 protein were predicted and analyzed. The results showed that it contained two SANT domains, located at positions 13-63 and 66-114, respectively, which confirmed that it belonged to the R2R3-MYB family protein.

[0073] (3) The hydrophobicity of the protein was analyzed using the ProtScale tool. The results showed that the lowest hydrophobicity peak at position 126 of the polypeptide chain was -2.822, while the hydrophobicity peak at position 81 was 1.644. This further inferred that the protein was a hydrophilic protein without a transmembrane domain.

[0074] (4) The secondary structure of SbMYB86 was predicted using SOPMA software (see Figure 7 The results showed that the secondary structure of the protein is composed of 36.61% α-helices (blue), 1.36% extended strands (red), 5.42% β-turns (green), and 56.61% random coils (purple). α-helices and random coils are the primary structures, with α-helices accounting for over 30% of the protein. This suggests that the SbMYB86 protein has a relatively stable spatial structure.

[0075] Example 3 Subcellular localization of SbMYB86 protein

[0076] 1. Experimental methods

[0077] Based on the coding sequence (CDS) of the SbMYB86 gene, specific primers containing Kpn I and Spe I restriction sites and protective bases were designed using Primer 5 software. The recombinant plasmid pSuper1300-SbMYB86 was successfully constructed. After sequencing confirmed the correctness of the plasmid, the plasmid was extracted and transformed into Agrobacterium tumefaciens GV3101 according to the relevant experimental manual. The activated Agrobacterium was mixed with a suspension of pSuper1300 and pSuper1300-SbMYB86 in a 1:1 volume ratio to prepare the infection medium. Three- to four-week-old Nicotiana benthamiana plants were then treated with the infection medium and incubated in darkness overnight before returning to light for 2-3 days. After injection of a DAPI solution, the subcellular localization of SbMYB86 was observed using laser confocal microscopy.

[0078] PCR amplification was performed using primers containing BamHI and EcoRI homology arms to the transcriptional activation vector pGBKT7. Gel electrophoresis revealed that the band length met the target fragment requirement. The fragment was then excised and ligated to the pGBKT7 vector using homologous recombination. Escherichia coli was transformed and positive for PCR. Sequencing confirmed the plasmids, and the plasmids were extracted and stored at -20°C until further use. The pGBKT7 empty vector served as a negative control. The plasmid was co-transformed with the pGBKT7-SbMYB86 plasmid into yeast AH109. Plates were plated onto SD / -Trp medium and growth was observed.

[0079] 2. Experimental results and analysis

[0080] The localization of SbMYB86 protein was observed using a laser confocal microscope at wavelengths of 340 nm and 488 nm. Figure 8 As shown in the figure, green fluorescence was detected throughout the cells of tobacco leaves injected with pSuper1300, while the fluorescence signal was only observed in the nucleus after injection of pSuper1300-SbMYB86 fusion protein. This experimental result indicates that the SbMYB86 protein is expressed in the nucleus.

[0081] Yeast transformed with the pGBKT7 and pGBKT7-SbMYB86 plasmids both grew well on SD / -Trp medium. Individual colonies harboring pGBKT7 and pGBKT7-SbMYB86 that grew normally on SD / -Trp medium were picked, diluted with sterile water, and then spotted on SD / -Trp / -His / -Ade medium containing X-α-gal. Yeast strain AH109, harboring only the empty pGBKT7 plasmid, failed to grow on SD / -Trp / -His / -Ade medium and failed to degrade the substrate, producing a blue color. However, yeast strain AH109 harboring pGBKT7-SbMYB86 grew normally and degraded the substrate, producing a blue color. This result indicates that SbMYB86 has transcriptional activation activity, activating the MEL1 gene on the vector and enabling the enzyme α-galactosidase to degrade the colorless X-α-gal substrate.

[0082] Example 4 Analysis of SbMYB86 gene expression

[0083] 1. Experimental methods

[0084] (1) To further explore the expression pattern of the SbMYB86 gene in different tissues, RNA was extracted from different parts of Scutellaria baicalensis, including roots, stems, leaves, and flowers, and quantitatively detected using qRT-PCR technology.

[0085] The specific method involved selecting Scutellaria baicalensis plants grown to the flowering stage and collecting samples from different tissues, including roots, stems, leaves, and flowers. RNA was extracted and reverse transcribed to synthesize cDNA. The tissue-specific expression of SbMYB86 was analyzed using qRT-PCR, with SbActin used as an internal reference gene for normalization.

[0086] (2) In view of the response pattern of SbMYB86 under NaCl treatment, this study extracted RNA from Scutellaria baicalensis after treatment at different time points (0h, 6h, 12h, 24h, 36h, 48h, 60h, 72h) and performed qRT-PCR detection.

[0087] The specific method was to plant four Scutellaria baicalensis plants per pot, place 12 pots in a tray, and water the tray with 250 ml of 0.5% NaCl. Samples were collected at different time points (0 h, 3 h, 6 h, 12 h, 24 h, 36 h, 48 h, 60 h, and 72 h). RNA was extracted and cDNA synthesized at each time point. qRT-PCR was then used to analyze the expression changes of candidate genes at each salt treatment time point.

[0088] 2. Experimental results and analysis

[0089] (1) Figure 10 Results showed that SbMYB86 was expressed in all tissues, but the expression levels varied significantly among different tissues. The highest expression level of SbMYB86 was in the stem, followed by the root, while the expression levels in the leaves and flowers were relatively low.

[0090] (2) Figure 10 The results of B showed that the expression level of SbMYB86 reached its highest value after 24 hours of NaCl treatment and showed a trend of first increasing and then decreasing. This result indicates that SbMYB86 is involved in the response of Scutellaria baicalensis to salt stress, and its expression pattern shows regular changes with the increase of salt stress time.

[0091] Example 5 Physiological response and salt tolerance analysis of transgenic Arabidopsis thaliana heterologously expressing SbMYB86 under salt stress 1. Experimental methods

[0092] In this example, a heterologous expression vector was constructed and transformed with Agrobacterium tumefaciens, and homozygous heterologous expression of SbMYB86 Arabidopsis thaliana was successfully obtained in the T3 generation using the inflorescence infection method. The specific method is as follows:

[0093] (1) Construction of heterologous expression vector

[0094] Using the known CDS sequence of the SbMYB86 gene from the transcriptome database as a template, specific primers were designed and PCR amplified using a high-fidelity enzyme. After gel electrophoresis verification, the target fragment was excised and recovered. This fragment was ligated into the pMD18-T vector and transformed into E. coli for verification by PCR. Once sequencing confirmed, the fragment was ligated into the pSuper1300 vector to construct the pSuper1300-SbMYB86 expression vector.

[0095] (2) Transformation of Agrobacterium

[0096] Wild-type Arabidopsis seeds were sterilized in a sterile operating chamber and sown in 1 / 2 MS solid medium at a pH of 5.8. After vernalization at 4°C for 3 days, they were cultured in a lighted incubator for approximately 7-10 days before being transferred to soil cultivation. Six wild-type Arabidopsis plants with bolts approximately 10 cm in height and uniform growth were selected and any existing fruit pods removed.

[0097] Transformation was performed using the inflorescence infection method. Activate pSuper1300-SbMYB86 Agrobacterium and collect the cells by centrifugation. Prepare the infection solution: First, prepare a sucrose solution with a final concentration of 5%, then add Silwet-L77 to a final concentration of 0.04%. Resuspend the cells in the infection solution and soak the Arabidopsis inflorescence in the resuspension for 7-10 seconds. Cover the transformed Arabidopsis plants with plastic wrap to keep them warm, incubate in the dark for 24 hours, and then transfer to long-day culture for 5-7 days before repeating the infection. Incubate the infected Arabidopsis plants under long-day culture until the seeds are harvested to obtain T0 generation seeds.

[0098] (3) Positive identification of transgenic Arabidopsis seedlings

[0099] The T0 generation seeds were sown in 1 / 2MS medium with a HYG concentration of 20 mg / L for resistance screening. The plants with good growth and long roots were transferred to soil culture. The samples were collected after about 2 weeks, and DNA was extracted using a DNA extraction kit. PCR identification was performed using primers for the SbMYB86 gene. The specific operation steps were referred to the instructions of the DNA extraction kit.

[0100] The positive plants screened and identified were cultured until seeds were harvested, and the same method was used to screen at least three generations. The leaves of the T3 generation Arabidopsis plants heterologously expressing SbMYB86 were taken, RNA was extracted, and cDNA was reverse transcribed (for qPCR). The expression level of SbMYB86 was identified by qRT-PCR.

[0101] (4) Detection of phenotypes and physiological indicators of transgenic Arabidopsis seedlings under salt stress

[0102] Wild-type and T3 generation homozygous heterologously expressing SbMYB86 Arabidopsis thaliana grown in soil under normal conditions for 3 weeks with consistent growth were selected. Six pots were planted per tray, with four plants planted per pot. 250 mL of 200 mM NaCl was irrigated into the tray every two days until phenotypic differences appeared. The results were recorded by photographing.

[0103] The sterilized wild-type and T3 generation homozygous heterologous expression SbMYB86 Arabidopsis seeds were sown on 1 / 2MS medium for normal growth. After 5 days, seedlings with consistent growth were selected and transferred to 1 / 2MS solid medium containing 0 and 150mM NaCl concentrations. After vertical placement and culture for 10 days, the root length was measured using ImageJ software. The fresh weight was weighed and the residual culture medium was cleaned. Three replicates were set for each group.

[0104] Wild-type and T3-generation homozygous heterologously expressing SbMYB86 Arabidopsis plants grown in soil under normal conditions for three weeks with consistent growth were selected. Six pots, four plants per pot, were planted per tray. The plants were irrigated with 250 mL of 200 mM NaCl every two days for one week. Leaves were then sampled and physiological parameters, including peroxidase (POD) activity, malondialdehyde (MDA) content, catalase (CAT) activity, and proline (Pro) superoxide dismutase (SOD) activity, were measured. Three replicates were set for each sample. Specific procedures were described in the instructions for the physiological indicator kits.

[0105] The relative plasma membrane permeability of Arabidopsis leaves was determined using the conductivity method. Three replicates were set for each sample. The specific steps are as follows:

[0106] ① Rinse the leaves with deionized water, dry them, and then use a hole puncher to punch holes for sampling.

[0107] ② Place 10 pieces of material with basically the same wound surface into a dry test tube, add 10 mL of deionized water, and let it stand at room temperature for 30 minutes. Use a conductivity meter to measure and record the conductivity (L1).

[0108] ③ Place the test tube in boiling water, take it out after 5 minutes, cool it to room temperature, and perform the second conductivity measurement (L2).

[0109] ④ Calculate the relative plasma membrane permeability using the following formula: Relative plasma membrane permeability (%) = (L1 / L2) × 100%

[0110] 2. Experimental results and analysis

[0111] (1) The results showed that after one week of salt treatment, the growth of T3 generation Arabidopsis heterologously expressing SbMYB86 was significantly better than that of wild type (see Figure 11, Table 3, Table 4), its SOD, Pro, POD, and CAT activities were significantly enhanced compared with the wild type, and its relative plasma membrane permeability and MDA were lower than those of the wild type ( Figure 12 , Table 5).

[0112] Table 3 Statistics of seed germination rate of Arabidopsis thaliana (T3) heterologously expressing SbMYB86

[0113]

[0114] Table 4 Statistics of root length and fresh weight of Arabidopsis thaliana (T3) heterologously expressing SbMYB86

[0115]

[0116] Table 5 Physiological index determination of Arabidopsis thaliana (T3) heterologously expressing SbMYB86

[0117]

[0118]

[0119] (2) Gene expression was determined by qRT-PCR. The results showed that under salt stress conditions, the expression levels of salt stress-related genes NHX1, RD20, SOS1, SOS4, and SOS5 were significantly upregulated in Arabidopsis thaliana heterologously expressing SbMYB86 in the T3 generation (see Figure 13 , Table 6), which indicated that SbMYB86 might participate in the response to salt stress by affecting the salt stress signal transduction pathway, thereby enhancing the salt tolerance of Arabidopsis.

[0120] Table 6 Expression levels of salt stress-related genes in Arabidopsis thaliana (T3) heterologously expressing SbMYB86

[0121]

[0122] Example 6 Analysis of Physiological Response and Salt Tolerance of SbMYB86 Gene-Silenced Transgenic Scutellaria Baicalensis under Salt Stress

[0123] In this example, a TRV2-SbMYB86 gene silencing vector was constructed, Agrobacterium was transformed, and a vacuum transient infection method was used to successfully obtain SbMYB86 gene-silenced Scutellaria baicalensis plants. The Scutellaria baicalensis plants were treated with 0.5% salt stress for 60 h.

[0124] 1. Experimental methods

[0125] (1) Construction of TRV2-SbMYB86 gene silencing vector

[0126] The website SGN-VIGS (https: / / vigs.solgenomics.net / ) was used to predict the optimal silencing fragment. Based on the obtained optimal silencing fragment, PCR amplification primers with KpnI and EcoRI restriction sites and TRV2 homology arms were designed. PCR amplification was performed using a high-fidelity enzyme, and the PCR product was subjected to gel electrophoresis. The bright and correct-length band was excised and recovered, and the product was purified. The concentration and purity were detected using an ultra-micro UV spectrophotometer. The TRV2 vector was double-digested with KpnI and EcoRI, and the linear vector fragment was recovered by gel electrophoresis. Homologous recombination was used for ligation to obtain the TRV2-SbMYB86 recombinant plasmid.

[0127] (2) Acquisition and identification of transgenic Scutellaria baicalensis with SbMYB86 gene silenced

[0128] The correctly sequenced TRV2-SbMYB86 recombinant plasmid was transformed into Agrobacterium GV3101 and screened using LB solid medium supplemented with Kan and Rif. Single colonies were picked for bacterial liquid PCR identification. The bacterial liquid identified as positive was expanded and cultured, and the bacteria were preserved for use.

[0129] Evenly spread Scutellaria seeds in a moist petri dish. After incubating at 22°C for about 10 days, transplant uniformly grown seedlings into soil, planting 4 plants per pot and placing 12 pots in a tray. After 21 days of soil cultivation, perform transient transformation of Scutellaria baicalensis. Follow the steps below:

[0130] Prepare VIGS infection solution according to actual usage. The pH of the infection solution is 5.6, the final concentration of MES is 10 mmol / L, the final concentration of MgCl2 is 10 mmol / L, and the final concentration of acetosyringone (AS) is 150 μmol / L. TRV1, TRV2, and Agrobacterium transformed with TRV2-SbMYB86 were activated by shaking overnight. The activated bacterial solution was propagated in a volume ratio of 2:1:1 of TRV1:TRV2:TRV2-SbMYB86 and centrifuged at 4000 rpm for 10 minutes at room temperature to collect the cells. Resuspend the cells in the prepared infection solution and measure the OD600 of TRV1 using a spectrophotometer to 0.8 for TRV1 and 0.4 for TRV2 and TRV2-SbMYB86. Equal volumes of the TRV1, TRV2, and TRV2-SbMYB86 suspensions were mixed and incubated with shaking at 25°C for 3 hours. Before infection, Silwet-L77 was added to the mixture to a final concentration of 0.04% to promote infection and transformation. Vacuum inoculation was performed for 3 minutes. The vacuum-infected plants were placed in a dark incubator overnight and then transferred to normal daylight conditions for light incubation. After 9 days of incubation, samples were harvested, RNA was extracted, and cDNA was reverse-transcribed for qPCR. The expression of SbMYB86 was analyzed by qRT-PCR to verify gene silencing.

[0131] (3) Detection of phenotypes and physiological indicators of transgenic Scutellaria baicalensis under salt stress

[0132] Nine days after infection, 250 mL of 0.5% NaCl solution was poured into trays. Samples were collected from control and gene-silenced Scutellaria baicalensis plants at 0 and 60 hours of salt stress. Multiple physiological parameters were measured, including peroxidase (POD) activity, malondialdehyde (MDA) content, catalase (CAT) activity, and proline (Pro) superoxide dismutase (SOD) activity. Three replicates were set for each sample. Specific procedures were described in the instructions for the physiological indicator kits.

[0133] The relative plasma membrane permeability of Arabidopsis leaves was determined using the conductivity method, with three replicates for each sample. The specific steps were as follows: rinse the leaves with deionized water, dry the water, and then use a hole puncher to punch and collect the sample. Place 10 pieces of material with basically the same wounds in a dry test tube, add 10 mL of deionized water, and let it stand at room temperature for 30 minutes. Use a conductivity meter to measure and record the conductivity (L1). Place the test tube in boiling water, take it out after 5 minutes, cool it to room temperature, and perform a second conductivity measurement (L2). Use the following formula to calculate the relative plasma membrane permeability: Relative plasma membrane permeability (%) = (L1 / L2) × 100%

[0134] 2. Experimental results and analysis

[0135] The results showed that after silencing the SbMYB86 gene, the relative plasma membrane permeability and MDA of the Scutellaria baicalensis plants were higher than those of the control group, and SOD, POD, and Pro were significantly decreased compared with the control group (see Figure 14 , Table 7), indicating that the salt tolerance of S. baicalensis plants with gene silencing SbMYB86 decreased to a certain extent compared with the control group. The relative expression levels of salt stress-related genes SbNHX1 and SbSOS1 were significantly lower than those in the control group (see Figure 15 , Table 8), which indicated that silencing the SbMYB86 gene reduced the salt tolerance of Scutellaria baicalensis.

[0136] Table 7 Physiological indexes of Scutellaria baicalensis after gene silencing SbMYB86

[0137]

[0138] Table 8 Expression levels of salt stress-related genes in Scutellaria baicalensis silencing SbMYB86

[0139]

[0140] It is understandable that those skilled in the art can make equivalent substitutions or changes based on the technical solutions and concepts of the present invention, and all these changes or substitutions should fall within the scope of protection of the claims attached to the present invention.

Claims

1. A SbMYB86 gene related to salt stress in Scutellaria baicalensis, characterized in that: Its nucleotide sequence is shown in SEQ ID NO:

1.

2. The protein encoded by the SbMYB86 gene related to salt stress in Scutellaria baicalensis according to claim 1, characterized in that: Its amino acid sequence is shown in SEQ ID NO:

2.

3. A recombinant vector, characterized in that The recombinant vector carries the polynucleotide sequence of the SbMYB86 gene related to salt stress of Scutellaria baicalensis as claimed in claim 1, and the recombinant vector is a cloning vector or an expression vector for expressing the polynucleotide.

4. The recombinant vector according to claim 3, characterized in that The original vector of the recombinant vector is pGBKT7 vector.

5. A recombinant host cell, characterized in that The invention comprises the polynucleotide sequence of the SbMYB86 gene related to salt stress of Scutellaria baicalensis according to claim 1 or the recombinant vector according to claim 3, or the polynucleotide sequence of the SbMYB86 gene related to salt stress of Scutellaria baicalensis according to claim 1 is integrated into its genome.

6. Use of the SbMYB86 gene related to salt stress of Scutellaria baicalensis as claimed in claim 1 or the protein as claimed in claim 2 in cultivating salt-tolerant transgenic plants.

7. The application according to claim 6, characterized in that The plant is Scutellaria baicalensis or Arabidopsis thaliana.

8. Use of the SbMYB86 gene related to salt stress in Scutellaria baicalensis as claimed in claim 1 or the protein as claimed in claim 2 in reducing the salt tolerance of plants.

9. A method for preparing a salt-alkali resistant transgenic plant, the preparation method comprising: S1. Constructing the aforementioned SbMYB86 gene overexpression recombinant plant expression vector; S2. The SbMYB86 gene overexpression recombinant plant expression vector is transformed into plants to overexpress the SbMYB86 gene in the plants, and the salt tolerance of the resulting transgenic plants is improved.

10. A specific primer pair for identifying the SbMYB86 gene related to salt stress in Scutellaria baicalensis according to claim 1, characterized in that: The specific primer pair includes SbMYB86-F1 and SbMYB86-R1, whose sequences are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively.

Images