Setaria italica plant type regulation gene, mutant gene and application thereof

Abstract

The invention discloses application of a millet plant type regulation gene. Plant types comprise plant height and / or tillering. The SiDT1 gene (the nucleotide sequence is shown as Seq ID No: 1) is cloned by utilizing a dwarf tillering millet mutant through a map-based cloning method, the function of the gene is verified through transgene complementation, the gene encodes a gibberellin 3 oxidase (the amino acid sequence is shown as Seq ID No: 2), and the characters of plant height, tillering and the like are influenced by influencing synthesis of gibberellin active substances. The invention also discloses a mutant gene of the gene, a protein coded by the mutant gene, a plasmid containing the mutant gene, a plant expression vector, a host cell and application of the mutant gene in regulation and control of plant types. The invention also discloses an application of a mutant containing the mutant gene in regulation and control of the millet plant type, and discloses an application of a molecular marker closely linked with the millet plant type regulation and control gene. The invention provides a new thought for shaping a new variety of ideal plant types of plants.

Description

Technical Field

[0001] The present invention relates to the field of plant genetic engineering, in particular to a millet plant type regulating gene, a mutant gene and applications thereof. Background Art

[0002] Millet, an ancient C4 crop originating in my country, boasts high light efficiency, strong drought and barrenness tolerance, and a rich nutritional profile, making it an ideal vehicle for developing marginal land resources and supplementing a nutritious and healthy staple food. However, millet's current yield per unit area lags significantly behind that of staple crops like rice and wheat.

[0003] Millet's high planting density and tall plant height lead to severe lodging in actual production. Irrational plant structure has become a key bottleneck restricting high and stable yields. Identifying and applying genes that control millet plant structure could help improve lodging resistance and enhance both yield and quality. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide a millet plant type regulating gene and a mutant gene thereof; and to develop related applications based thereon.

[0005] In order to solve the above-mentioned technical problems, the present invention adopts the following technical solutions:

[0006] On the one hand, the present invention provides an application of a millet plant type regulating gene, the amino acid sequence of the protein encoded by the gene is shown in Seq ID No: 2, and the application is for regulating plant type, and the plant type includes plant height and / or tillering.

[0007] As a further improvement of the present invention, the application also includes regulating the length of the ear of grain.

[0008] Furthermore, the nucleotide sequence of the gene is shown in Seq ID No: 1.

[0009] Furthermore, plant architecture can be regulated through genetic modification or gene mutation. For example, in millet, the aforementioned genes can be used to transform millet cells, which can then be grown into plants to improve the plant architecture. Alternatively, the aforementioned genes can be mutated through genetic mutation methods, such as natural mutation, artificial mutagenesis, or gene editing, to alter millet architecture, such as by reducing plant height or tiller number, thereby improving lodging resistance.

[0010] In another aspect, the present invention provides a mutant gene of a millet plant type regulating gene, which is a gene mutated from the gene shown in Seq ID No: 1. The gene mutation herein can be achieved by natural mutation, artificial mutagenesis, or gene editing.

[0011] Furthermore, the mutant gene is a nucleotide sequence in which A is replaced by T at position 1188 in the nucleotide sequence shown in Seq ID No: 1.

[0012] In a third aspect, the present invention provides a protein encoded by the above-mentioned mutant gene, a plasmid, a plant expression vector or a host cell containing the above-mentioned mutant gene; the protein encoded by the mutant gene is an amino acid sequence in which N at position 280 in the amino acid sequence shown in Seq ID No: 2 is replaced by Y.

[0013] In a fourth aspect, the present invention further provides an application of the above-mentioned mutant gene, protein, plasmid, plant expression vector or host cell, wherein the application is:

[0014] Application in regulating plant type, the plant type includes plant height and / or tillering.

[0015] In a fifth aspect, the present invention further provides a use of a millet plant type mutant containing the aforementioned mutant gene, wherein the mutant is used to control millet plant type, including plant height and / or tillering, through hybridization or backcrossing breeding. This method can be used to breed millet with a short, tillering plant type.

[0016] In a sixth aspect, the present invention further provides an application of a molecular marker tightly linked to a millet plant type regulatory gene, wherein the primer sequence of the molecular marker is:

[0017] M5 upstream primer: TCGGTGGAGTATGAGTGTGTC;

[0018] M5 downstream primer CCAGTAATTGCTTCGGGTGAAC;

[0019] Or the primer sequence of the molecular marker is:

[0020] M8 upstream primer CGTGGATGCACTTATGTCATTTTG;

[0021] M8 downstream primer CCTCCTCCTGGTCTCCCTAAT;

[0022] Or the molecular marker primer sequence is:

[0023] M4 upstream primer: TCATTATTGGTTAATCTAGT;

[0024] M4 upstream primer: CTCCTATATTTGTATGAATG;

[0025] The application is in molecular marker-assisted plant type selection, where the plant type includes plant height and / or tillering. Taking millet as an example, this molecular marker-assisted selection breeding method can be used to select short-stemmed, tillering millet varieties at an early stage.

[0026] In order to obtain the correlation between the above genes and functions of the present invention, the research technical steps of the present invention are as follows:

[0027] The present invention obtains a dwarf and tillering mutant sidt1 (Setaria italica dwarf and tillering 1) in a millet background through EMS (Ethylmethanesulfonate) mutagenesis, and obtains the F1 generation by crossbreeding with the wild type. The field-planted phenotype of the F1 generation is consistent with that of the wild type, indicating that the gene is a recessive mutation. The mutant is crossed with a conventional millet variety to construct a genetic mapping population, and mutant phenotype individual plants are selected from the F2 population for gene linkage analysis and fine mapping, and the mutation site is determined by sequencing. Finally, a complementation vector is constructed, and the normal sequence of the gene is transferred into Arabidopsis thaliana and rice homologous mutants through Agrobacterium-mediated transfer. Because the transferred normal gene sequence can perform normal gene functions, the resulting transgenic Arabidopsis thaliana and rice plants have restored their normal phenotypes.

[0028] By adopting the above technical solution, the present invention has at least the following beneficial effects:

[0029] 1. The present invention cloned a millet plant type gene SiDT1 by map-based cloning and verified the function of the gene through transgenic complementation; it provides a new idea for shaping the ideal plant type of plants, especially millets of the Poaceae family.

[0030] 2. Plant architecture is a crucial component of millet lodging resistance and yield improvement, and is currently a key focus in crop breeding. The cloning and application of the SiDT1 gene can improve plant architecture in plants, particularly millets from the Poaceae family. Therefore, this invention provides new insights into plant architecture improvement. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] The above is only an overview of the technical solution of the present invention. In order to more clearly understand the technical means of the present invention, the present invention is further described in detail below in conjunction with the accompanying drawings and specific embodiments.

[0032] Figure 1Figure 1 is a comparison of phenotypic traits between the wild type and mutants, where: AE: phenotypic identification of the wild type WT and the mutant sidt1, where A is a plant at the grain filling stage (Bar = 25 cm), B is a plant at the seedling stage (Bar = 3 cm), C is a stem at the mature stage (Bar = 25 cm), and D is a leaf at the grain filling stage (Bar = 5 cm); E is a grain ear at the mature stage (Bar = 5 cm); FK is the field measurement results of different phenotypic traits of the wild type WT and the mutant sidt1, and ** indicates that the difference is extremely significant;

[0033] Figure 2 Comparison of stem cell structures between wild-type WT and mutant sidt1, where: AD: cells of the seventh aboveground stem node of WT and sidt1 at mature stage, AB is longitudinal section, CD is transverse section; EH: cells of the fifth aboveground stem node of sidt1 at seedling stage, EF is longitudinal section, GH is transverse section;

[0034] Bar = 50 μm;

[0035] Figure 3 It is the result of different gradient responses of gibberellins;

[0036] Figure 4 Figure 1 is the process of SiDT1 gene localization; AB: Positional cloning of SiDT1; C: Heat map of differentially expressed genes in the candidate interval; D: Mutation pattern of SiDT1 gene;

[0037] Figure 5 is a vector map; A is the map of the pUbi 10-3xFlag Arabidopsis overexpression vector; B is the map of the ZmUBQ-3xFlag transformation vector;

[0038] Figure 6 are transgenic plants; A is a phenotypic comparison between the T2 transgenic plants and the wild-type materials in the functional complementation experiment of the homologous mutants of Arabidopsis thaliana, and B is a phenotypic comparison between the T2 transgenic plants and the wild-type materials of the homologous mutant xiaowei of rice. DETAILED DESCRIPTION

[0039] The following examples further illustrate the present invention but should not be construed as limiting the present invention. Modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and substance of the present invention are within the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. Unless otherwise specified, the biochemical reagents, carriers, consumables, etc. used in the examples are all commercially available products.

[0040] The present invention utilizes a millet mutant with dwarf tillers and first clones the SiDT1 gene through map-based cloning combined with transcriptome analysis. The nucleotide sequence of the gene is shown in Seq ID No: 1 (1858 bp). The gene encodes a gibberellin 3 oxidase, and the amino acid sequence of the gene is shown in Seq ID No: 2 (382). The gene affects plant height, tiller number, and other traits by affecting the synthesis of gibberellin active substances. The present invention clarifies the specific coding sequence and mechanism of action of the gene, and understands the biochemical function and application of its protein product. Based on this, the gene can be truly mastered and put into practical use.

[0041] The technical steps for implementing the present invention are as follows:

[0042] 1. Phenotype of the millet dwarf tillering mutant sidt1:

[0043] The millet dwarf tiller sidt1 of the present invention is derived from the EMS-induced mutant library of Jingu No. 40 (JG40). Figure 1 As shown, compared with the wild type (tall stem, single stem), the sidt1 mutant has a significantly lower plant height throughout the entire growth cycle and has 2-3 tillers. The mutant plant height at maturity is 101.45 cm, which is about 61.30% of the wild type; in addition to plant height, the mutant's panicle length, panicle neck length, and second leaf length are significantly shorter than those of the wild type at the same stage. The number of main stem nodes of the mutant is no different from that of the wild type, but the internode length is significantly shortened. Paraffin sections were made on the 5th stem at the seedling stage and observed using a confocal microscope; the 7th stem at maturity was scanned using a Helios field emission cryo-scanning electron microscope ( Figure 2 The results showed that the average longitudinal cell length of the mutant was significantly shorter than that of the wild type, and the difference was large during the seedling stage, indicating that the shortened internodes of the main stem of the dwarf mutant were mainly due to the reduction of the longitudinal cell length.

[0044] 2. Clarifying the phenotypic changes caused by the gibberellin synthesis pathway

[0045] Based on the fact that the mutant phenotype is very similar to the dwarf stem caused by gibberellin deficiency, the wild type and mutant were hydroponically cultured and treated with different concentrations (7.6 x 10 -9 to 7.6x 10 -6 ) Gibberellic acid GA3, the results showed that the mutant responded to gibberellin, indicating that the mutant was a gibberellin-deficient mutant. At different concentrations, the wild type and mutant had certain differences in their response to gibberellin. When the concentration reached 7.05x10 -8 mol / L, the height of the mutant strain was basically restored. When the concentration reached 7.05x 10 - 7mol / L, the mutant plant height surpassed that of the wild type, indicating that the mutant responded faster and was more sensitive to GA3. When the GA3 concentration was higher (7.05x 10 -6 mol / L), both the wild type and the mutant were inhibited ( Figure 3 ).

[0046] 3. Cloning of the SiDT1 gene that controls dwarf stem and tillering in millet:

[0047] 1. Location of the SiDT1 gene:

[0048] The mutant sidt1 was reciprocally crossed with the wild type JG40, and the segregation ratios of normal plants (tall stems) and dwarf plants in the F2 population were counted and tested using statistical methods (Table 1), indicating that the mutant was a recessive single gene mutation.

[0049] Table 1 Genetic analysis of mutant sidt1

[0050]

[0051] To isolate the SiDT1 gene, the present invention first assembled an F2 generation genetic mapping population, sidt1×Yugu1, and selected individual plants exhibiting a dwarf, tillering mutant phenotype as the mapping population. Using positional cloning, molecular markers evenly distributed throughout the genome were used to locate the SiDT1 gene locus. It was located on chromosome 5, between markers M5 and M8 ( Figure 4 AB).

[0052] 2. Transcriptome analysis to identify target genes:

[0053] To further identify target genes, transcriptome analysis was performed on seedlings with phenotypic differences between the wild type and mutants. All genes detected between the wild type and mutants were screened for differences using p-adj ≤ 0.05 and |log2FC| ≥ 1 as screening criteria. A total of 9782 differentially expressed genes were obtained, of which 4312 genes were upregulated and 5470 genes were downregulated. There were 25 differentially expressed genes in the target positioning interval, of which 13 genes were upregulated and 12 genes were downregulated ( Figure 4 C), combined with the differentially expressed genes in the gibberellin biosynthesis pathway, comprehensive analysis finally locked the target gene SiDT1, which is 32.6Mb away from the rice Green Revolution SD1 homologous gene SiSD1 in foxtail millet ( Figure 4A), and finally the mutation site was determined by Sanger sequencing. The base at this site was replaced by A to T (position 1188 in the nucleotide sequence shown in Seq ID No: 1), causing an asparagine (N) with a hydrophilic side chain in the conserved domain of the protein to mutate to an aromatic amino acid - tyrosine (Y) with a hydrophobic side chain (position 280 in the amino acid sequence shown in Seq ID No: 2), thus causing a change in the function of the gene ( Figure 4 D).

[0054] 3. Identification and functional analysis of the SiDT1 gene:

[0055] The overexpression vector pUBi-SiDT1 was constructed, and through transgenic complementation experiments, transgenic Arabidopsis thaliana was obtained in which the homologous mutant atdt1 of Arabidopsis thaliana was restored to the normal wild-type phenotype; at the same time, the transgenic xiaowei ( Figure 5 、 Figure 6 ).

[0056] The following is a detailed description with reference to the embodiments:

[0057] Example 1:

[0058] 1. Millet materials:

[0059] A dwarf and tillering mutant of millet (Setaria italica) was named sidt1 (Setaria italicadwarf and tillering 1), and the original wild-type material was Jingu 40 (JG40).

[0060] 2. Analyze and position the group:

[0061] The homozygous sidt1 mutant was hybridized with Jingu 40 variety, and the F1 generation was self-pollinated to obtain the F2 population. Genetic statistical analysis was performed to determine that SiDT1 was recessive. Sidt1 was hybridized with Yugu1 to construct an F2 genetic mapping population, from which 121 individuals with the same dwarf tillering phenotype as the mutant sidt1 were selected as the mapping population, and genomic DNA was extracted.

[0062] 3. Molecular marker localization of the SiDT1 gene

[0063] Genomic DNA for gene mapping was extracted from millet leaves using the CTAB extraction method. Approximately 0.2 g of rice leaves were quickly frozen in liquid nitrogen, ground into a powder, and transferred to a 2 ml centrifuge tube. 750 μl of DNA CTAB extraction solution was added, mixed, and then incubated at 65°C for approximately 50 minutes, with vortexing every 15 minutes. The tube was then fully extracted with 500 μl of chloroform. After centrifugation, 500 μl of the supernatant was transferred to a 1.5 ml centrifuge tube. An equal volume of ethanol was then added to the supernatant, gently mixed, refrigerated at -20°C for 1 hour, and centrifuged. The supernatant was discarded, retaining the DNA pellet at the bottom of the tube. The DNA was then washed twice with 70% ethanol. Once the DNA dried, it was dissolved in 60 μl of ddH2O for later use.

[0064] Preliminary mapping of the SiDT1 gene: A small, preliminary mapping population of 194 individuals with mutant phenotypes was selected from the F2 population of the sidt1 and Yugu1 gene combinations for linkage analysis. Using the Setaria-DB database (http: / / 111.203.21.71:8000 / index.html), molecular markers approximately evenly distributed across nine chromosomes were selected for preliminary mapping. Testing of recessive individuals in the genetic population led to the candidate gene being localized to chromosome 5. InDel markers were designed on chromosome 5 for fine mapping of the target gene, ultimately localizing it to a 1.80 Mb interval (markers M5 and M8).

[0065] Table 2 PCR reaction procedure

[0066]

[0067] The molecular marker sequences used for preliminary and fine mapping are shown in Table 3 (Seq ID No: 3-24).

[0068] Table 3 Molecular marker sequences

[0069]

[0070] 4. Gene prediction and comparative analysis:

[0071] To further identify target genes, transcriptome analysis was performed on seedlings with phenotypic differences between the wild type and mutants. All genes detected between the wild type and mutants were screened for differences using p-adj ≤ 0.05 and |log2FC| ≥ 1 as screening criteria. A total of 9782 differentially expressed genes were obtained, of which 4312 genes were upregulated and 5470 genes were downregulated. There were 25 differentially expressed genes in the target positioning interval, of which 13 genes were upregulated and 12 genes were downregulated ( Figure 4C), combined with the differentially expressed genes in the gibberellin biosynthesis pathway, comprehensive analysis finally locked the target gene SiDT1, which is 32.6Mb away from the rice Green Revolution SD1 homologous gene SiSD1 in foxtail millet ( Figure 4 A), and finally the mutation site was determined by Sanger sequencing. The base at this site was replaced by A to T (position 1188 in the nucleotide sequence shown in Seq ID No: 1), causing an asparagine (N) with a hydrophilic side chain in the conserved domain of the protein to mutate to an aromatic amino acid - tyrosine (Y) with a hydrophobic side chain (position 280 in the amino acid sequence shown in Seq ID No: 2), thus causing a change in the function of the gene ( Figure 4 D).

[0072] Example 2: Plant transformation

[0073] 1. Construction of intermediate vector pDONR221:

[0074] The target gene was transferred to the PD221 vector by BP reaction using Gateway technology, and then transformed into Escherichia coli DH5α by electroporation. After verification, the vector was stored for future use.

[0075] 2. Construction of Arabidopsis overexpression vector pUbi10-3xFlag-SiDT1:

[0076] The target gene was transferred into the Arabidopsis overexpression vector pUbi10-3xFlag ( Figure 5 A) and electroporated Escherichia coli. After verification, the plasmid was extracted and transformed into Agrobacterium tumefaciens, which was then used to infect homologous mutants of Arabidopsis. Plant identification and continuous observation revealed that the height of the overexpressing transgenic plants returned to the normal morphology of the wild type. Compared with the mutants of the same period, the height of the transgenic plants was normal ( Figure 6 A).

[0077] 3. Construction of rice overexpression vector ZmUBQ-3xFlag-SiDT1:

[0078] The target gene was transferred into the rice overexpression vector ZmUBQ-3xFlag-SiDT1 ( Figure 5 B) and electroporated Escherichia coli. After verification, the plasmid was extracted and transformed into Agrobacterium. The rice homologous mutant was genetically transformed for functional verification. The plants were identified and continuously observed. It was found that the height of the overexpressing transgenic plants returned to the normal form of the wild type. Compared with the mutants of the same period, the height of the transgenic plants was normal ( Figure 6 B).

[0079] In addition to transformation in model crops such as Arabidopsis and rice, the present invention also performed gene editing and plant transformation in millet, and obtained similar results.

[0080] Example 3: Other applications

[0081] Since the present invention cloned the SiDT1 gene, it was proved that the gene has the function of regulating the plant type (especially millet in the grass family). Therefore, the gene can be directly applied to dwarf breeding, tillering breeding, etc. of plants (especially millet), and thus lodging resistance breeding and high-yield breeding can also be achieved. After mutation, the gene can achieve the above-mentioned breeding purposes. The gene mutation here can be achieved by natural mutation, artificial mutagenesis or gene editing (such as CRISPR / Cas9). Or it can be achieved by hybridization and backcross breeding with mutants and other millet materials. It is also possible to directly use the above-mentioned mutant genes and various biological materials containing mutant genes to carry out plant (especially millet) breeding and improvement through transgenic methods. In addition, molecular markers (M5, M8, M4) that are closely continuous with the gene during fine positioning can be used for molecular marker-assisted selection breeding.

[0082] The above examples are only some specific embodiments of the present invention. It is necessary to point out that the present invention is not limited to the above examples, and all variations that can be directly derived or associated with the contents disclosed by a person skilled in the art should be considered to be within the scope of protection of the present invention.

Claims

1. An application of a millet plant type regulating gene, characterized in that: The amino acid sequence of the protein encoded by the gene is shown in Seq ID No:

2. The application is to regulate plant type, which includes plant height and / or tillering.

2. The use according to claim 1, characterized in that The application also includes regulating the length of the ear of grain.

3. The use according to claim 1, characterized in that The nucleotide sequence of the gene is shown in Seq ID No:

1.

4. The use according to any one of claims 1 to 3, characterized in that Manipulating plant morphology through genetic modification or gene mutation.

5. A mutant gene of a millet plant type regulatory gene, characterized in that: This is a gene obtained by mutation of the gene shown in Seq ID No:

1.

6. The mutant gene according to claim 5, characterized in that This is a nucleotide sequence in which position 1188 in the nucleotide sequence shown in Seq ID No: 1 is replaced by A with T.

7. A protein encoded by the mutant gene according to claim 5 or 6, a plasmid, a plant expression vector or a host cell containing the mutant gene according to claim 5 or 6; the protein encoded by the mutant gene is an amino acid sequence in which N at position 280 in the amino acid sequence shown in Seq ID No: 2 is replaced by Y.

8. A use of the mutant gene according to claim 5 or 6, the protein according to claim 7, a plasmid, a plant expression vector or a host cell, characterized in that: The applications are: Application in regulating plant type, the plant type includes plant height and / or tillering.

9. An application of a millet plant type mutant, characterized in that: The mutant contains the mutant gene according to claim 5 or 6, and the mutant is used to regulate the plant type of millet through hybridization or backcrossing breeding, and the plant type includes plant height and / or tillering.

10. An application of a molecular marker tightly linked to a millet plant type regulating gene, characterized in that: The primer sequences of the molecular markers are: M5 upstream primer: TCGGTGGAGTATGAGTGTGTC; M5 downstream primer CCAGTAATTGCTTCGGGTGAAC; Or the primer sequence of the molecular marker is: M8 upstream primer CGTGGATGCACTTATGTCATTTTG; M8 downstream primer CCTCCTCCTGGTCTCCCTAAT; Or the molecular marker primer sequence is: M4 upstream primer: TCATTATTGGTTAATCTAGT; M4 upstream primer: CTCCTATATTTGTATGAATG; The application is an application in molecular marker-assisted plant type selection and breeding, and the plant type includes plant height and / or tillering.

Images