Application of SC8 gene in regulation and control of accumulation of soluble solids in tomato fruits and breeding method
By regulating the expression of SC8 gene and using its nitrate transport and vacuole membrane sugar transporter interaction mechanism, the problem of difficulty in accumulating and controlling soluble solids in tomato fruit in the prior art is solved, and the effect of efficiently improving flavor quality and yield is achieved, and a new breeding method is provided.
Patent Information
- Application Number
- CN202510621286.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-14
- Publication Date
- 2025-08-12
AI Technical Summary
The prior art has made slow progress in regulating the accumulation of soluble solids in tomato fruits, and the application of main effect genes is limited, which affects the improvement of tomato flavor quality. Traditional genetic breeding methods may have a negative impact on tomato growth or yield.
By mining and utilizing the SC8 gene, regulating nitrate transport and interaction with vacuole membrane sugar transporter proteins, genetic engineering methods are used to enhance or inhibit SC8 gene expression, positively or negatively regulate the accumulation of soluble solids in tomato fruit, construct SC8 gene knockout or overexpression vectors, and transform tomato plants to increase or decrease the content of soluble solids.
While ensuring tomato yield, it has achieved significant increase or decrease in the content of soluble solids and sugar acid metabolites in the fruit, improved the flavor quality, and provided new breeding ideas for cultivating high-quality flavored tomato varieties and improved the economic benefits of the industry.
Smart Images

Figure CN120464673A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of genetic engineering breeding, and in particular to an application of the SC8 gene in regulating the accumulation of soluble solids in tomato fruits and a breeding method. Background Art
[0002] Tomatoes (Solanum lycopersicum) can be prepared in a variety of ways to enrich consumers' dining tables, and can also be eaten raw as an important source of micronutrients in the human diet. The flavor quality of tomatoes is primarily influenced by their soluble solids content (SSC). Tomato SSC is primarily composed of soluble sugars, organic acids, and volatile substances. Soluble sugars and organic acids are the primary determinants of tomato flavor and are important indicators of fruit quality. Modulating the content of SSC and its components in mature tomato fruit is crucial for improving the taste and flavor quality of the fruit.
[0003] Using the large amount of genetic variation provided by classical genetics or genome-wide association studies, we can reveal the genetic basis of important agronomic traits in tomatoes, identify superior SSC-related genes within tomato germplasm resources, and genetically improve tomato fruit quality. This is a promising breeding strategy for endowing cultivated tomatoes with new functional traits. Although several quantitative trait loci (QTLs) and major genes regulating SSC have been identified, such as the apoplastic sucrose invertase gene Lin5 on chromosome 9 and the tomato sugar transporter gene STP1 on chromosome 2, genetic variation in SSC functional genes remains relatively scarce, and the application of major genes in improving SSC in tomatoes is limited. Furthermore, the introduction of new functional genes into wild tomatoes through genetic breeding often negatively impacts normal growth or yield potential. Therefore, despite some strategies to increase SSC content in tomatoes, progress in improving flavor quality remains slow. Therefore, enriching and improving the existing key genetic variation information related to controlling SSC in tomato fruit, revealing new functional genes in the genetic molecular regulatory mechanism of SSC, and providing scientific guidance for applied research such as breeding and improvement of tomato fruit quality and yield have important practical significance for the research of tomato agronomic traits and the improvement of agricultural production. Summary of the Invention
[0004] In view of the above technical problems in the prior art, the present invention provides an SC8 gene having vacuolar membrane H +The synergistic nitrate ion transport activity can affect the carbon-nitrogen balance in the vacuole by regulating nitrate transport and interacting with tonoplast sugar transporters, thereby negatively regulating the synthesis and accumulation of soluble solids in tomato fruit. The present invention thus provides the use of the SC8 gene in regulating the accumulation of soluble solids in tomato fruit and provides a breeding method for increasing the accumulation of soluble solids in tomato fruit. The present invention is specifically implemented through the following scheme:
[0005] In a first aspect, the present invention provides the use of the SC8 gene in regulating the accumulation of soluble solids in tomato fruit. The cDNA sequence of the SC8 gene is shown in SEQ ID NO.1, or the gDNA sequence of the SC8 gene is shown in SEQ ID NO.2.
[0006] Furthermore, the regulation includes positive regulation or negative regulation; wherein, negative regulation of tomato soluble solids accumulation is achieved by enhancing the expression of the SC8 gene; and positive regulation of tomato soluble solids accumulation is achieved by inhibiting the expression of the SC8 gene.
[0007] Furthermore, positive regulation of tomato soluble solids accumulation includes the following steps: constructing an SC8 gene knockout vector, transforming wild-type tomatoes, and cultivating transgenic tomato plants with reduced SC8 gene expression.
[0008] Furthermore, constructing the SC8 gene knockout vector includes the following steps: designing a target site using tomato SC8 gene gDNA, using SC8-CR-Fw and SC8-CR-Rv primer pairs for PCR amplification to obtain an sgRNA sequence targeting the SC8 gene, and connecting the sgRNA sequence to the pTX041 vector cut by BsaI enzyme through homologous recombination technology to construct the SC8 gene knockout vector; wherein the nucleotide sequences of SC8-CR-Fw and SC8-CR-Rv are shown in SEQ ID NO.11-12, respectively.
[0009] Furthermore, negatively regulating tomato SSC accumulation includes the following steps: constructing an SC8 gene overexpression vector, transforming wild-type tomatoes, and cultivating transgenic tomato plants with increased SC8 gene expression.
[0010] Furthermore, constructing the SC8 gene overexpression vector includes the following steps: using tomato genomic cDNA as a template, PCR amplification is performed using the SC8-OE-Fw and SC8-OE-Rv primer pairs to obtain the cDNA sequence of the SC8 gene, and the cDNA sequence is connected to the pHellstage8 vector double-digested with XhoI and XbaI through homologous recombination technology to construct the SC8 gene overexpression vector; wherein the nucleotide sequences of SC8-OE-Fw and SC8-OE-Rv are shown in SEQ ID NOs.9-10, respectively.
[0011] Furthermore, the wild-type tomato is Ailsa Craig tomato.
[0012] Furthermore, the soluble solids include soluble sugars and / or soluble acids, the soluble sugars include sucrose, fructose and / or glucose, and the soluble acids include malic acid and / or citric acid.
[0013] A second aspect of the present invention provides a breeding method for increasing the soluble solids accumulation of tomatoes, comprising the following steps: inhibiting the expression of the SC8 gene through genetic engineering means to obtain transgenic tomato plants with increased soluble solids accumulation; the cDNA sequence of the SC8 gene is shown as SEQ ID NO.1, or the gDNA sequence of the SC8 gene is shown as SEQ ID NO.2.
[0014] Furthermore, inhibiting the expression of the SC8 gene includes the following steps: constructing an SC8 gene knockout vector, transforming wild-type tomatoes, and cultivating transgenic tomato plants with reduced SC8 gene expression.
[0015] The advantages and positive effects of the present invention are:
[0016] The SC8 gene provided by the present invention has tonoplast H + The synergistic nitrate ion transport activity plays an important role in tomato sugar and acid metabolism and soluble solids synthesis and accumulation by regulating nitrate transport and interacting with tonoplast sugar transport proteins, and negatively regulates the synthesis and accumulation of soluble solids in tomato fruits. The application of the SC8 gene in plant genetic engineering breeding provides new functional sites and breeding ideas for the cultivation of high-quality flavor tomato varieties. By inhibiting the expression of the SC8 gene, the soluble solids and their sugar and acid metabolites sucrose, fructose, glucose, malic acid and citric acid in red ripe tomato fruits can be increased, while by enhancing the expression level of the SC8 gene, the synthesis and accumulation of soluble solids in tomatoes can be reduced; therefore, the implementation of the present invention provides a feasible way to cultivate and produce tomatoes with diverse flavor qualities, and plays an important role in improving the economic benefits of the tomato industry. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings used in describing the embodiments.
[0018] Figure 1 This is a statistical graph of the SSC content of red ripe fruits of two genotype tomato materials at the SSC significantly associated SNP site in the embodiment of the present invention;
[0019] Figure 2 This is a diagram showing the results of linkage disequilibrium analysis of the region near the SSC-significantly associated SNP site in an embodiment of the present invention;
[0020] Figure 3 This is a simplified diagram of the distribution of genes within the SCs gene cluster according to an embodiment of the present invention;
[0021] Figure 4 This is an analysis of the relative expression of the SCs gene cluster in red-ripe fruit of tomato materials with different base mutations in the present invention. Figure A shows the ch05_801303 mutation site, and Figure B shows the ch05_745307 mutation site.
[0022] Figure 5 This is a diagram showing the subcellular localization results of the SC8 gene in an embodiment of the present invention;
[0023] Figure 6 The NO3 of SC8 gene under different nitrate concentrations and pH values in the embodiment of the present invention - transport activity;
[0024] Figure 7 Figure 1 illustrates the identification of SC8 gene overexpression and knockout tomato materials in the examples of the present invention. Figure A shows the SC8 gene expression level in SC8 gene overexpression tomato materials, and Figure B shows the SC8 gene editing method in SC8 gene knockout tomato materials.
[0025] Figure 8 This is the identification of the red ripe fruit phenotype of the SC8 gene overexpression and knockout tomato materials in the embodiment of the present invention; wherein, Figures AF are respectively the SSC, sucrose, fructose, glucose, malic acid and citric acid contents; Figures GK are respectively the statistical results of fruit weight, fruit horizontal diameter, fruit vertical diameter, fruit shape index and fruit set rate; Figure L is a picture of the actual fruit and stalk;
[0026] Figure 9 Figure 1 is a GO enrichment analysis of differentially expressed genes in the transcriptome of red ripe fruit of tomato materials with SC8 gene overexpression and knockout lines according to the present invention; Figure A is a GO enrichment analysis of the SC8 gene overexpression line and the control line, and Figure B is a GO enrichment analysis of the SC8 gene knockout line and the control line;
[0027] Figure 10Figure 1 is an analysis of tonoplast-localized sugar transporter expression in tomato materials with SC8 gene overexpression and knockout lines according to the present invention; Figure A is a whole-tissue expression analysis of tomato gene cluster SCs and reported tonoplast-localized sugar transporter genes, and Figure B is an analysis of tonoplast-localized sugar transporter expression in tomato SC8 gene knockout lines;
[0028] Figure 11 This is an example of the present invention where SC8 interacts with the tonoplast sugar transporter; Figure A is a membrane system yeast point-to-point verification of the interaction between SC8 and the tonoplast-localized sugar transporter, and Figure B is an LCI dual luciferase complementation experiment verifying the interaction between SC8 and the tonoplast-localized sugar transporter. DETAILED DESCRIPTION
[0029] To make the objects, technical solutions, and advantages of the present invention more clearly understood, the present invention is further described in detail below with reference to the following examples. The examples described herein are intended only to illustrate the present invention and are not intended to limit the present invention. All numbers used in the present invention to express amounts, percentages, and other numerical values should be understood to be modified by the word "about" in all cases. Therefore, unless otherwise specified, the numerical parameters listed in the specification and the appended claims are approximate values and may vary depending on the desired properties to be obtained. Each numerical parameter should at least be considered to be based on the reported significant figures and obtained by conventional rounding methods. The meaning of "comprising," "including," "containing," "having," and similar words is non-restrictive, and other steps and other ingredients that do not affect the results can be added. "And / or" should be regarded as a specific disclosure of each of the two specified features or components with or without the other. For example, "A and / or B" will be regarded as including the following situations: (i) A, (ii) B, and (iii) A and B.
[0030] Carbon (C) and nitrogen (N) are the two most abundant elements in all living organisms. They are the primary sources of energy for plants and serve as crucial signals for growth and development. Existing studies have found that substantial increases in nitrogen fertilizer application lead to increased tomato yield and a shortened growth cycle, but this does not translate to a simultaneous improvement in tomato flavor, instead resulting in a more bland flavor. According to the C / N nutrient balance hypothesis, nitrogen fertilizer application not only affects the accumulation of nitrogen metabolism products such as amino acids in plants but also the synthesis of carbon metabolism products. Excessive nitrogen fertilizer application reduces the plant's C / N ratio and reduces residual carbon production. In high-nitrogen environments, a significant amount of carbon skeletons and energy are allocated to nitrogen assimilation, leading to the synthesis and accumulation of amino acids. The remaining carbon source is allocated to secondary metabolic processes or storage tissues, resulting in a decrease in carbohydrate content and affecting crop quality. Therefore, improving quality while maintaining yield is a current focus of tomato research.
[0031] Plants store large amounts of metabolically inactive nitrate and soluble sugar acids in the vacuole. Therefore, a regulated equilibrium is likely maintained between nitrate nitrogen (a nitrogen source) and soluble sugar acids (a carbon source), both stored in the vacuole. To cope with the dynamics of soil nitrate concentrations, higher plants have evolved two distinct nitrate uptake systems in their roots: a low-affinity transport system (LATS) that operates at high nitrate concentrations (>1 mM) and a high-affinity transport system (HATS) that predominates at low nitrate concentrations (<1 mM). Studies have shown that malate and citrate stored in the vacuole can, under certain conditions, be released as substrates for nitrogen metabolism, used to synthesize the carbon skeletons of nitrogen-containing compounds. The tonoplast-localized glycerate transporter NPF8.4 sequesters glycerate, a carbon intermediate of photorespiration, into the vacuole upon nitrogen depletion, mitigating the increased C / N ratio during nitrogen deficiency and thus maintaining carbon-nitrogen balance.
[0032] The present invention uses genomic data obtained by sequencing technology, combined with metabolome data, to conduct a genome-wide association study (mGWAS) of metabolites. The study explored new loci associated with soluble solids accumulation in tomato core germplasm resources, and discovered a similar significant association locus at the front end of tomato chromosome 5. Based on the mGWAS association results, genes within 100Kb upstream and downstream of the site significantly associated with SSC and sucrose content at the front end of chromosome 5 were screened. Through analysis of gene annotation information, sequence characteristics, and expression differences, a gene cluster SCs consisting of 10 homologous genes in series was identified. Evolutionary analysis revealed that this gene cluster belongs to the nitrate transporter NRT1 family. Further analysis of the major genes within the SCs gene cluster revealed that tomato populations were grouped based on genotypes associated with significant loci located near the front end of chromosome 5. The populations were divided into extremely high and extremely low SSC groups based on SSC content, and extremely high and extremely low sucrose groups based on sucrose content. Analysis of the expression levels of 10 genes within the cluster revealed that SC8 had the highest expression in the extremely low SSC and sucrose groups, with the most significant differences between the groups. Therefore, the SC8 gene (SGN database gene ID: Solyc05g005990) was identified as the major gene, and its expression level showed an inverse trend with the SSC content within the population. This suggests that SC8 plays a negative regulatory role in the accumulation of SSC and sugar and acid content in ripe tomato fruit.
[0033] The biological function of SC8 gene was analyzed. Subcellular localization experiments confirmed that the gene cluster SCs was located in the vacuole membrane. Xenopus oocyte transport experiments confirmed that SC8 had H + Synergistic nitrate (NO3 -) ion transport activity, and according to the external environment NO3 - The affinity and transport direction of nitrate ions are different due to changes in concentration and pH; - In an acidic environment, it is active for efflux. In high concentrations of NO3 - In an acidic environment, SC8 exhibits systemic activity. Furthermore, yeast two-hybrid and dual-luciferase complementation experiments revealed that SC8 interacts with multiple tomato vacuolar sugar transporters, such as TMT1, SUT4, and VGT1. This study preliminarily elucidates the mechanism by which SC8 indirectly regulates soluble solids accumulation and flavor quality in tomato fruit by regulating nitrate transport and altering the carbon-nitrogen balance within the vacuole.
[0034] The SC8 gene was transformed into Ailsa Craig (AC) tomato plants, generating SC8 overexpression and knockout lines. The total SSC content and sugar and acid metabolite content of the red-ripe fruits of the transformed plants were measured. Compared with the wild-type, the SSC content, as well as the sucrose, fructose, glucose, malic acid, and citric acid contents, decreased in the SC8 overexpression line, while the SSC content, as well as the sucrose, fructose, glucose, malic acid, and citric acid contents, increased significantly in the knockout line, confirming that downregulating SC8 expression is beneficial for increasing SSC accumulation in tomato fruit. Furthermore, phenotypic characterization of the transformed plants revealed that the SC8 gene did not affect the growth phenotype of the tomato plants. Fruit weight, fruit diameter, fruit diameter, and fruit shape index remained unchanged compared to the control line. In contrast, the fruit set rate of the SC8 knockout line was significantly higher than that of the control and overexpression lines.
[0035] Based on the above results, it can be seen that the SC8 gene plays an important role in tomato sugar and acid metabolism and soluble solids synthesis and accumulation. It changes the carbon and nitrogen balance in the vacuole by regulating nitrate transport and interacting with tonoplast sugar transporters, thereby indirectly negatively regulating the synthesis and accumulation of soluble solids in tomato fruit. This present invention provides a theoretical basis and scientific guidance for analyzing the regulation of SC8 gene regulation in tomato fruit flavor quality and metabolic network. This helps to explain the relationship between nitrogen fertilizer application and tomato fruit flavor changes in field production, provides a theoretical reference for improving tomato fruit quality in actual production, and applies the SC8 gene to plant genetic engineering breeding, providing new functional sites and breeding ideas for cultivating high-quality flavor tomato varieties, which plays an important role in improving the economic benefits of the tomato industry.
[0036] Based on this, one embodiment of the present invention provides the use of the SC8 gene in regulating the accumulation of soluble solids in tomato fruit, wherein the cDNA sequence of the SC8 gene is shown in SEQ ID NO.1, or the gDNA sequence of the SC8 gene is shown in SEQ ID NO.2.
[0037] The tomato SC8 gene has a negative regulatory effect on the synthesis and accumulation of soluble solids. Through genetic engineering breeding, by inhibiting the expression of the SC8 gene, the soluble solids and their sugar and acid metabolites sucrose, fructose, glucose, malic acid and citric acid in ripe red tomato fruits can be increased, providing new functional sites and breeding ideas for the cultivation of tomato varieties with high SSC content and high-quality flavor; and by enhancing the expression level of the SC8 gene, the synthesis and accumulation of soluble solids in tomatoes can be reduced, providing effective biological materials for studying the SSC synthesis regulatory network and molecular mechanism, and providing a feasible way to cultivate and produce tomatoes with diverse flavor qualities.
[0038] Optionally, the soluble solids include soluble sugars and soluble acids, wherein the soluble sugars include sucrose, fructose, and glucose, and the soluble acids include malic acid and citric acid. The changing trends of the sucrose, fructose, glucose, malic acid, and citric acid contents are consistent with the trend of the total soluble solids.
[0039] Optionally, the regulatory effect described above includes positive regulation or negative regulation. By enhancing the expression of the SC8 gene, negative regulation of tomato SSC accumulation can be achieved; by inhibiting the expression of the SC8 gene, positive regulation of tomato SSC accumulation can be achieved. It should be noted that the expression level of the SC8 gene includes the expression level at the gene level (mRNA) and / or the expression level at the protein level. The gene level can be achieved through RNA interference technology, CRISPR-Cas9 technology, or overexpression vectors, and the protein level can be achieved through protein activators or inhibitors. This is a conventional technical means in the art and will not be described in detail here.
[0040] Specifically, positively regulating tomato SSC accumulation includes the following steps: constructing an SC8 gene knockout vector, transforming wild-type tomatoes, and cultivating transgenic tomato plants with reduced SC8 gene expression. More specifically, constructing the SC8 gene knockout vector includes the following steps: designing a target site using tomato SC8 gene gDNA, performing PCR amplification using the SC8-CR-Fw and SC8-CR-Rv primer pairs to obtain a sgRNA sequence targeting the SC8 gene, and ligating the sgRNA sequence to a BsaI-cleaved pTX041 vector via homologous recombination technology to construct the SC8 gene knockout vector; wherein the nucleotide sequences of SC8-CR-Fw and SC8-CR-Rv are shown in SEQ ID NOs. 11-12, respectively.
[0041] Specifically, negatively regulating tomato SSC accumulation includes the following steps: constructing an SC8 gene overexpression vector, transforming wild-type tomatoes, and cultivating transgenic tomato plants with elevated SC8 gene expression. More specifically, constructing the SC8 gene overexpression vector includes the following steps: using tomato genomic cDNA as a template, performing PCR amplification using the SC8-OE-Fw and SC8-OE-Rv primer pairs to obtain the SC8 gene cDNA sequence, and ligating the cDNA sequence to a pHellstage8 vector digested with XhoI and XbaI via homologous recombination technology to construct the SC8 gene overexpression vector. The nucleotide sequences of SC8-OE-Fw and SC8-OE-Rv are shown in SEQ ID NOs. 9-10, respectively.
[0042] Optionally, the wild-type tomato mentioned above is Ailsa Craig (AC) tomato.
[0043] Transformation of wild-type tomatoes with the SC8 gene overexpression vector and knockout vector described above can be performed using conventional techniques familiar to those skilled in the art. Knockout or overexpression vectors carrying the SC8 gene can be introduced into tomato cells or tissues using DNA transfection methods such as calcium phosphate co-precipitation, Ti plasmids, Ri plasmids, viral vectors, gene guns, microinjection, electroporation, or Agrobacterium-mediated transfection.
[0044] Based on the same inventive concept as above, an embodiment of the present invention further provides a breeding method for increasing the soluble solids accumulation of tomatoes, comprising the following steps: inhibiting the expression of the SC8 gene through genetic engineering means to obtain transgenic tomato plants with increased soluble solids accumulation; the cDNA sequence of the SC8 gene is shown as SEQ ID NO.1, or the gDNA sequence of the SC8 gene is shown as SEQ ID NO.2.
[0045] Optionally, inhibiting the expression of the SC8 gene includes the following steps: constructing an SC8 gene knockout vector, transforming wild-type tomatoes, and cultivating transgenic tomato plants with reduced SC8 gene expression, wherein the soluble solids accumulation of the transgenic tomato plants is increased compared to that of the wild-type tomato plants.
[0046] The method for constructing the SC8 gene knockout vector has been described previously and will not be repeated in this example.
[0047] The present invention is further described below with reference to specific examples. Experimental methods in the following examples where specific conditions are not specified are generally performed under conventional conditions, such as those described in the Molecular Cloning Laboratory Manual (4th Edition) published by Cold Spring Harbor Laboratory, or conditions recommended by manufacturers.
[0048] Plants: 302 core tomato germplasm material groups used for genome-wide association analysis (GWAS) were planted at the scientific research and experimental base of Huazhong Agricultural University. The background material used for genetic transformation of tomatoes was TS-9 (Ailsa Craig, AC). The transformed materials and background materials were planted at the scientific research and experimental base of Huazhong Agricultural University and grown under the same environmental conditions for phenotypic statistics and metabolic measurements. The material used for transient expression was Nicotiana benthamiana. Tobacco seeds were sown in nutrient pots. After germination, individual plants were transplanted into 7cm×7cm nutrient pots and placed in a growth room for growth. The growth conditions were 16h / 8h alternating light and dark, relative humidity of 60%-70%, and temperature of 25±2°C. After about 30 days, leaves of tobacco plants with good growth were selected for injection and sampling. The aforementioned germplasm resource materials can be obtained by the public from the applicant for repeating the experiments of the present invention, but may not be used for other purposes.
[0049] Strains: Competent Escherichia coli Trans T1 strain was used for vector construction, Agrobacterium tumefaciens GV3101 strain was used for tomato genetic transformation and tobacco transient expression, and yeast NMY51 strain was used for yeast two-hybrid experiments.
[0050] Vectors: pTX041 vector was used for target gene knockout (see reference [1] “Xie K, Zhang J, Yang Y. Genome-wide prediction of highly specific guide RNA spacers for CRISPR-Cas9-mediated genome editing in model plants and major crops. Molecular Plant, 2014, 7(5): 923-926”); pK7WGF2 vector was used for subcellular vector construction (see reference [2] “Chen X, Wang W, Cai P, Wang Z, Li T, Du Y. The role of the MAP kinase-kinase protein StMKK1 in potato immunity to different pathogens. Horticulture Research, 2021, 8(1): 117”); JW771 and JW772 vectors were used for tobacco transient expression of dual luciferase vector construction (see reference [3] “Chen H, Zou Y, Shang Y, Lin H, Wang Y, Cai R, Tang X, Zhou J. Firefly pBT3-N and pPR3-N vectors were used for membrane yeast two-hybrid vector construction (see reference [4] “Thaminy S, Auerbach D, Arnoldo A, Stagljar I. Identification of novel ErbB3-interacting factors using the split-ubiquitin membrane yeast two-hybrid system. Genome Research, 2003, 13(7): 1744-1753”).
[0051] Gene and Primer: The sequences of the tomato SC8 gene and the primers used in this invention are shown in Table 1. cDNA is complementary DNA (exons only) and contains no introns. gDNA is genomic DNA, which includes the coding region (CDS), noncoding regions, introns, and UTRs (untranslated regions). Primers were synthesized by Qingke Biotechnology. Related gene and genetic transformation sequencing work was completed by BGI. Numbering corresponds to the sequence numbering in the sequence listing (SEQ ID NO.).
[0052] Table 1 DNA sequences of SC8 gene and related primers in the embodiment of the present invention
[0053]
[0054]
[0055]
[0056] 1. Identification of SSC candidate genes by genome-wide association analysis
[0057] The 302 tomato core germplasm materials used for genome-wide association analysis (GWAS) include 3 wild tomatoes (Solanum cheesmaniae), 24 PIM tomatoes (S. pimpinellifolium), 104 CER tomatoes (S. lycopersicum var. cerasiforme), 157 BIG tomatoes (S. lycopersicum) and 14 F1 hybrid cultivars. They were originally from TGRC (Tomato Genetic Resource Center), USDA (United States Department of Agriculture), EU-SOL (European Union Solanaceae Project), INRA (National Agricultural Research Institute) and IVF-CAAS (Institute of Vegetables and Floriculture, Chinese Academy of Agricultural Sciences). The aforementioned tomato populations were planted at the scientific research experimental base of Huazhong Agricultural University. The research related to 302 germplasm materials was published in the literature [5] "Lin T, Zhu G, Zhang J, Xu X, Yu Q, Zheng Z, Zhang Z, LunY, Li S, Wang X, Huang Z, Li J, Zhang C, Wang T, ZhangY, WangA, ZhangY, Lin K, Li C, Xiong G, XueY, Mazzucato A, Causse M, Fei Z, Giovannoni JJ, Chetelat RT, Zamir D, Stadler T, Li J, Ye Z, Du Y, Huang S. Genomic analyses provide insights into the history of tomato breeding. Nature Genetics, 2014, 46(11): 1220-1226". The resequencing data were released in the NCBI database with the accession number SRP045767.
[0058] A genome-wide association analysis was performed on SSC and sucrose content of 302 tomato core germplasm resources. Beagle software was used to estimate missing genotypes, and then the EMMAX algorithm was used for association analysis. The effective number of independent SNPs was calculated by GEC software. The physical position of the SNP was determined based on the tomato reference genome sequence version SL2.50 (link: https: / / solgenomics.net / ftp / tomato_genome / Heinz1706 / annotation / ITAG2.4_release / ). The association analysis results of specific candidate segments were visualized using LocusZoom software. LDBlockShow software was used to calculate the linkage segment of each significant site, visualize the linkage segment and construct the haplotype block, and the linkage segment where the significant SNP was located was used as the candidate region.
[0059] A GWAS analysis of the SSC content of ripe red tomato fruit revealed a significant correlation site, SL2.50ch05_801303, at the front of chromosome 5. Genotypes at the SSC-significant SNP site, SL2.50ch05_801303, were extracted and revealed a TG base variation located in the intergenic region. Combined with phenotypic data, the genotype corresponding to high SSC materials was primarily T, while the genotype corresponding to low SSC materials was primarily G. This base variation was significantly correlated with changes in soluble solids content (see ). Figure 1 ).
[0060] To determine whether the locus is real, a linkage disequilibrium (LDBlock) analysis was performed on the region near SL2.50 ch05_801303 based on the tomato genome version SL2.50. The results are shown in Figure 2 The top figure shows a Manhattan plot of the correlation between tomato SSC content and the variant locus, with the red line representing the recommended threshold. The bottom figure shows a heat map of linkage disequilibrium analysis within the 100 kb genomic region upstream and downstream of the ch05_801303 variant locus. SNPs in linkage disequilibrium are indicated by pink lines, SNPs in linkage equilibrium by light blue lines, SNP-free locations by gray lines, and SNP-block locations are connected by dark green lines. The results showed that the SL2.50 ch05_801303 locus was in significant linkage disequilibrium with nearby loci. Analysis of the 100 kb region upstream and downstream of the QTL revealed that this region contains 34 genes. Combined with gene annotation information, a gene cluster consisting of 10 tandem transporter genes was identified, which was named SCs.
[0061] 2. SCs gene cluster distribution, evolution, and domain analysis
[0062] Protein isoelectric point (pI), molecular weight (MW), hydrophilicity, and stability were predicted using the ProtParamtool on the ExPASy website (https: / / web.expasy.org / protparam / ); subcellular localization was predicted using Plant-mPLoc (http: / / www.csbio.sjtu.edu.cn / bioinf / plant-multi / ); and conserved domains were predicted using the CD-search tool on the NCBI website (https: / / www.ncbi.nlm.nih.gov / Structure / cdd / wrpsb.cgi).
[0063] Using the information in the Sol Genomics Network (SGN) database of Solanaceae, a distribution diagram of the gene cluster was drawn according to the physical positions of the start codon, 5'UTR, exon, intron and 3'UTR of each gene in the gene cluster (see Table 2). Figure 3 , where the arrow length indicates the relative length of the gene, and the arrow direction indicates the transcription direction of the gene). The distribution shows that the gene cluster members are arranged in close series, with only one UDP-glycosyltransferase gene (SGN database gene number Solyc05g005930, Figure 3 The SC5 and SC9 genes are separated by a network of 1,200 small scaffolds (indicated by the red arrow in the middle), and the sequence sizes of the individual members vary. The transcription direction of the SC5 and SC9 genes is opposite to that of the other genes in the cluster. Therefore, it is speculated that the tandem arrangement of this gene cluster may have been formed by gene duplication during evolution.
[0064] Table 2 Basic information of the gene structure of gene cluster SCs
[0065]
[0066] 3. Expression differences of the major gene SC8 for SSC accumulation in tomato fruit in different tomato materials
[0067] Based on the soluble solids GWAS association SL2.50 ch05_801303 site variation information, the tomato population was divided into two types: T genotype and G genotype (see Figure 1 ), extremely high SSC materials (H-SSC T ) genotype is T, extremely low SSC material (L-SSC c) genotype is G. Based on the transcriptome data of mature fruits of tomato population materials, the expression of 10 genes in the gene cluster was analyzed. It was found that the expression of SC8 gene was the highest in the two genotype materials, and the difference was significant. Based on the variation information of the significant locus SL2.50 ch05_745307 associated with sucrose GWAS, the tomato core population materials were divided into two categories: G genotype and C genotype. The extreme high sucrose content material (H-Sucrose G ) genotype is G, extreme low sucrose material (L-Sucrose C ) as C, the expression levels of the 10 genes in the gene cluster were analyzed, and it was found that only SC3 and SC8 genes had significant expression differences between the two genotype materials, among which SC8 gene had the highest expression level and the most significant expression difference. Therefore, the SC8 gene was determined to be the major effect gene, playing a negative regulatory role in the SSC and sucrose accumulation process of tomato red ripe fruit. Figure 4 Figure A shows the relative expression levels of gene cluster SCs at the ch05_801303 locus in red-ripe fruits of tomato materials with different genotypes, and Figure B shows the relative expression levels of gene cluster SCs at the ch05_745307 locus in red-ripe fruits of tomato materials with different genotypes.
[0068] 4. Functional analysis of the major gene SC8 for SSC accumulation in tomato fruit
[0069] 4.1. The major gene SC8 is located in the tomato tonoplast
[0070] In order to determine the specific site of action of the SCs transport protein of this gene cluster, a subcellular localization experiment was performed. The steps were as follows: RNA was extracted from Ailsa Craig (AC) tomato by trizol method, and cDNA was obtained by reverse transcription. The coding region (CDS) of the SC8 gene was amplified from the AC tomato cDNA using primers SC8-GFP-Fw / Rv. The coding region of the SC8 gene was cloned into the GFP vector by homologous recombination using the II one-step cloning kit (C112-02, Vazyme, China) to construct the CaMV35S:SC8-GFP vector, which was then transformed into the Agrobacterium tumefaciens strain GV3101 along with the nuclear marker vector CaMV35S:ERF-mCherry. The bacterial suspensions were mixed and injected into tobacco leaves. After growing at 25°C for 48 hours, the GFP and mCherry fluorescence signals of the tobacco leaves were observed using Leica laser confocal software. The CaMV35S:GFP vector served as a positive control. The above process can be referred to the reference [6] "Song J, Shang L, Chen S, Lu Y, Zhang Y, Ouyang B, Ye Z, Zhang J: Interactions between ShPP2-1, an F-box family gene, and ACR11A regulate cold tolerance of tomato. Hortic Res 2021, 8(1): 148."
[0071] Subcellular localization results are shown in Figure 5 (Bar = 10 μm). Red fluorescence indicates the tonoplast marker, red fluorescent protein H-mCherry (VM-GFP), green fluorescence indicates SC8-GFP protein, and yellow fluorescence (Merged) indicates the superposition of SC8-GFP and H-mCherry proteins. Bright is a bright-field image of tobacco protoplasts. As can be seen, the SC8 gene is localized to the tonoplast.
[0072] 4.2. The major gene SC8 has a nitrate ion transport function
[0073] Using the JGI genome database information, a phylogenetic tree was constructed by BLAST analysis of highly homologous genes in tomato, rice, potato and Arabidopsis. The SC8 gene belonged to the nitrate transporter 1 (NRT1) family.
[0074] In order to explore the transport substrate and transport direction of the SC8 gene, the transport function was verified by using the African clawed frog oocyte transport experiment. The steps are as follows: the SC8 gene was amplified from the cDNA of AC tomato using the primer SC8-pT7Ts-Fw / Rv, and the SC8 gene was cloned into the clawed frog oocyte expression vector pT7TS using homologous recombination. The vector restriction sites are BglII and SpeI. The constructed vector was linearized with BamHI endonuclease and then synthesized using the mRNA synthesis kit (mMESSAGEmMA mRNA was synthesized using T7 Kit, Ambion., catalog number AM1344. A calibrated glass needle was used for injection, with 1 μL of mRNA injected into each oocyte. Approximately 22-25 oocytes were injected with each vector. The injected oocytes were incubated in MBS solution (formula: 88 mM NaCl, 1 mM KCl, 2.4 mM NaHCO3, 0.71 mM CaCl2, 0.82 mM MgSO4, 15 mM HEPES, 10 g / mL penicillin sodium and 10 g / mL streptomycin sulfate, pH 7.4) for 2 days. Experimental method reference [7] “Feng H, Xia X, Fan X, Xu G, Miller A J. Optimizing plant transporter expression in Xenopusoocytes. Plant Methods, 2013, 9(1): 48”. Before the assay, Xenopus oocytes transformed with the pT7TS vector were placed in the following treatment solutions and incubated at 18°C for 30 minutes. The treatment solutions included: 1) Treatment solution 1: 0.25mM KNO3 + 0.5HEPES, pH 7.4; 2) Treatment solution 2: 0.25mM KNO3 + 0.5MES, pH 5.5; 3) Treatment solution 3: 10mM KNO3 + 0.5HEPES, pH 7.4; 4) Treatment solution 4: 10mM KNO3 + 0.5MES, pH 5.5. After treatment, the non-invasive micro-test technology (NMT) was used to detect the NO3 - Transport rate and direction, experimental equipment: Younger USA LLC, Amherst, MA01002, USA; testing unit: Xuyue (Beijing) Sci.&Tech. Co., Ltd., Beijing, China.
[0075] Figure 6 The NO3 of SC8 gene under different nitrate concentrations and pH values is shown - Transport activity, from left to right, 0.25mM and 10mM NO3 - The negative value in the Y axis indicates the transport direction of NO3 - Transported from the inside to the outside of the vacuole membrane, positive values on the Y axis represent NO3 - Transport from the outside to the inside of the tonoplast. It can be seen that at a low concentration of 0.25 mM nitrate ions in an acidic environment of pH 5.5, SC8 exhibits efflux activity. At a high concentration of 10 mM nitrate ions in an acidic environment of pH 5.5, SC8 exhibits systemic activity.
[0076] The above results confirm that SC8 protein belongs to H + The family of channel proteins that depends on SSC plays a transport function on the tomato vacuole membrane. They can specifically recognize and transport nitrate ions. Moreover, according to the changes in the concentration of nitrate ions in the external environment, the affinity and transport direction of nitrate ions are also different, thereby affecting the accumulation of sugars in the vacuole and causing SSC changes.
[0077] 5. SC8 gene negatively regulates the accumulation of soluble solids in tomatoes
[0078] 5.1. Construction of gene editing vector
[0079] In order to explore the effect of SC8 gene on the soluble solids (SSC) content of tomato fruit, the tomato low SSC material TS-9 (AC) was selected as the background material, and the SC8 gene was overexpressed or knocked out.
[0080] 1) Construction of the SC8 gene overexpression vector: Using reverse-transcribed cDNA from the tomato genome as a template, the SC8 gene was amplified using primers SC8-OE-Fw / Rv. After gel extraction, the fragment was ligated into the pHellstage8 vector digested with Xho I and Xba I via homologous recombination. The ligation product was then transformed into competent E. coli cells using the heat shock method, and positive single colonies were selected using solid medium containing spectinomycin. Positive bacterial cultures were selected and sent to the company for sequencing. E. coli cultures that had been sequenced correctly were stored at -80°C.
[0081] 2) Construction of SC8 gene knockout vector: The conserved domains of the SC8 gene were analyzed, and the common conserved region sequences were selected for CRISPR target design using the targetDesign website (http: / / skl.scau.edu.cn / targetdesign / ). The target sequences were target1: TCCAGATAATGAGAGAGTTATGG, target2: CTTGCCAACCAAACTGCACTTGG. The primers SC8-CR-Fw / Rv were designed based on the homologous recombination arms. Using the pTX043 plasmid as a template, a DNA fragment containing the sgRNA was amplified. After gel recovery, the fragment was ligated to the pTX041 vector opened with BsaI enzyme via homologous recombination reaction. The ligation product was then transformed into E. coli competent cells by heat shock, and positive single clones were selected using solid culture medium containing kanamycin. Single clones were selected and sent to the company for sequencing, and the E. coli culture solution with correct sequencing was stored at -80°C.
[0082] 5.2 Tomato Genetic Transformation
[0083] The above-mentioned correctly sequenced E. coli culture was shaken to extract the SC8 gene overexpression vector and knockout vector, and the above-mentioned vectors were transformed into AC tomatoes respectively using the Agrobacterium-mediated method. The tomato transformation method was based on the literature published by our laboratory [8] "Ouyang Bo. Research on transformation of several pathogenesis-related protein genes into tomatoes [D]. Huazhong Agricultural University, 2003", and the genetic transformation recipient material was TS-9 (AC). The gene expression of the overexpressing T0 generation plants was identified and harvested individually, and the T1 generation plants were mixed and the gene expression verification and phenotypic identification were performed on the T2 generation plants. The gene knockout material T0 generation plants were harvested individually, and the T1 generation plants were separated and sequenced and tested for Cas9 vector primers. The homozygous edited T2 generation lines without the vector were harvested individually for gene function identification.
[0084] The red ripe fruits of two overexpression lines and two homozygous knockout lines of tomatoes 45 days after flowering were selected, and the relative expression of the SC8 gene was detected by real-time fluorescence quantitative PCR (qRT-PCR). The steps are as follows: total RNA was extracted, and reverse transcription cDNA was synthesized using the HiScript II first-strand cDNA synthesis kit (Vazyme, R212-02, China). The SC8 gene was amplified using SC8-qPCR-Fw / Rv primers, and the transcription level of the gene was identified on a SYBR Light Cycler 480 instrument. The tomato Actin gene (Solyc11g005330) was used as the internal reference control, and its amplification primer was Q-actin-Fw / Rv, and the sequence is shown in SEQ ID NO.15-16. 2 -ΔΔCT Quantitative relative gene expression levels.
[0085] Related results can be found in Figure 7 Figure A shows the expression levels of the SC8 gene in a tomato line overexpressing the SC8 gene, while Figure B shows the editing methods used in a tomato line knocking out the SC8 gene. Calculations revealed that SC8 gene expression in the overexpression lines OE-4 and OE-5 was upregulated approximately 32-fold and 18-fold, respectively, compared to the wild-type TS-9 line. In both knockout lines, CR-5 produced a 14-bp deletion, while CR-9 produced a 1-bp deletion. These editing methods resulted in frameshift mutations in the SC8 gene, leading to loss of function.
[0086] 5.3 Analysis of SSC Content in Red-Ripe Fruits of SC8 Gene Overexpression and Knockout Lines
[0087] Tomato red ripe fruits from two overexpression lines and two homozygous knockout lines 45 days after anthesis were selected for phenotypic identification. The soluble solids (SSC) content was determined, and the fruit weight, fruit transverse diameter, fruit longitudinal diameter, fruit shape index and fruit setting rate were calculated. TS-9 was used as the control material (CK). The soluble solid content of ripe tomato red fruits was determined using a portable sugar meter (PAL-BX|ACID 3, ATAGO CO., LTD., Japan); the sugar and acid metabolite content was determined using gas chromatography-mass spectrometry. The sample preparation and determination methods were based on the reference [9] "Xu Rangwei, Cheng Yunjiang. (2018). Determination of sugar and acid content in citrus fruits. Bio-101: e1010211." Specifically, ripe tomato red fruits were ground with liquid nitrogen, further extracted with 80% methanol (purchased from Sigma Aldrich, CAS#A452-4), vacuum concentrated, and derivatized with hydroxylamine hydrochloride (purchased from Sigma Aldrich, CAS#55460), hexamethyldisilane (HMDS, purchased from Sigma Aldrich, CAS#52619), and trimethylchlorosilane (TMCS, purchased from Sigma Aldrich, CAS#92361). The derivatized supernatant was added to an autosampler vial and analyzed by GC-FID using an Agilent Technologies 7890B GC System (Agilent Technologies, USA).
[0088] See the results Figure 8 Figures AF show the SSC, sucrose, fructose, glucose, malic acid, and citric acid contents, respectively; Figures GK show the statistical results of fruit weight, fruit horizontal diameter, fruit vertical diameter, fruit shape index, and fruit set rate, respectively; and Figure L shows the actual fruit and stalk. SSC measurements of red-ripe fruit from SC8 overexpression and knockout lines using TS-9 as the background material showed that overexpression of the SC8 gene significantly decreased fruit SSC, while knockout of the SC8 gene led to a significant increase in fruit SSC. To further explore the changes in specific sugar and acid components in SSC, metabolite content was determined using GC-MS, revealing that loss of SC8 gene function resulted in increased sucrose, fructose, glucose, malic acid, and citric acid contents in red-ripe fruit. This suggests that the SC8 gene has the function of influencing SSC and sugar and acid accumulation in tomato fruit and has a negative regulatory effect. In addition, during the growth of transformed plants, it was observed that overexpression and functional loss of the SC8 gene did not affect the growth and appearance phenotype of tomato fruit. The fruit weight, fruit transverse diameter, fruit longitudinal diameter and fruit shape index did not change significantly compared with the control group, but the fruit set rate of the SC8 gene knockout plants was significantly higher than that of the control line and the overexpression line.
[0089] 6. Analysis of SC8 transcriptional regulation
[0090] To investigate the alterations in gene transcription in fruit parts caused by changes in the SC8 gene, transcriptome (RNA-Seq) analysis was performed on SC8 (TS-9) overexpression lines, knockout lines, and control (AC) materials. Mature tomato fruits, 45 days after anthesis, were ground into powder using liquid nitrogen and sent to the BGI Research Institute for RNA extraction and library construction. After sequencing, raw sequence data were obtained. The obtained reads were quality-controlled using bioinformatics analysis, and clean reads were screened for alignment to the tomato reference genome sequence, version SL2.50. The reads were assembled into transcripts, and differentially expressed genes (DEGs) were identified using edgeR, with parameters set to log2FC ≥ 1.0 and FDR < 0.01. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses were performed on the differentially expressed genes. Real-time quantitative PCR was then used to verify the transcriptional levels of the associated genes.
[0091] Comparison of transcriptome data of SC8 gene overexpression line, knockout line and wild-type AC red-ripe fruit showed that a total of 1601 DEGs were screened out in the overexpression line compared with the control line, including 1020 upregulated genes and 581 downregulated genes; a total of 1553 DEGs were screened out in the knockout line compared with the control line, including 896 upregulated genes and 657 downregulated genes.
[0092] GO enrichment analysis showed (see Figure 9 Figure A shows the GO enrichment analysis of the SC8 gene overexpression line and the control line, and Figure B shows the GO enrichment analysis of the SC8 gene knockout line and the control line. DEGs at the biological process (BP) level were largely concentrated in membrane transport pathways for sugars, acids, carbohydrates, and water. At the cellular composition (CC) level, DEGs were mainly enriched in plastids, chloroplasts, thylakoid membranes, and secondary metabolite pathways. Plastids are organelles responsible for fundamental aspects of plant development, including carbon fixation and the synthesis of several secondary metabolites. At the molecular function level (MF), DEGs were concentrated in nitrogen starvation, amino acids, organic acids, and ion transport pathways.
[0093] 7. Identification of SC8-interacting proteins
[0094] To explore the tonoplast sugar transporters that interact with SC8, we used the publicly available Tomato eFP Browser (http: / / bar.utoronto.ca / efp_tomato / cgi-bin / efpWeb.cgi) website to analyze the expression patterns of tonoplast sugar transporters. Figure 10Figure A in the middle shows the heat map of gene expression (FPKM value). It was found that TMT2, VGT2 and SUT4 transporters have the same expression pattern as SC8. The relative transcription levels of tonoplast-localized sugar transporter genes in the RNA-seq results of the SC8 knockout line were further analyzed. The results are shown in Figure 10 Figure B shows that the expression levels of TMT3, SUT4, and SWEET16 genes in the SC8 knockout line were upregulated compared with the control group, while the expression levels of TMT1, TST2, VGT1, and VGT2 genes were downregulated.
[0095] Yeast two-hybrid assays and luciferase complementation assays were performed with SC8 to verify the interaction with the vacuolar sugar transporter. The membrane system yeast dot-to-dot assay included: yeast strain NMY51 was streaked and cultured on 2×YPDA solid medium at 30°C. Single colonies were picked and transferred to 2×YPDA liquid medium and continued to be cultured overnight. 2 mL of bacterial solution was aspirated into each tube and centrifuged at 12,000 rpm for 1 minute. The supernatant was discarded and the following reagents were added according to the following system: 50% PEG3350 240 μL, 1M LiAC 34 μL, 2 mg / mL SS carrier DNA was added to 50 μL, and 1.5 μg of AD and BD plasmids were added according to the following combinations: A. pPR3-N + pTSU2-APP, B. pNubG-Fe65 + pTSU2-APP, C. pPR3-N + SC8-pBT3-N, where A and C were negative controls, B was a positive control, and the other combinations were experimental groups; the plasmids in the experimental groups were: TMT1-pPR3-N, TMT2-pPR3-N, TMT3-pPR3-N, SUT4-pPR3-N, VGT1-pPR3-N, VGT2 For SC8-pBT3-N, SWEET16-pPR3-N, and SC8-pBT3-N, the corresponding target sequences were amplified using primer pairs TMT1-pPR3-Fw / Rv, TMT2-pPR3-Fw / Rv, TMT3-pPR3-Fw / Rv, SUT4-pPR3-Fw / Rv, VGT1-pPR3-Fw / Rv, VGT2-pPR3-Fw / Rv, SWEET16-pPR3-Fw / Rv, and SC8-pBT3-Fw / Rv, and the pPR3-N plasmid was ligated. Each tube was mixed thoroughly, incubated at 42°C for 1.5 hours, and then centrifuged at 12,000 rpm for 1 minute, and the supernatant discarded. The cells were rinsed twice with ddH2O and resuspended in 400 μL of ddH2O. 100 μL of each tube was plated on solid medium SD / -Trp-Leu for 3 days. Pick a single colony and resuspend it in ddH2O to obtain the OD 600 =0.1, and 3 μL was respectively aspirated and cultured on SD / -Trp-Leu and SD / -Trp-Leu-His-Ade solid culture media to observe the growth.
[0096] The LCI dual-luciferase complementation experiment included: using AC tomato cDNA as a template, the full-length CDS sequence of the SC8 gene (excluding the stop codon) was amplified by primers SC8-LUC-N-Fw / Rv and ligated into the JW771-nLUC vector; the full-length CDS sequences of TMT1, TMT2, TMT3, VGT1, VGT2, SUT4, and SWEET16 (including the stop codon) were amplified by primers TMT1-LUC-C-Fw / Rv, TMT2-LUC-C-Fw / Rv, TMT3-LUC-C-Fw / Rv, VGT1-LUC-C-Fw / Rv, VGT2-LUC-C-Fw / Rv, SUT4-LUC-C-Fw / Rv, and SWEET16-LUC-C-Fw / Rv and ligated into the JW772-cLUC vector (sequences as shown in SEQ ID NO: 5). IDNO.21-36), and transformed into Agrobacterium GV3101. The Agrobacterium bacterial solution of the two vectors was mixed at a concentration of 1:1 (total concentration OD 600 = 1.0) were mixed and injected into tobacco leaves. Fluorescence imaging was performed using a laser confocal microscope 2-3 days later. Three negative controls were set up: nLUC empty vector and cLUC empty vector, nLUC empty vector and cLUC linked to the target gene, and nLUC linked to the target gene and cLUC empty vector. In the dark, LUC substrate was evenly applied to the back of the injected leaves, and fluorescence images were observed using a plant live imaging system.
[0097] The results of the interaction between SC8 and vacuolar sugar transporters are shown in Figure 11 Figure A shows a membrane yeast point-to-point verification of the interaction between SC8 and tonoplast-localized sugar transporters, while Figure B shows an LCI dual-luciferase complementation assay verifying the interaction between SC8 and tonoplast-localized sugar transporters. The results showed that when genes such as SlTMT1, SlSUT4, and SlVGT1 were co-transfected with SC8, yeast activity improved on SD / -Trp-Leu-Ade-His-3-AT medium (SD / -TLAH-3-AT, 3-AT is a competitive inhibitor of the yeast HIS3 protein (histidine), which suppresses background expression or inhibits autoactivation, thereby reducing background). In the luciferase complementation assay, a relatively strong fluorescence signal was observed when the SC8 gene linked to the nLUC vector was co-transfected with genes such as SlTMT1, SlSUT4, and SlVGT1 linked to the cLUC vector. These two experimental results indicate that the SC8 protein in tomato can interact with transporters such as TMT1, SUT4, and VGT1.
[0098] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.
Claims
1. Application of the SC8 gene in regulating the accumulation of soluble solids in tomato fruit, characterized in that: The cDNA sequence of the SC8 gene is shown as SEQ ID NO.1, or the gDNA sequence of the SC8 gene is shown as SEQ ID NO.
2.
2. The use of the SC8 gene according to claim 1 in regulating the accumulation of soluble solids in tomato fruit, characterized in that: The regulation includes positive regulation or negative regulation; wherein, negative regulation of tomato soluble solids accumulation is achieved by enhancing the expression of SC8 gene; positive regulation of tomato soluble solids accumulation is achieved by inhibiting the expression of SC8 gene.
3. The use of the SC8 gene according to claim 2 in regulating the accumulation of soluble solids in tomato fruit, characterized in that: Positive regulation of soluble solids accumulation in tomato includes the following steps: An SC8 gene knockout vector was constructed and used to transform wild-type tomatoes, and transgenic tomato plants with reduced SC8 gene expression were obtained.
4. The use of the SC8 gene according to claim 3 in regulating the accumulation of soluble solids in tomato fruit, characterized in that: Construction of the SC8 gene knockout vector includes the following steps: designing a target site using tomato SC8 gene gDNA, performing PCR amplification using SC8-CR-Fw and SC8-CR-Rv primer pairs to obtain an sgRNA sequence targeting the SC8 gene, and ligating the sgRNA sequence to a pTX041 vector cut with BsaI enzyme through homologous recombination technology to construct the SC8 gene knockout vector; wherein the nucleotide sequences of SC8-CR-Fw and SC8-CR-Rv are shown in SEQ ID NOs. 11-12, respectively.
5. The use of the SC8 gene in regulating the accumulation of soluble solids in tomato fruit according to claim 4, characterized in that: Negative regulation of tomato SSC accumulation involves the following steps: An SC8 gene overexpression vector was constructed and used to transform wild-type tomatoes, and transgenic tomato plants with increased SC8 gene expression were obtained through cultivation.
6. Use of the SC8 gene according to claim 5 in regulating the accumulation of soluble solids in tomato fruit, characterized in that: The construction of the SC8 gene overexpression vector includes the following steps: Using tomato genomic cDNA as a template, PCR amplification was performed using the SC8-OE-Fw and SC8-OE-Rv primer pairs to obtain the cDNA sequence of the SC8 gene. The cDNA sequence was then ligated into a pHellstage8 vector double-digested with XhoI and XbaI by homologous recombination technology to construct the SC8 gene overexpression vector. The nucleotide sequences of SC8-OE-Fw and SC8-OE-Rv are shown in SEQ ID NOs. 9-10, respectively.
7. Use of the SC8 gene according to any one of claims 3 to 6 in regulating the accumulation of soluble solids in tomato fruit, characterized in that: The wild-type tomato is Ailsa Craig tomato.
8. The use of the SC8 gene according to claim 1 in regulating the accumulation of soluble solids in tomato fruit, characterized in that: The soluble solids include soluble sugars and / or soluble acids. The soluble sugars include sucrose, fructose and / or glucose. The soluble acids include malic acid and / or citric acid.
9. A breeding method for increasing the accumulation of soluble solids in tomatoes, characterized in that: The following steps are involved: By inhibiting the expression of the SC8 gene through genetic engineering means, a transgenic tomato plant with increased soluble solids accumulation is obtained; the cDNA sequence of the SC8 gene is shown in SEQ ID NO.1, or the gDNA sequence of the SC8 gene is shown in SEQ ID NO.
2.
10. The breeding method for increasing the soluble solids accumulation in tomatoes according to claim 9, characterized in that: Inhibiting the expression of the SC8 gene comprises the following steps: An SC8 gene knockout vector was constructed and used to transform wild-type tomatoes, and transgenic tomato plants with reduced SC8 gene expression were obtained.
Citation Information
Cited By
KASP molecular markers and their use in tomato fruit soluble solids content
CN122521906A