Linked molecular marker of wheat semi-dwarf and dense panicle character and application of linked molecular marker
By developing InDel molecular markers on wheat 3B chromosomes, the problem of difficulty in quickly identifying agronomic traits in the prior art is solved, and the effect of rapid identification and improvement of wheat plant types and improving yield is achieved.
Patent Information
- Application Number
- CN202510573665.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-06
- Publication Date
- 2025-08-12
AI Technical Summary
In the prior art, the frequent use of semi-dwarf genes may limit the genetic diversity of wheat, and there is little research on the morphological traits of ears, making it difficult to quickly identify agronomic traits of wheat such as plant height, ear length, ear density, etc., which affects the breeding effect.
An InDel molecular marker was developed, located on the chromosome of wheat 3B. The marker was detected by PCR primer amplification, and combined with DNA sequencing, restriction enzyme fragment length polymorphism and other methods to identify or assist in the identification of wheat agronomic traits, especially plant height, ear length, ear density, thousand-grain weight and grain length.
The rapid and accurate identification of wheat agronomic traits is achieved, and new breeding pathways are provided, which can reduce plant height, increase ear density, increase wheat yield, and broaden the genetic basis.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to a linkage molecular marker for a wheat semi-dwarf and dense-ear trait and an application thereof. Background Art
[0002] In wheat, the genes of the "Green Revolution" primarily refer to the Rht-B1b and Rht-D1b loci derived from the Japanese variety 'Norin 10' (Peng et al. 1999). Rht-B1b and Rht-D1b are orthologous genes, both encoding N-terminally truncated DELLA proteins. The N-terminus of intact DELLAs contains the DELLA and TVHYNP motifs, which are essential for GA signaling. In the presence of GA, GIBBERELLIN INSENSITIVE DWARF1 (GID1) binds to the N-terminus of DELLAs and degrades them. The truncated DELLAs encoded by Rht-B1b and Rht-D1b are more stable and accumulate in high concentrations, weakening GA signaling and inhibiting plant growth (Dill et al. 2001; Richards et al. 2001; Van De Velde et al. 2021). At least 15 Rht-B1 alleles have been identified. Among them, Rht-B1c (Rht3) causes significant dwarfing of wheat plants, Rht-B1b, Rht-B1e (Rht11), Rht-B1f, Rht-B1h, and Rht-B1p (Rht17) cause semi-dwarfism, and wheat carrying Rht-B1g or Rht-B1i-1 exhibits excessive growth (Li et al. 2013; Thomas 2017; Kroupin et al. 2020). However, Rht-B1b and Rht-D1b also have certain negative effects, such as reduced coleoptile length, reduced seedling vigor and population density, and reduced nitrogen use efficiency, ultimately leading to a significant reduction in grain weight and number of grains per spike (Ellis et al. 2004; Li et al. 2018; Liu et al. 2022).
[0003] To date, more than 27 loci have been classified as Rht genes (Zhong et al. 2018; Liu et al. 2022; Song et al. 2023; Liu et al. 2024; Li et al. 2024), but only a few have been identified through map-based cloning. For example, Rht8 is a GA-insensitive gene encoding an unknown 808-amino acid protein with a predicted RNase H-like domain (Chai et al. 2022; Xiong et al. 2022). Recent studies have identified GA2oxA9, encoding the GA-inactivating enzyme GA 2-oxidase, as a candidate gene for Rht18, Rht24, and Rht14 (Ford et al. 2018; Tian et al. 2022). GA2oxA9 converts the GA1 precursor GA12 into an inactive product, reducing the bioactive concentration of GA1 and thus inducing a semi-dwarf phenotype. Furthermore, GA2oxA13 was identified as a candidate gene for Rht12, with functions similar to those of Rht18 / GA2oxA9 (Bian et al. 2023). Rht23 is a GA-sensitive dwarfing locus first discovered in the mutant NAUH164 of the ethylmethanesulfonate (EMS)-induced wheat variety 'Sumai 3'. Rht23 is allelic to 5Dq, the D genome homolog of the domestication gene 5AQ (Zhao et al. 2018). Unlike other dwarfing genes regulated by GA metabolism or signaling, Rht23 has a more complex effect on genomic transcription, involving the expression of genes involved in cell wall biosynthesis, lignin synthesis, and photosynthesis. Furthermore, Rht13 encodes a nucleotide binding site / leucine-rich repeat (NB-LRR) gene. Point mutations in its semi-dwarf allele, Rht-B13b, autoactivate the NB-LRR gene, resulting in significant dwarfing. Rht13 is a novel dwarfing gene that does not regulate GA signaling or metabolic pathways. Rht25 is a GA-sensitive gene that encodes a plant-specific AT-rich zinc-binding protein (PLATZ) protein, expressed in elongating stems and young spikelets (Zhang et al. 2023). Further experiments have demonstrated that Rht25 interacts with Rht1 to regulate plant height morphogenesis. Studies have reported that GSK3 regulates plant height development in wheat by phosphorylating the Rht-B1b protein (Dong et al. 2023). Furthermore, studies have reported that TaERF-A1, an AP2 / ERF transcription factor encoding TaERF, has been identified on the upper arm of chromosome 5A, regulating plant height and spike length in wheat. The allele from Jingdong 6 effectively reduces plant height and improves lodging resistance (Li et al. 2024).Mutations in TaACT7 interfere with the signaling response of hormones such as BR and GA by affecting actin polymerization, leading to cell deformities, reduced plant height, and rounded grains in wheat (Li et al. 2023; Xie et al. 2023). It is important to note that the frequent use of these single dwarfing genes may limit wheat genetic diversity. Therefore, in breeding practice, the discovery of new dwarfing genes to broaden the genetic basis of dwarf and semi-dwarf traits is of great significance.
[0004] Spike morphology is an important component of wheat plants and includes traits such as spike compactness (SC), spike length (SL), and spikelet number. Several Rht loci (e.g., Rht4, Rht5, Rht8, and Rht25) exhibit pleiotropic effects on SC and SL (Mo et al. 2018; Li et al. 2021; Chai et al. 2022; Xiong et al. 2022). Furthermore, Q, Compactum (C), and Sphaerococcum (S1) are three well-known domestication genes associated with wheat spike morphology (Faris et al. 2003; Fan et al. 2019). The Q gene, located on chromosome 5A, is a member of the AP2 class of transcription factors that regulates spike length, plant height, and rachis brittleness (Faris et al. 2003; Jiang et al. 2019). The C gene, located on chromosome 2D, influences spike compactness (SC), spike length (SL), kernel size, shape, and number. This gene originates from the dense-spike wheat (Triticum aestivum ssp. compactum) (Faris et al. 2014). The S1 gene, officially designated Tasg-D1, is located on chromosome 3D and has been successfully cloned. Tasg-D1 encodes the serine / threonine protein kinase glycogen synthase kinase 3, a key inhibitor of BR signaling and crucial for kernel shape and spike density (Liu et al. 2022). Furthermore, wheat's photoperiod gene (Ppd), vernalization gene (Vrn), and early maturity gene (Eps) also significantly influence spike morphogenesis (Li et al. 2021; You et al. 2021). These genes, acting together, provide a crucial genetic basis for spike morphological diversity and for wheat domestication and breeding.
[0005] Although there is relatively much research on wheat plant height and ear density, relatively few semi-dwarf and dense-ear genes have been applied in actual production. Therefore, discovering new genes that affect wheat plant height and ear shape and developing linked markers are of great application value in wheat marker-assisted selection breeding. Summary of the Invention
[0006] The technical problem to be solved by the present invention is how to quickly identify agronomic traits of wheat. To solve this problem, the present invention first provides the use of an InDel molecular marker, wherein the InDel molecular marker is a DNA fragment having a nucleotide sequence of positions 37 to 61 of SEQ ID NO: 4. The application can be the use of the InDel molecular marker in any of the following:
[0007] A1) Identify or assist in identifying agronomic traits of wheat,
[0008] A2) preparing products for identifying or assisting in identifying agronomic traits of wheat,
[0009] A3) Wheat breeding,
[0010] A4) Preparation of wheat breeding products.
[0011] The present invention also provides an application of a substance for detecting an InDel molecular marker, wherein the InDel molecular marker is a DNA fragment having a nucleotide sequence of positions 37 to 61 of SEQ ID NO: 4. The application can be application of the substance in any of the following:
[0012] B1) Identify or assist in identifying agronomic traits of wheat,
[0013] B2) preparing products for identifying or assisting in identifying agronomic traits of wheat,
[0014] B3) Wheat breeding,
[0015] B4) Preparation of wheat breeding products.
[0016] In the above application, the wheat breeding indicators may include wheat agronomic traits.
[0017] In the above application, the agronomic traits of wheat may be plant height, ear length, ear density, 1000-grain weight and grain length.
[0018] The plant height may be the distance between the root neck and the top of the plant, wherein the top refers to the top of the main stem.
[0019] The ear density is the number of spikelets in an ear divided by the ear length.
[0020] Furthermore, in the application, the purpose of wheat breeding may include cultivating wheat with changed agronomic traits; the changed agronomic traits may be reducing wheat plant height, total spikelet number, grain weight, grain length and increasing wheat spike density.
[0021] In the above application, the substance contains PCR primers for amplifying a wheat genomic DNA fragment containing the InDel molecular marker.
[0022] The PCR primers are a primer pair consisting of a forward primer and a reverse primer. The forward primer is a single-stranded DNA that specifically binds to the upstream double-stranded DNA fragment of position 37 of SEQ ID NO: 4 in the wheat genomic DNA, and the reverse primer is a single-stranded DNA that specifically binds to the downstream double-stranded DNA fragment of position 62 of SEQ ID NO: 4 in the wheat genomic DNA.
[0023] The forward primer may be a single-stranded DNA having a nucleotide sequence of SEQ ID NO: 1, and the reverse primer may be a single-stranded DNA having a nucleotide sequence of SEQ ID NO: 2.
[0024] In the above applications, the substance can be a substance capable of detecting the InDel molecular marker using at least one of the following methods: DNA sequencing, restriction fragment length polymorphism (RFLP), single-strand conformation polymorphism (SSP), denaturing high-performance liquid chromatography (DHPLC), and SNP chip. SNP chips include those based on nucleic acid hybridization reactions, single-base extension reactions, allele-specific primer extension reactions, one-step reactions, primer ligation reactions, restriction endonuclease reactions, protein-DNA binding reactions, and fluorescent DNA binding reactions.
[0025] In the above applications, the PCR primers may or may not be labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be attached to a nucleic acid. Markers include, but are not limited to, dyes; radioactive labels, such as 32P; binding moieties, such as biotin; haptens, such as digoxigenin (DIG); luminescent, phosphorescent or fluorescent moieties; and fluorescent dyes alone or in combination with moieties that can inhibit or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The marker can provide a signal that can be detected by fluorescence, radioactivity, colorimetry, weight determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moiety (positive or negative charge) or, alternatively, can be charge neutral. The marker can include a nucleic acid or protein sequence or a combination thereof, as long as the sequence comprising the marker is detectable. In some embodiments, the nucleic acid is directly detected (e.g., directly reading the sequence) without a marker.
[0026] The present invention also provides a method for identifying or assisting in identifying agronomic traits of wheat, comprising using the genomic DNA of the wheat to be identified as a template, performing PCR amplification with the above-mentioned PCR primers to obtain a PCR product, and identifying the agronomic traits of the wheat based on whether the PCR product contains the InDel molecular marker.
[0027] In the above method, the agronomic traits of wheat are identified based on whether the PCR product contains the InDel molecular marker. Specifically, the wheat plant height, total spikelet number, grain weight and / or grain length of the wheat to be identified containing the InDel molecular marker are lower than those of the wheat to be identified without the InDel molecular marker, and the wheat spike density of the wheat to be identified with the InDel molecular marker is higher than that of the wheat to be identified without the InDel molecular marker.
[0028] In the above method, the wheat may be a wheat inbred line or a pure line, or the wheat may be a hybrid offspring of Lankao 906 and the mutant sdd1, such as F2 and above offspring.
[0029] The present invention also provides a DNA molecule, which is the above-mentioned InDel molecular marker.
[0030] The present invention also provides a specific primer for identifying or assisting in identifying agronomic traits of wheat. The specific primer may be composed of a forward primer and a reverse primer. The forward primer is a single-stranded DNA that specifically binds to the upstream double-stranded DNA fragment of position 37 of SEQ ID NO: 4 in the wheat genomic DNA. The reverse primer is a single-stranded DNA that specifically binds to the downstream double-stranded DNA fragment of position 62 of SEQ ID NO: 4 in the wheat genomic DNA.
[0031] The forward primer may be a single-stranded DNA having a nucleotide sequence of SEQ ID NO: 1, and the reverse primer may be a single-stranded DNA having a nucleotide sequence of SEQ ID NO: 2.
[0032] The present invention also provides a kit for identifying or assisting in identifying agronomic traits of wheat, wherein the kit contains the above-mentioned PCR primers.
[0033] The present invention discovered and confirmed a new tightly linked molecular marker, JM5, located on chromosome 3B and developed based on InDel (insertion / deletion) mutations. This marker can accurately distinguish the Rsd1-3B genes. Map-based cloning of wheat revealed that the Rsd1-3B gene can reduce wheat plant height and increase wheat spike density. Improving wheat plant height and spike shape can effectively reduce wheat lodging and increase yield. The JM5 molecular marker of the present invention can be applied to improve wheat plant type, providing a new approach for breeding new high-yield wheat varieties. BRIEF DESCRIPTION OF THE DRAWINGS
[0034] Figure 1 Phenotypic differences and data statistics between wild-type Lankao 906 and mutant sdd1.
[0035] Figure 2This is a correlation analysis of plant height, spike length, total spikelet number and spike density in the F2 generation produced by hybridization of Lankao 906 and sdd1 followed by selfing.
[0036] Figure 3 This is the map-based cloning of the sdd1 gene.
[0037] Figure 4 This is the genotyping diagram of JM5.
[0038] Figure 5 This is the sensitivity analysis of sdd1 to BR.
[0039] Figure 6 Transcriptome analysis of sdd1.
[0040] Figure 7 Verify the accuracy of transcriptome data by RT-PCR. DETAILED DESCRIPTION
[0041] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.
[0042] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.
[0043] The data in the following examples were processed using SPSS 11.5 statistical software. The experimental results were expressed as mean ± standard deviation and were analyzed using Student's t test. P < 0.05 (*) indicated a significant difference, P < 0.01 (**) indicated a very significant difference, and P < 0.001 (***) indicated an extremely significant difference.
[0044] Example 1. Positioning and detection of linked molecular markers for the semi-dwarf and dense-ear trait in wheat
[0045] 1.1 Experimental materials and planting conditions
[0046] In the early stages of the experiment, a mutant was obtained from somatic cell culture in the genetic background of Lankao 906 and named sdd1. Sdd1 was crossed with wild-type Lankao 906 and another bread wheat variety, Jimai 325, to generate two F2 populations for phenotypic analysis and positional cloning of candidate genes.
[0047] Wheat materials were grown in the Shangzhuang experimental field at China Agricultural University in Beijing (40°14'N, 116°19'E) under normal water and fertilization conditions. Wheat plants and their progeny were planted with 20 seeds per row (row length 1.5 m, spacing 0.3 m).
[0048] 1.2 Phenotypic investigation
[0049] At maturity, wheat parent plants were measured for plant height, total spikelet number, and main spike length. Phenotyping of at least 30 plants per accession was performed. Phenotypic analysis of 1,000-grain weight, grain length, and grain width was performed using a Wanshen SC-G automated seed analyzer, with three replicates. For the localized population, plant height was categorized as A, with taller plants similar to Lankao 906 and normal spike density, and shorter plants similar to sdd1 and high spike density designated B.
[0050] The plant height is the distance between the root neck and the top of the plant, where the top refers to the top of the main stem.
[0051] The ear density is an important ear morphological characteristic related to wheat yield, and is calculated by dividing the number of spikelets in an ear by the ear length.
[0052] Through somatic cell culture, the laboratory previously isolated a semi-dwarf dense-eared mutant from the common wheat (Triticum aestivum) variety Lankao 906 and named it sdd1. The plant height of sdd1 is about 45 cm, which is 41.6% lower than that of wild-type Lankao 906 (see Figure 1 Figures A and B show the phenotypic data for plant height, spike length, and grain size of Lankao 906 and sdd1 at maturity, with scales of 10 cm, 2 cm, and 1 cm, respectively. Figure B shows the phenotypic data for plant height, spike length, total spikelet number, spike density, 1000-grain weight, grain length, and grain width of Lankao 906 and sdd1. The spike length of sdd1 was approximately 7.94 cm, a decrease of 44.0%, while the spike density was 3.28, an increase of 60.3%. Furthermore, the total spikelet number, grain weight, and grain length of sdd1 were significantly lower than those of the wild type, while grain width showed no significant difference. In the figures, LK 906 represents Lankao 906, and sdd1 represents sdd1.
[0053] For paraffin section observation, the middle part of the penultimate internode of Lankao 906 and sdd1 plants was collected and then fixed in formalin-acetic acid-alcohol solution (FAA; 50% (v / v) ethanol, 5% (v / v) glacial acetic acid and 4% (v / v) formaldehyde) at 4°C overnight. The samples were then dehydrated in a graded ethanol series and decolorized in a series of xylene solutions. Next, the glumes were embedded in paraffin. The tissue sections were cut into 9 μm thick sections, fixed on slides, and stained with 1% safranin and 0.5% fast green (G1031, https: / / www.servicebio.cn / ). The obtained sample images were analyzed under a microscope imaging system (DS-U3, Nikon, Japan). Cell length and cell width were counted using Image J software, with no less than 50 replicates for each material. The results are shown in Figure 1 Center C: Compared with the wild type, the stem cell length of sdd1 is significantly shortened, while the cell width is significantly increased. This suggests that sdd1 may affect the morphology of plant, panicle, and grain shape by regulating cell length rather than cell width.
[0054] To analyze the relationship between plant height and panicle-related phenotypes, the plant height, panicle length, total number of spikelets, and panicle density of the F2 generation produced by hybridization of Lankao 906 and sdd1 and then self-pollination were studied. Correlation analysis showed that plant height, panicle length, total number of spikelets, and panicle density were significantly correlated (see Figure 2 ), indicating that the mutant gene has pleiotropic effects in controlling plant architecture and panicle type. While reducing plant height, it also slows the growth of panicle length. Further findings revealed that the correlation between panicle length and panicle density was the highest, far higher than the correlation between total spikelet number and panicle density, indicating that changes in panicle length, rather than changes in total spikelets, were the primary cause of changes in panicle density. Distribution statistics revealed that plant height, panicle length, total spikelet number, and panicle density all exhibited bimodal distributions, indicating that these traits are controlled by a single major gene. Statistical tests for panicle length met a 3:1 segregation ratio. These results suggest that sdd1, caused by a single gene mutation, results in reduced panicle length, increased panicle density, and reduced plant height.
[0055] 1.3 Map-based cloning and positioning
[0056] To locate the candidate gene controlling semi-dwarf dense spike, we developed polymorphic InDel markers on wheat chromosomes and screened the genotypes of the F2 population obtained by crossing sdd1 with Jimai 325 and then selfing. We then used single marker analysis to identify the chromosome where the candidate gene was located. Figure 3 Middle B), map-based cloning of genes was performed.
[0057] Table 1 InDel markers and primer sequences used for positioning
[0058]
[0059] To locate the target gene, sdd1 was crossed with the cultivated variety Jimai 325 to generate an F2 segregating population. Resequencing data from sdd1 and Jimai 325 allowed the development of InDel molecular markers on 21 chromosomes. Single marker analysis showed that the molecular marker JM1 located on chromosome 3B was significantly correlated with traits such as ear length, plant height, and ear density (p-value 2.2E-16). Therefore, we initially located the target gene on chromosome 3B ( Figure 3 Further phenotypic and genotypic analysis revealed that sdd1 was located between markers JM5 and JM6 (see Figure 3 Middle C) corresponds to the physical interval of 414.7-420.4Mb of the Chinese spring reference genome, which contains 44 high-confidence annotated genes. Analysis of the young panicle transcriptome data of Lankao 906 and sdd1 found that 24 genes were expressed in this interval.
[0060] The amplified sequence length of JM5 was 207 bp (SEQ ID NO: 3), indicating that the allelic variation type was a deletion type (Del, Table 2 A): 5′–TTCCTCCATCCAATCCACATCGGCCCGAACCTGGGTGTGTCGCATCATGGCTTCTGCTCTTTCTGCA ACGTGATCTCCCCCTTGCTGAACCACAAAGGGGCCGATGGCCCCATAGGTGATCGTGTTCTCCCACAACATCTTTGGCAC GCCAGGTAGGGGGAATCGCTTGCGAGAACCTGAAGTTGTGAATAGCGCGTCAAGCTTCAT–3′; the amplified product sequence length was 232 bp (SEQ ID NO: 4), indicating that the allelic variation type was an insertion type (In, Table 2 B): 5′–TTCCTCCAT CCAATCCACATCGGCCCGAACCTGGGTAAAAATCACCAGTGTCACCGACGGTGTGTCGCATCATGGCTTCTGCTCTTTCT GCAACGTGATCTCCCCCTTGCTGAACCACAAAGGGGCCGATGGCCCCATAGGTGATCGTGTTCTCCCACAACATCTTTGGCACGCCCAGGTAGGGGGAATCGCTTGCGAGAACCTGAAGTTGTGAATAGCGCGTCAAGCTTCAT–3′. The difference between the insertion type and the deletion type is that the insertion type has an additional InDel molecular marker 3B-JM5-25 bp (positions 37 to 61 in SEQ ID NO: 4).
[0061] Table 2 Amplification results and agronomic traits of the F2 generation produced by hybridization of Lankao 906 and sdd1 followed by self-pollination
[0062]
[0063]
[0064]
[0065]
[0066] Data were processed using SPSS 19.0 statistical software, and the experimental results are expressed as mean ± standard deviation. The Student's t test was used to analyze the relationship between the two genotypes, the insertion type (B in Table 3) and the deletion type (A in Table 3), and wheat plant height, spike length, spikelet number, and spike density. P < 0.05 (*) indicates a significant difference, P < 0.01 (**) indicates a very significant difference, and P < 0.001 (***) indicates an extremely significant difference. The results are shown in Table 3, indicating that the plant height and spike length of the insertion type wheat were significantly lower than those of the deletion type wheat, and the spike density was significantly higher than that of the deletion type wheat.
[0067] Table 3 Analysis of variance of agronomic traits of different genotypes
[0068] Agronomic traits A B p-value Plant height 79.93±6.79 46.41±5.70 1.33E-70 Ear length 11.45±1.58 7.39±1.09 3.93E-42 number of spikelets 23.27±3.39 23.95±3.65 0.233094 ear density 2.03±0.07 3.24±0.27 3.08E-45
[0069] These results indicate that the sdd1 gene is located on wheat chromosome 3B, is closely linked to the molecular marker JM5, and affects wheat phenotypes such as plant height, ear length, ear density, grain weight, and grain length.
[0070] 1.4 Brassinosteroid (eBL) sensitivity analysis
[0071] Wild-type Lankao 906 and mutant sdd1 seedlings were cultured in an artificial climate chamber for approximately 14 days. The angle between the second and first leaves of the seedlings was removed and placed in a gradient of eBL solution (Beijing Coolabo Technology Co., Ltd., Cat. No. CE5051). The seedlings were incubated in the dark at room temperature for 2 days. Phenotypes were recorded, and the leaf angle was measured using Image J. Data from at least 20 samples were collected for each treatment.
[0072] Rsd1-3B is mediated by BR signaling.
[0073] Figure 5Figures A and B show the leaf angles of Lankao 906 and sdd1 treated with eBL. The scale bar is 1 cm. Under 10 μM eBL conditions, the leaf angle of wild-type Lankao 906 increased sharply and was significantly different from that of sdd1, indicating that Rsd1-3B is insensitive to eBL. Figure 5 The coleoptile length and phenotype statistics of Lankao 906 and sdd1 in C are shown in Figure 2. The scale bar is 2 cm. The coleoptile of sdd1 is significantly shorter than that of Lankao 906 at the seedling stage, which is consistent with the phenotype of BR deficiency. To observe whether the BR level of sdd1 has changed, we quantitatively detected BR synthesis and signal-related genes in the young panicles of Lankao 906 and sdd1 (such as Figure 5 (D, ns indicates no significant difference, * indicates P < 0.05, *** indicates P < 0.001). The results showed that compared with the wild type, the expression of TaBrd2, D11, and TaDLT was significantly upregulated in sdd1, while the expression of TaDwarf4, TaTUD1, and TaBZR1 was significantly downregulated. These results indicate that Rsd1-3B is a BR signaling-mediated regulator of wheat plant and ear morphology.
[0074] 1.5 Transcriptome analysis
[0075] At the jointing stage, 0.5-1 cm young ears of Lankao 906 and sdd1 were collected for RNA extraction and library construction (Poly-APurification TruSeq library reagent, Illumina). Sequencing was performed on the Illumina 2500 platform. After screening and trimming, clean reads were mapped to the wheat reference genome (IWGSC RefSeq v1.1) and DEG analysis was performed using DESeq2, whose criteria included |log2(fold-change)| ≥ 1 and p-value (false discovery rate) < 0.05. GO enrichment analysis was performed using the clusterProfiler R package (https: / / www.R-project.org / ). The credibility of the data was verified by real-time quantification. The data accuracy and primer sequences related to BR synthesis and metabolism genes are shown in Table 4.
[0076] Table 4 Marker and primer sequences used for real-time quantification
[0077] name Forward primer (5′-3′) Reverse primer (5′-3′) TaGALT31A AGAGGGGTGAAGTACCACGA TCCTTGGAGACGGCGTAGAT TaLTP-like GCGCTGAGCTCCATCTCG GTTGACTCGTCCGATGTTGC TaLTP10 GTCCAGACCCTCCATAACCAG TTGAGATTGTGGATGCGACC TaNAC59 TCCCGAAAACCCACTCATCTACT TGTTCACGTAGCCGTTGTTGTTAT TaSUT1 CCTGCTACTCAACTCGGTCG ATGGAGAGGCAGACGAGGAA TaLTP1 GTGCCCACCTCCTTCGTC CACGTTCACCAGGCCCAG TaCSLC9 CCCGAGGAAGGAAGGGAAGA CCCTGTTTCGTCAGCAGGC TaAGT3 TTCGGCAATGTGTTCAGGGT GACAGCGCAATGTCCATCAC TaUBQ8 GGCAGGACAATCTGCCTCAA CCATCAAAGACGAGGCGGTA TaBIM2 CAGAATCGAGTACATCCTGCC CACTGAGGCAGAAGCCTGAA TaULT2 GGACATGTGCAAATTTGACGGC CGCGCGAGCACCCCT TaOFP2 ATGGTTCTCCAAGCTCACGG CGGAGCTCTTGGCCTCAG TaD11 GCATACCCGTACGTGGAGTT GCTAAGCTAGTCATCGGTGCTT TaBrd2 GTGACGGAGCTGAACGAGA GCACCTCCTTCTCCGACTT TaD2 ATCTCATCCCCAAAGGATGG CAAAAGGGGTGAAGCTGCTA TaDwarf4 ACCAGGCGTTCGTGTACC TCCCCTAGACGCTAGACTGAG TaBRI1 ATCCAGGTTTTGCGGTCAT TGATTTCTACGGGCACTTCG TaBZR1 CCGCGTACAACCTCGTCA CGACCTCGTGGATCCTCTC TaTUD1 GCCAGGAGCATGATTGTCAG GGCGTTGGGTATCGTCCT TaRAVL1 AAAGGCCGACACCGTTTAG CGTTCACAGATCGAGATCCA TaDLT GTTCGAGGGCTCCGACAG AACATCCTCGCGATCATCC
[0078] To explore the transcriptional regulatory mechanisms underlying the semi-dwarf and dense panicle phenotypes of the sdd1 mutant, transcriptome analysis was performed on 0.5-1 cm panicles of wild-type and sdd1 at the jointing stage. The results showed that the biological replication between Lankao 906 and sdd1 was good (e.g. Figure 6Transcriptome analysis showed that 1461 genes were up-regulated and 408 genes were down-regulated in sdd1 relative to the wild type (Fig. Figure 6 Middle B). Figure 6 Middle C is the GO analysis of differentially expressed genes, the size of the circle indicates the number of enriched genes, and the color scale indicates the P value; up-regulated genes are mainly enriched in defense response, cell wall organization, response to oxidative stress, lipid transport, hydrogen peroxide decomposition and metabolism, xyloglucan metabolism, lignin biosynthesis, cell wall biosynthesis, response to mannose, thiamine biosynthesis, ethylene biosynthesis, arabinan decomposition and metabolism, pyrimidine nucleobase metabolism and nucleotide decomposition and metabolism, etc.; down-regulated genes are mainly enriched in the cell response to sulfur starvation and cysteine biosynthesis, etc. In order to explore the relationship between Rsd1-3B and BR, we used GSEA analysis, and the results showed that SDD1 affects the BR biosynthesis process homeostasis, BR signaling pathway and BR response of BR (such as Figure 6 Middle D).
[0079] Some genes were selected from the transcriptional regulatory factors to verify the data. The real-time quantitative results were the same as the transcriptome data, which further demonstrated the reliability of the data (e.g. Figure 7 ).
[0080] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes that depart from the disclosed scope in this application and are made using conventional techniques known in the art.
Claims
1. Application of InDel molecular markers, characterized in that: The InDel molecular marker is a DNA fragment having a nucleotide sequence of positions 37 to 61 of SEQ ID NO: 4, and the application is the application of the InDel molecular marker in any of the following: A1) Identify or assist in identifying agronomic traits of wheat, A2) preparing products for identifying or assisting in identifying agronomic traits of wheat, A3) Wheat breeding, A4) Preparation of wheat breeding products.
2. Application of a substance for detecting InDel molecules, characterized in that: The InDel molecular marker is a DNA fragment having a nucleotide sequence of positions 37 to 61 of SEQ ID NO: 4, and the application is the application of the substance in any of the following: B1) Identify or assist in identifying agronomic traits of wheat, B2) preparing products for identifying or assisting in identifying agronomic traits of wheat, B3) Wheat breeding, B4) Preparation of wheat breeding products.
3. The use according to claim 2, characterized in that The material contains PCR primers for amplifying a wheat genomic DNA fragment containing the InDel molecular marker.
4. The use according to claim 3, characterized in that The PCR primers are a primer pair consisting of a forward primer and a reverse primer. The forward primer is a single-stranded DNA that specifically binds to the upstream double-stranded DNA fragment of position 37 of SEQ ID NO: 4 in the wheat genomic DNA, and the reverse primer is a single-stranded DNA that specifically binds to the downstream double-stranded DNA fragment of position 62 of SEQ ID NO: 4 in the wheat genomic DNA.
5. The use according to claim 4, characterized in that The forward primer is a single-stranded DNA with a nucleotide sequence of SEQ ID NO: 1, and the reverse primer is a single-stranded DNA with a nucleotide sequence of SEQ ID NO:
2.
6. A method for identifying or assisting in the identification of agronomic traits of wheat, comprising: using genomic DNA of the wheat to be identified as a template, performing PCR amplification using the PCR primers described in claim 3, 4, or 5 to obtain a PCR product, and identifying the agronomic trait of the wheat based on whether the PCR product contains the InDel molecular marker described in claim 1.
7. A DNA molecule, characterized in that The DNA molecule is the InDel molecular marker described in claim 1.
8. A specific primer for identifying or assisting in identifying agronomic traits of wheat, characterized in that: The specific primer consists of a forward primer and a reverse primer. The forward primer is a single-stranded DNA that specifically binds to the upstream double-stranded DNA fragment of position 37 of SEQ ID NO: 4 in the wheat genomic DNA, and the reverse primer is a single-stranded DNA that specifically binds to the downstream double-stranded DNA fragment of position 62 of SEQ ID NO: 4 in the wheat genomic DNA.
9. The specific primer according to claim 8, characterized in that The forward primer is a single-stranded DNA with a nucleotide sequence of SEQ ID NO: 1, and the reverse primer is a single-stranded DNA with a nucleotide sequence of SEQ ID NO:
2.
10. A kit for identifying or assisting in identifying agronomic traits of wheat, characterized in that: The kit contains the PCR primers described in claim 3, 4 or 5.