SNP marker closely linked to tobacco resistance to phoma parastica var nicotiana ph gene and its application

By developing SNP markers SNP-2 and SNP-6, which are closely linked to the Ph gene for resistance to black shank in tobacco, the problems of low breeding efficiency and misjudgment in existing technologies have been solved, enabling low-cost, high-throughput genotyping and accurate breeding of disease-resistant varieties.

CN120464776BActive Publication Date: 2025-12-09HUBEI TOBACCO SCI RES INST
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510721620.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-30
Publication Date
2025-12-09
Estimated Expiration
2045-05-30

AI Technical Summary

Technical Problem

Existing molecular markers cannot meet the requirements of low cost, high throughput and automation for molecular breeding of tobacco resistant to black shank, and have problems such as misjudgment and small polymorphism range.

Method used

We developed SNP markers SNP-2 and SNP-6, which are closely linked to the Ph gene for resistance to black shank in tobacco, and provided corresponding primer sets to detect whether tobacco materials carry the Ph gene. We then bred new black shank resistant tobacco lines through backcrossing and self-crossing.

Benefits of technology

It enables low-cost, high-throughput, and automated genotype detection, improving breeding efficiency and ensuring the accuracy and wide applicability of disease-resistant varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120464776B_ABST
    Figure CN120464776B_ABST
Patent Text Reader

Abstract

The application provides SNP markers closely linked to a tobacco black shank resistance gene Ph The application discloses SNP markers closely linked to a tobacco black shank resistance gene and application thereof, and belongs to the technical field of tobacco breeding. Ph The two double-sided specific SNP markers closely linked to the gene can effectively promote the molecular breeding of tobacco with resistance to black shank disease. Ph The two double-sided specific SNP markers closely linked to the gene can effectively promote the molecular breeding of tobacco with resistance to black shank disease.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of tobacco breeding technology, specifically to a method for controlling tobacco resistance to black shank disease. Ph Tightly linked SNP markers and their application in assisting tobacco breeding for resistance to black shank. Background Technology

[0002] Tobacco black shank disease is caused by Phytophthora indicum (… Phytophthora parasitica var nicotianae Soil-borne fungal diseases caused by black shank are among the most devastating diseases affecting tobacco production. Since its discovery over a century ago, this disease has rapidly spread to major tobacco-producing countries worldwide, causing enormous economic losses annually. Black shank can occur throughout the entire tobacco growing season, but it primarily affects plants in the field, mainly at the base of the stem, but can also damage the pith and leaves, ultimately leading to the wilting and death of the entire plant.

[0003] The occurrence and spread of tobacco black shank are affected by a variety of factors. High temperature and humidity, poor drainage, and continuous cropping can all aggravate the damage caused by the disease. Therefore, in production practice, the damage can be reduced by taking reasonable crop rotation with non-host crops such as grass, promoting deep plowing and high ridging for transplanting, strengthening drainage and timely cleaning of diseased plants, as well as selecting appropriate fungicides, antagonistic bacteria and inducers. From the perspective of sustainable development, cultivating disease-resistant varieties is undoubtedly the most economical, effective and environmentally friendly measure to prevent and control black shank. The key is to find suitable resistance sources. After decades of collection, creation and experimentation, tobacco has accumulated a wealth of black shank resistance sources. These resistance sources mainly come from: (1) closely related species of tobacco, such as wild tobacco. N. plumbaginifolia and N. longiflora Vertical resistance genes Php and Phl and from N. rustica of Wz (2) Cultivated tobacco germplasm resources, such as the level resistance micro-effect polygenes derived from cigar tobacco Florida301 and Beinhart1000-1, namely quantitative trait loci (QTLs). In addition, a number of resistance sources have been identified from local tobacco germplasm resources. (3) Artificial mutagenesis mutants of cultivated tobacco, such as the red-flowered Dajinyuan mutant with high resistance to black shank disease obtained by Liu Xiaoxia et al. using radiation mutagenesis.

[0004] During the breeding process, researchers prefer to use vertical resistance genes with clear segregation between resistance and susceptibility. Black shank currently has four physiological races: 0, 1, 2, and 3. Races 0 and 1 are prevalent in most tobacco-producing countries, including my country, with race 0 being the dominant race. Therefore, races derived from wild tobacco... N. plumbaginifolia The physiological race 0 of black shank resistancePh Genes have received considerable attention. (Regarding carriers) Ph The tobacco variety Coker371-Gold, which contains genetically modified tobacco, serves as a source of resistance. A series of resistant varieties have been developed both domestically and internationally. Ph Gene-linked molecular markers were successfully applied to the targeted improvement of black shank resistance in the flue-cured tobacco varieties Honghua Dajinyuan and YNR3. However, currently developed molecular markers... Ph There are still many shortcomings of gene-linked molecular markers: (1) Among the markers developed by Bao et al. in 2019, most of them are repulsive markers (dominant markers with bands only in susceptible parents), which are difficult to use in backcross molecular breeding, or have a small range of polymorphisms and cannot be widely used in other varieties. Only BS-SCAR1 has a good actual effect, but this marker is not linked to the gene-linked molecular markers. Ph (1) Gene co-segregation, using only this marker may lead to misjudgment; (2) A series of co-dominant markers developed by Yunnan Provincial Tobacco Agricultural Science Research Institute from 2017 to 2020 are all SSR (simple sequence repeat) markers. However, SSR markers are gradually being replaced by the new generation of SNP (single nucleotide polymorphism) markers, which can no longer meet the needs of molecular breeding for low-cost, high-throughput and automated genotype detection. Summary of the Invention

[0005] In view of this, the present invention has developed a method similar to... Ph SNP markers with tighter gene linkage are intended to address the technical problem that existing molecular markers cannot adequately meet the requirements of molecular breeding for resistance to black shank.

[0006] In a first aspect, the present invention provides a method for treating black shank disease with tobacco. Ph Closely linked SNP marker combinations, including SNP-2 and SNP-6, specifically:

[0007] The nucleotide sequence of SNP-2 is shown in SEQ ID No. 1, and the polymorphic site is located at position 68 of the sequence shown in SEQ ID No. 1, with a polymorphism of T / C.

[0008] The nucleotide sequence of SNP-6 is shown in SEQ ID No. 2, and the polymorphic site is located at position 431 of the sequence shown in SEQ ID No. 2, with a polymorphism of T / A.

[0009] This invention, based on tobacco SSR markers and SNP variation analysis of 33 cultivated tobacco germplasm resources, systematically elucidates the role of carriers of tobacco black shank resistance. Ph Genes N. plumbaginifolia Molecular features of chromosome segments were integrated and mapped from existing data. Ph Genetic mapping based on gene molecular markers, and subsequently development of 6 related...Ph SNP markers closely linked to the gene; wherein SNP-2 and SNP-6 are located Ph on both sides of the gene, and SNP-2 and SNP-6 are at a genetic distance of Ph 0.49 cM from the gene, both reaching a close linkage degree.

[0010] In a second aspect, the present application provides a primer set for detecting the above-mentioned SNP markers. In some embodiments of the present application, the primer set comprises a primer pair with sequences as shown in SEQ ID No. 3-4 and a primer pair with sequences as shown in SEQ ID No. 5-6.

[0011] A detection product containing the above-mentioned primer set also belongs to the protection scope of the present application, and it can be understood that the detection product includes but is not limited to detection reagents, kits or gene chips, etc.

[0012] In a third aspect, the present application provides the above-mentioned SNP markers, primer set or detection product for use in any of the following:

[0013] 1) for use in tobacco breeding against Phytophthora parasitica;

[0014] 2) for use in detecting whether a tobacco material carries the Ph gene, specifically, if the genotype of SNP-2 carries T and the genotype of SNP-6 carries A, it can be judged that the tobacco material to be detected carries the Ph gene.

[0015] In a fourth aspect, the present application provides a method for breeding a Phytophthora parasitica-resistant tobacco strain, comprising the following steps:

[0016] S1, crossing a Phytophthora parasitica-resistant tobacco carrying the Ph gene with a Phytophthora parasitica-susceptible tobacco not carrying the Ph gene, and then backcrossing;

[0017] S2, selecting a single plant with SNP-2 genotype of C / T, SNP-6 genotype of T / A and phenotype similar to the Phytophthora parasitica-susceptible tobacco from the population obtained in step S1, crossing the single plant with the Phytophthora parasitica-susceptible tobacco, and continuing to select a single plant with SNP-2 genotype of C / T, SNP-6 genotype of T / A and phenotype similar to the Phytophthora parasitica-susceptible tobacco, repeating the above operation until a target single plant with SNP-2 genotype of C / T, SNP-6 genotype of T / A and phenotype similar to the Phytophthora parasitica-susceptible tobacco is obtained;

[0018] S3, selfing the above-mentioned target single plant, and identifying a single plant with SNP-2 genotype of T / T and SNP-6 genotype of A / A from the selfed single plant, which is a new Phytophthora parasitica-resistant tobacco strain.

[0019] Preferably, in the above method, the black shank resistant tobacco plant is Coker 371-Gold. Ph Preferably, in the above method, the black shank resistant tobacco plant is Coker 371-Gold.

[0020] Preferably, in the above method, the black shank resistant tobacco plant is Coker 371-Gold. Ph Preferably, in the above method, the black shank resistant tobacco plant is Coker 371-Gold.

[0021] In the present application, the SNP-2 and SNP-6 genotypes can be detected according to the prior art, and specifically, the DNA of the tobacco material to be detected is extracted as a template, and a primer pair as shown in SEQ ID No. 3-4 and a primer pair as shown in SEQ ID No. 5-6 are used for amplification, and the amplification product is analyzed (such as sequencing), and the genotype result can be obtained.

[0022] Compared with the prior art, the present application has the following beneficial effects:

[0023] The present application develops two double-sided specific SNP markers closely linked to the Ph gene, and compared with the molecular markers disclosed in the prior art and linked to the Ph gene, the present application can better meet the needs of low cost, high throughput and automation of genotype detection in molecular breeding.

[0024] The present application uses tobacco SSR markers and SNP variation data based on whole genome resequencing to systematically and comprehensively describe the molecular characteristics of the chromosome fragment carrying the Ph gene. N. plumbaginifolia The present application uses tobacco SSR markers and SNP variation data based on whole genome resequencing to systematically and comprehensively describe the molecular characteristics of the chromosome fragment carrying the Ph gene. Ph The present application uses tobacco SSR markers and SNP variation data based on whole genome resequencing to systematically and comprehensively describe the molecular characteristics of the chromosome fragment carrying the Ph gene. Ph The present application uses tobacco SSR markers and SNP variation data based on whole genome resequencing to systematically and comprehensively describe the molecular characteristics of the chromosome fragment carrying the BRIEF DESCRIPTION OF DRAWINGS

[0025] To more clearly illustrate the technical solution of the present invention, the accompanying drawings used in the present invention will be briefly described below. Obviously, the drawings described below are merely some embodiments of the present invention, and those skilled in the art can obtain other drawings based on these drawings without any creative effort.

[0026] Figure 1 The above are the SSR analysis results of the terminal segment of linkage group 20 in Coker371-Gold in Example 1 of this invention. A represents the SSR polymorphism analysis between China Tobacco Special Fragrance 301 and Coker371-Gold; B represents the SSR markers and their positions at the terminal segment of linkage group 20; and C represents the SSR markers at... NtaSR1 And the physical location of Yunyan 87 in the genome;

[0027] Figure 2 This is a chromosome distribution diagram showing the number and average spacing of Coker371-Gold specific SNPs in Embodiment 1 of the present invention, where A is the chromosome distribution of the number of Coker371-Gold specific SNPs and B is the average spacing of each chromosome specific SNP in Coker371-Gold.

[0028] Figure 3 This is a comparison of the allelic SNP deletion rates of Coker371-Gold and 32 other cultivated tobacco germplasm resources in the 0-30 Mb region of chromosome 87HIC_ASM_14 of the Yunnan tobacco plant.

[0029] Figure 4 In Embodiment 1 of the present invention, and Ph Molecular markers of gene linkage and their genetic maps, where A represents 8 known and linked genes. Ph Molecular markers of gene linkage and their genetic maps, B being a newly developed marker in this invention related to... Ph Linked SNP molecular markers and their physical maps; recombinant single plants represent the number of single plants in which phenotype and genotype recombine.

[0030] Figure 5 As carried in Embodiment 2 of the present invention Ph Comparison of resistance performance of the new Zhongyan Texiang 301 strain (left) and the original Zhongyan Texiang 301 strain (right) after inoculation with black shank race 0;

[0031] Figure 6 As carried in Embodiment 2 of the present invention Ph A comparison of the field performance of the new Zhongyan Texiang 301 strain (left) and the original Zhongyan Texiang 301 strain (right) in Feixian County, Shandong Province. Detailed Implementation

[0032] The embodiments of the technical solution of the present invention will now be described in detail with reference to the accompanying drawings. These embodiments are merely illustrative of the technical solution of the present invention and are therefore intended to limit the scope of protection of the present invention.

[0033] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs; the terminology used herein is for the purpose of describing particular implementations only and is not intended to limit the invention; the term "comprising" and any variations thereof are intended to cover non-exclusive inclusion.

[0034] To address the lack of genes for resistance to black shank in existing technologies Ph Addressing the technical challenges of linked SNP markers, this invention, based on tobacco SSR markers and SNP variation analysis of 33 cultivated tobacco germplasm resources, systematically elucidates the role of carriers of tobacco black shank resistance. Ph Genes N. plumbaginifolia Molecular features of chromosome segments were integrated and mapped from existing data. Ph Genetic mapping based on gene molecular markers, and further development of related technologies. Ph Two bilaterally specific SNP markers that are tightly linked to the gene thus meet the current needs of molecular breeding for disease resistance in tobacco.

[0035] The embodiments of the present invention provide tobacco-based anti-black shank disease Ph The specific SNP markers of tightly linked genes are:

[0036] The nucleotide sequence of SNP-2 is shown in SEQ ID No. 1, and the polymorphic site is located at position 68 of the sequence shown in SEQ ID No. 1, with a polymorphism of T / C.

[0037] The nucleotide sequence of SNP-6 is shown in SEQ ID No. 2, and the polymorphic site is located at position 431 of the sequence shown in SEQ ID No. 2, with a polymorphism of T / A.

[0038] This invention provides a primer set for detecting the aforementioned SNP markers, specifically:

[0039] Primer pairs with sequences as shown in SEQ ID No. 3-4 are used to detect SNP-2;

[0040] Primer pairs with sequences as shown in SEQ ID No. 5-6 are used to detect SNP-6.

[0041] This invention also provides a method for cultivating tobacco varieties resistant to black shank, comprising the following steps:

[0042] S1, will carry PhThe tobacco with resistance to black shank disease carries the gene Ph The tobacco with susceptibility to black shank disease does not carry the gene

[0043] S2, selecting a single plant with SNP-2 genotype of C / T, SNP-6 genotype of T / A and phenotype similar to the tobacco with susceptibility to black shank disease from the population obtained in step S1, crossing the single plant with the tobacco with susceptibility to black shank disease, and continuously selecting a single plant with SNP-2 genotype of C / T, SNP-6 genotype of T / A and phenotype similar to the tobacco with susceptibility to black shank disease from the cross, and repeating the above operation until a target single plant with SNP-2 genotype of C / T, SNP-6 genotype of T / A and phenotype similar to the tobacco with susceptibility to black shank disease is obtained

[0044] S3, selfing the target single plant, and identifying a single plant with SNP-2 genotype of T / T and SNP-6 genotype of A / A from the selfing, which is a new tobacco strain with resistance to black shank disease.

[0045] In an embodiment of the present application, the tobacco with resistance to black shank disease carries the gene Ph The tobacco with susceptibility to black shank disease does not carry the gene Ph The tobacco with susceptibility to black shank disease is Zhongyan Te Xiang 301; the obtained new tobacco strain has excellent resistance to black shank disease, and has no obvious difference in phenotype after field planting with Zhongyan Te Xiang 301.

[0046] Some specific examples are listed below, and it should be noted that the examples described below are exemplary and are used to explain the present application, and cannot be understood as a limitation of the present application. If the specific technology or condition is not specified in the examples, the technology or condition described in the literature in the art or according to the product manual is used. If the reagent or instrument is not specified by the manufacturer, it is a conventional product that can be obtained by purchase.

[0047] Example 1

[0048] The present application uses tobacco SSR markers and SNP variation data based on whole genome resequencing to systematically and comprehensively analyze the molecular characteristics of the chromosome fragment carrying the gene Ph The tobacco with resistance to black shank disease carries the gene N. plumbaginifolia The tobacco with susceptibility to black shank disease does not carry the gene Ph The tobacco with resistance to black shank disease carries the gene Ph The tobacco with susceptibility to black shank disease is Zhongyan Te Xiang 301; the obtained new tobacco strain has excellent resistance to black shank disease, and has no obvious difference in phenotype after field planting with Zhongyan Te Xiang 301. Ph The tobacco with resistance to black shank disease carries the gene Ph The SNP marker closely linked to the gene is developed. Specifically, the following experiments are included:

[0049] (1) The tobacco with resistance to black shank disease carries the gene Ph The tobacco with susceptibility to black shank disease does not carry the gene N. plumbaginifoliaSSR molecular marker analysis of chromosome fragments.

[0050] Refer to Bao et al. (BAO YG, DING N, QIN QL, et al. Genetic mapping of the Ph gene conferring disease resistance to black shank in tobacco. MolecularBreeding, 2019, 39(9): 122) Right Ph The gene localization results were based on the high-density linkage map of tobacco SSRs published by Bindler et al. (BINDLER G, PLIESKE J, BAKAHER N, et al. A high-density genetic map of tobacco). Nicotiana tabacum (L.) obtained from large-scale microsatellite marker development. Theoretical and Applied Genetics, 2011, 123: 219-230). Twenty-two SSR markers uniformly distributed from the end to the 70 cM region of linkage group 20 (LG20) were selected. PCR and polyacrylamide gel electrophoresis analysis were performed on Zhongyan Texiang 301 and Coker371-Gold, and a total of 19 stable amplified SSR markers with clear bands were obtained. Polymorphism analysis showed that nine SSR markers from the ends to 27.816 cM were polymorphic between Zhongyan Texiang 301 and Coker371-Gold, but only three of them were co-dominant markers (i.e., amplified in both Zhongyan Texiang 301 and Coker371-Gold with length polymorphism), while the remaining six were dominant markers of Zhongyan Texiang 301 (i.e., amplified only in Zhongyan Texiang 301 and not in Coker371-Gold); however, although ten SSR markers from 39.192 cM to 63.237 cM amplified in both Zhongyan Texiang 301 and Coker371-Gold, none of them showed length polymorphism. Figure 1 (A and B).

[0051] In the evolutionary history of the genus *Nicotiana*, due to N. plumbaginifolia With cultivated tobacco and its two ancestral species N. sylvestris and N. tomentosiformis The differentiation has spanned millions of years, resulting in dramatic changes and the accumulation of a massive amount of differentially expressed sequences between genomes. Based on this, it can be inferred that...Ph gene of N. plumbaginifolia The chromosome fragment might be transferred into the cultivated tobacco genome by the form of terminal translocation, and the translocation site is located between 27.816 cM and 39.192 cM of tobacco SSR linkage group 20 ( Figure 1 B), corresponding to the HIC_ASM_14 chromosome of Yunyan 87 genome between 13.029 Mb and 19.547 Mb, and the newly published NtaSR1 genome (WANG J B, ZHANG Q L, TUNG J, et al. High-quality assembled and annotated genomes of Nicotiana tabacum and Nicotiana benthamiana Chr19 between 150.695 Mb and 141.160 Mb (C). In addition, according to the 3 co-dominant SSR markers on the fragment, it is inferred that the fragment might have some homology with the replaced cultivated tobacco chromosome fragment. Figure 1

[0052] (2) SNP molecular marker analysis of the chromosome fragment carrying Ph gene of N. plumbaginifolia

[0053] 33 different types of cultivated tobacco germplasm resources including Zhongyan Te Xiang 301 and Coker371-Gold were subjected to whole genome resequencing, including Coker371-Gold, Zhongyan Te Xiang 301, Beinhart 1000-1, Florida 301, Coker 86, Dixie Bright 101, Hicks, K346, NC82, NC89, Speight G-28, Speight G-80, Jingye Huang, Yanyan 97, K326, Cuibi No.1, Honghua Dajinyuan, Longjiang 911, Zhongyan 101, Zhongyan 100, Te 2, Te 3, Te 4, Te 5, Te 8, Te 10, Te 13, Te 18, Te Xiang Zhusha Yan, Samsun, TN 90, Daba Jin 599 and Gexin No.3. The related information of these germplasm resources and SNP variation analysis method are described in detail in the literature “Construction and application of Zhongyan Te Xiang 301 specific SNP fingerprint” (China Tobacco Science, 2024, 45(5): 8-16).

[0054] ​​Based on SNP variation analysis data, a statistical analysis was first performed on 2894 specific SNPs in Coker371-Gold that distinguish it from 32 other germplasm resources. The results showed that nearly half of the specific SNPs were concentrated on chromosome HIC_ASM_14 (1282, accounting for 44.30%), while the number of SNPs on the remaining chromosomes ranged from 26 to 200, showing significant differences from HIC_ASM_14. Figure 2 A). The average spacing of specific SNPs also indicates that the density of specific SNPs on HIC_ASM_14 is significantly higher than that on other chromosomes ( Figure 2 B). Further statistical analysis was performed on the distribution of specific SNPs on the HIC_ASM_14 chromosome, and the results are as follows: Figure 2 As shown in Figure A, the vast majority of specific SNPs are concentrated in the chromosomal region of 0–18.54 Mb (i.e., HIC_ASM_14U, accounting for 96.57%); the average spacing of specific SNPs in this region is also highly similar to that of HIC_ASM_14 mentioned above. Figure 2 B). The remaining segments (HIC_ASM_14D) showed no significant differences from other chromosomes. Figure 2 A, 2B). In summary, it is speculated that HIC_ASM_14U may carry... Ph Genetic N. plumbaginifolia The chromosome fragments, the ends of which also coincide with the translocation intervals inferred from the aforementioned SSR analysis.

[0055] Allelic SNP deletion rates of 35,379 SNP variants within the 0–30 Mb range on chromosome HIC_ASM_14 were statistically analyzed across all 33 germplasm resources, including Coker371-Gold. Results showed that, except for the 0–1 Mb range, the allelic SNP deletion rate of Coker371-Gold was significantly higher than that of the other 32 germplasm resources (0.00–0.02) within the 1–18.54 Mb range (0.32–0.59). However, within the 18.54–30 Mb range, the allelic SNP deletion rate of Coker371-Gold did not differ significantly from other germplasm resources. Figure 3 The above results indicate that carrying Ph Genetic N. plumbaginifolia The chromosome segment showed good homology with the replaced cultivated tobacco chromosome segment, and its translocation site was located near 18.54 Mb on the Yunyan 87HIC_ASM_14 chromosome.

[0056] (3) Existing Ph Integration mapping of gene-linked molecular markers.

[0057] According to the methods of GB / T 23224-2008 (Identification of Disease Resistance of Tobacco Varieties) and Guo X et al. (Genetic analysis of resistance to Phytophthora parasitica race 0 in cigar tobacco Beinhart 1000-1, Tobacco Science of China, 2017, 38(2): 56-62), the race 0 of P. parasitica was activated and propagated, and Coker371-Gold, Zhongyan Te Xiang 301 and the BC1F1 population derived from the hybridization and backcross of the two were inoculated with the pathogen when the seedlings grew to 5-6 true leaves. The resistance of each test material to black shank was identified according to GB / T 23222-2008 (Classification and Investigation Methods of Tobacco Diseases and Pests). After inoculation, the disease condition of each single plant was investigated every 3 days, and the classification was made according to the disease severity until the disease condition no longer developed. After the disease investigation was completed, 0-1 grade was determined as resistant, and 7-9 grade was determined as susceptible. The investigation results showed that 113 resistant plants and 90 susceptible plants were identified. Chi-square (X2) test showed that the resistant and susceptible separation was consistent with the dominant single gene inheritance (Table 1). χ 2 ) test showed that the resistant and susceptible separation was consistent with the dominant single gene inheritance (Table 1).

[0058] Table 1 Resistance separation and statistics of the BC1F1 population derived from the hybridization of Coker371-Gold and Zhongyan Te Xiang 301 to black shank

[0059]

[0060] Note: “―” means data missing.

[0061] By consulting and collecting 5 molecular markers known to be linked to Ph gene, plus 3 co-dominant SSR markers screened in step (1), a total of 8 molecular markers that can be used for backcross breeding were obtained, as shown in Table 2.

[0062] Table 2 Information of 8 molecular markers known to be linked to Ph gene

[0063]

[0064] Note: “―” means data missing.

[0065] The markers in Table 2 were used to detect the genotype of the above-mentioned BC1F1 population, and on this basis, QTL IciMapping 4.2 was used to draw a genetic linkage map of Ph gene. The results are shown in Figure 4 A, except that InDel0617 is co-segregated with Ph gene, the rest of the markers are located on the same side, and the genetic distance from Ph gene is 0.49, 0.99 and 1.48 cM, respectively, which preliminarily completes the existing PhIntegration mapping of gene-linked molecular markers.

[0066] Following the method of Zhang Lei et al. (Comparison of two methods for recovering small DNA fragments from non-denaturing polyacrylamide gels, Chinese Agricultural Science Bulletin, 2011, 27(7): 227-230.), the target DNA bands of the PCR products of the seven linked SSR markers, excluding BS-SCAR1 (the PCR products of this marker were analyzed by agarose gel electrophoresis), were separated from the polyacrylamide gel. After being crushed with a pipette tip, an appropriate amount of ddH2O was added and boiled for 15 min. The supernatant obtained after centrifugation at 12000 r / min for 5 min was used as a template for a second PCR using the original SSR primers. The PCR products were then detected by polyacrylamide gel electrophoresis and then sequenced according to routine procedures. Finally, they were compared with Yunyan 87 and NtaSR1 Genome alignment was used to obtain the precise physical location of SSRs within the genome. Analysis of the chromosomal locations of these linkage markers revealed that their relative positions on the physical map were consistent with those on the genetic map, further demonstrating the reliability of the genetic linkage map.

[0067] (4) with Ph Development of SNP markers for tight gene linkage.

[0068] To further clarify Ph Within the gene region, the specific SNPs of Coker371-Gold were collected in the region where the markers Scf_30K and InDel0617 are located, and in the 3 Mb region downstream of InDel0617. Using TBtools software and PrimerPremier 5.0 software, new linkage molecular markers were developed, and 6 pairs of stable polymorphic SNP markers were successfully developed, as shown in Tables 3 and 4.

[0069] Table 3. Locations and variant information of six Coker371-Gold specific SNPs.

[0070]

[0071] Table 4. Information on 6 Coker371-Gold specific SNP primers

[0072]

[0073] The BC1F1 population is genotyped by using the SNP markers (it can be understood that the BC1F1 population has only two genotypes, i.e., donor parent / recurrent parent heterozygous type and recurrent parent / recurrent parent homozygous type; when the above BC1F1 population is detected by using the marker SNP1-6, if the genotype of a single plant at the target SNP site is heterozygous, i.e., C / T, T / C, A / C, T / A, A / T, A / T, respectively, the marker genotype of the single plant is the donor parent / recurrent parent heterozygous type, and if the genotype of a single plant at the target SNP site is homozygous, i.e., T / T, C / C, C / C, A / A, T / T, T / T, respectively, the marker genotype of the single plant is the recurrent parent / recurrent parent homozygous type. The genotypes can be identified by using the SNP markers and primers according to the existing method, and the example will not be described in detail here), and the different recombinant single plants and the trend of the reduction are used to determine the genetic location of the gene between SNP-2 and SNP-6, the interval size of which is about 6.60 Mb on the chromosome of Yunyan 87 HIC_ASM_14, and the interval size of which is about 12.89 Mb on the chromosome of Ph Chr19. NtaSR1 B). The genetic distance between SNP-2 and SNP-6 and the gene is calculated to be 0.49 cM, which reaches the close linkage degree (≤0.5 cM), and SNP-2 and SNP-6 are Coker371-Gold specific SNPs, so they can be effectively used for the molecular marker assisted improvement breeding of the gene in many varieties. Figure 4 Ph Ph

[0074] The specific sequence information of the SNP markers SNP-2 and SNP-6 closely linked to the gene is shown in Sequence 1 (SEQ ID No. 1) and Sequence 2 (SEQ ID No. 2), respectively. In the genomes of Zhongyan Te Xiang 301 and other 31 different types of cultivated tobacco germplasm resources not carrying the gene, the 68th position of Sequence 1 is C, and the 431st position of Sequence 2 is T; in the genome of Coker371-Gold carrying the gene, the 68th position of Sequence 1 is T, and the 431st position of Sequence 2 is A. Ph Ph Ph

[0075] Sequence 1 is as follows:

[0076] TCACTAAAGCTACAAGGCACA ​​​​​​CACATATATGCAACACTTGGTTTATGTTACATAACACCTCTACAAA(C / T)TGTAAATACCAAAAATCAAGTTATACCATTTCACCGTTTGAATATATCTATATAAGCTGTGTGGGTTTCTGTTTTTATTTTTTGCTTCAAATGAGCAGCAGAATGAAGAAGAATTTGGACATGAGCGTAGACGTCGGAATCTCAGTGCAATACAAGGGTGGTGAATAATTTTATTCGTTTTTTATCGTGTGAAATCATAAGCCATATTTATTACTTTGGAAACCATTTTTGGAAAGCATAAATTAGCTGAAAGGAAAAACTTTTCATTAAATAT GAATGTAATCCTTGGTTTGAAC (SEQ ID No. 1).

[0077] Sequence 2 is specified as follows:

[0078] TAGAAACGTAGAAACAGGAAT TTCCTTGTAAGGTTGCTTATTGACTTGCATTAAATTTTGACATCTATCTAATTTGATAATTAACCAAGCATGGCTTGGCTTTTACACATCACAATTATCCAAAACAAGAATTATATCTTATGTAATGCCCTCAATTTTAATGATTCTTTTATAGTGTTGCTTACTTGTACAATGTGTTATGACTCGACACAATGGGATAATCATGTCATAATTAATTACTCAAAATGACTTGTACATTGTTTTCATTAACAAGGATATTGAGGATACATATGTACAAGTCATTTTGAGTAATTATAGCCTATCATCAACTAGTTATAATATACTCGTAATATTGTATAAAGAGGAATAACAACAACAACAACAACAACCCAGTGTAATAAAATTTTGATATTACAAAATATTTTGA(T / A)ATCCTTGCAACAATTTT GCTATTTTAGTTACCTATTTCTA (SEQ ID No. 2).

[0079] Example 2

[0080] This example demonstrates the effectiveness of SNP markers SNP-2 and SNP-6 in Ph molecular marker assisted improvement breeding of the gene, and the specific experiment is as follows:

[0081] From the BC1F1 population ((Zhongyan Texiang 301 × Coker371-Gold) × Zhongyan Texiang 301) generated by crossing Coker371-Gold with Zhongyan Texiang 301 and backcrossing, single plants with SNP-2 genotype C / T and SNP-6 genotype T / A, and whose appearance is similar to Zhongyan Texiang 301, were selected and crossed with Zhongyan Texiang 301 to obtain the BC2F1 population. Single plants with SNP-2 genotype C / T and SNP-6 genotype T / A, and whose appearance is similar to Zhongyan Texiang 301, were then identified from the BC2F1 population and crossed with Zhongyan Texiang 301. This process was repeated until the BC5F1 population yielded target single plants with SNP-2 genotype C / T and SNP-6 genotype T / A, and whose appearance was not significantly different from Zhongyan Texiang 301. These were then self-pollinated to obtain the BC5F2 population. A single plant with SNP-2 genotype T / T and SNP-6 genotype A / A, and whose appearance was not significantly different from that of China Tobacco Special Fragrance 301, was identified from the BC5F2 population. This plant is considered a carrier. Ph Gene-based China Tobacco Special Fragrance 301 new product line.

[0082] Referring to the method in step (3) of Example 1, the above-mentioned carrier Ph A new strain of Zhongyan Texiang 301 containing the gene was investigated after inoculation with black shank disease race 0 and the strain underwent full disease development. Results showed that the gene carrier... Ph The new strain of China Tobacco Special Fragrance 301 showed no obvious symptoms of disease, while the strain of China Tobacco Special Fragrance 301 was extremely severe. Figure 5 Additionally, during the peak blooming season in Daejeon, carrying... Ph The new strain of China Tobacco Special Flavor 301 has no significant difference in appearance from the original China Tobacco Special Flavor 301. Figure 6 The above results clearly demonstrate that SNP-2 and SNP-6 can be effectively used for... Ph Molecular markers for genes assist in breeding improvement.

[0083] In summary, this invention, based on tobacco SSR markers and SNP variation analysis of 33 cultivated tobacco germplasm resources, systematically elucidates the role of carriers of tobacco black shank resistance. Ph Genes N. plumbaginifolia Molecular features of chromosome segments were integrated and mapped from existing data. Ph Genetic mapping based on gene molecular markers; and, based on this, the following technologies have been developed. Ph Two closely linked bilateral specific SNP markers can well meet the current needs of molecular breeding work for tobacco disease resistance.

[0084] Note that the present application is not limited to the above-described embodiments. The above-described embodiments are merely examples, and embodiments having substantially the same configuration as the technical idea and achieving the same effects within the scope of the technical idea of the present application are included in the technical scope of the present application. Furthermore, other modes constructed by applying various modifications that can be thought of by those skilled in the art to the embodiments or by combining part of the constituent elements of the embodiments are also included in the scope of the present application without departing from the spirit of the present application.

Claims

1. An SNP marker closely linked to the Ph gene for resistance to black shank in tobacco, characterized in that, It includes SNP-2 and SNP-6; the nucleotide sequence of SNP-2 is shown in SEQ ID No.1, and the polymorphic site is located at position 68 of the sequence shown in SEQ ID No.1; the nucleotide sequence of SNP-6 is shown in SEQ ID No.2, and the polymorphic site is located at position 431 of the sequence shown in SEQ ID No.

2.

2. Detect the primer set of the SNP marker as described in claim 1.

3. The primer set according to claim 2, characterized in that, This includes primer pairs with sequences as shown in SEQ ID No. 3-4 and primer pairs with sequences as shown in SEQ ID No. 5-6.

4. A detection product containing the primer set described in claim 2.

5. The primer set as described in claim 2 or the detection product as described in claim 4 for detecting whether tobacco materials carry [a specific substance]. Ph In the application of genes, the tobacco material is Coker371-Gold or the offspring obtained from a cross between Coker371-Gold. When the genotype of SNP-2 carries T and the genotype of SNP-6 carries A, then the tobacco material being tested carries... Ph Gene.

6. A method for cultivating tobacco varieties resistant to black shank disease, characterized in that, Includes the following steps: S1. Cross the black shank resistant tobacco carrying the Ph gene with the black shank susceptible tobacco without the Ph gene and then backcross. S2. Select individual plants from the population obtained in step S1 with SNP-2 genotype C / T and SNP-6 genotype T / A, whose phenotypes are similar to those of the susceptible tobacco plants. Cross these individual plants with the susceptible tobacco plants. Continue to select individual plants with SNP-2 genotype C / T and SNP-6 genotype T / A, whose phenotypes are similar to those of the susceptible tobacco plants. Repeat the above operation until a target individual plant with SNP-2 genotype C / T and SNP-6 genotype T / A, whose phenotype is not significantly different from that of the susceptible tobacco plants, is obtained. S3. Self-pollinate the target individual plants to identify individual plants with SNP-2 genotype T / T and SNP-6 genotype A / A, which are the new tobacco lines resistant to black shank disease. The nucleotide sequence of SNP-2 is shown in SEQ ID No. 1, and the polymorphic site is located at position 68 of the sequence shown in SEQ ID No. 1; the nucleotide sequence of SNP-6 is shown in SEQ ID No. 2, and the polymorphic site is located at position 431 of the sequence shown in SEQ ID No.

2. The carrying Ph The gene for resistance to black shank in tobacco is Coker371-Gold; The term does not carry Ph The tobacco varieties susceptible to black shank disease are any one of the following: China Tobacco Special Fragrance 301, Beinhart 1000-1, Florida 301, Coker 86, Dixie Bright 101, Hicks, K346, NC82, NC89, Speight G-28, Speight G-80, Jingyehuang, Yanyan 97, K326, Cuibi No. 1, Honghua Dajinyuan, Longjiang 911, China Tobacco 101, China Tobacco 100, Special 2, Special 3, Special 4, Special 5, Special 8, Special 10, Special 13, Special 18, Special Fragrance Zhusha Tobacco, Samsun, TN 90, Dabaijin 599, and Gexin No. 3.

Citation Information

Patent Citations

  • Codominant SSR marker closely linked with black shank resistance gene of cigar and application thereof

    CN114032323A