The invention relates to 6apos; application of-O-caffeoyl arbutin in preparation of product for preventing and / or treating atopic dermatitis as well as pharmaceutical preparation and cosmetic of-O-caffeoyl arbutin
By using 6'-O-caféyl arbutin as the active ingredient, the safety and cost issues in the treatment of atopic dermatitis are solved, effective dermatitis inhibition and anti-inflammatory effects are achieved, and the risk of skin irritation is reduced.
Patent Information
- Application Number
- CN202510737362.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-04
- Publication Date
- 2025-08-15
AI Technical Summary
The existing atopic dermatitis treatment drugs have skin irritation, atrophy risk, immune disorder risk and high cost problems, and biological agents are expensive and lack effective and safe treatment options for plant-derived compounds.
6'-O-caféyl arbutin is used as the active ingredient and is prepared by natural plant extraction or chemical synthesis. It is used to prepare pharmaceutical preparations and cosmetics with a weight percentage content of 0.1% to 5%, including oral, topical and injectable preparations, as well as serums, face creams and other products for the prevention and treatment of atopic dermatitis.
6'-O-Cafroyl Arbutin significantly inhibits rash and erythema in patients with atopic dermatitis, has good anti-inflammatory effects, is safe, has no toxic side effects, is low in cost, is better than dexamethasone's anti-inflammatory ability, significantly downregulates the expression of inflammatory factors, improves dermatitis symptoms and reduces scratching behavior.
Smart Images

Figure CN120478374A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of medical technology, and more specifically relates to an application of 6'-O-caffeoylarbutin in preparing a product for preventing and / or treating atopic dermatitis, and a pharmaceutical preparation and cosmetic thereof. Background Art
[0002] Atopic dermatitis (AD) is a chronic, relapsing, inflammatory skin disease characterized by recurrent episodes of eczematous dermatitis. Its incidence rate is approximately 10%-30% in children and 2%-10% in adults. The global prevalence of AD is increasing annually, and an increasing number of patients and families are suffering from the condition. Therefore, the active exploration of therapeutic agents for AD is of great clinical significance.
[0003] The primary goal of atopic dermatitis treatment is to reduce triggering or exacerbating factors, alleviate clinical symptoms, prevent and delay relapses, and improve patients' quality of life. Currently, atopic dermatitis treatments primarily utilize topical medications (such as corticosteroids (TCS) and calcineurin inhibitors (TCIs)) or biologics (such as those targeting the IL-4 and IL-13 pathways and small molecule inhibitors of the JAK-STAT pathway). However, topical TCS increases the risk of skin atrophy, particularly in skin wrinkles. Excessive use can also affect growth and development, particularly in children. Topical TCIs can cause local irritation, forcing some patients to discontinue treatment due to intolerance. Furthermore, the use of biologics carries the potential risk of inducing immune disorders, other immune diseases, or tumors. Furthermore, biologics are expensive, placing a significant financial burden on patients.
[0004] 6'-O-Caffeoylarbutin, also known as Robustaside B or urogynoside, is a monomeric compound extracted and isolated from the buds of Vaccinium dunalianum, a plant of the genus Vaccinium in the family Ericaceae. Its molecular formula is C21H22O10, and its chemical structure is as follows:
[0005] 6'-O-Caffeoyl arbutin can be obtained by extracting the buds of Camellia sinensis (Coleoptera: Camellia sinensis) through reflux with 60% ethanol and water, followed by purification using AB-8 macroporous resin, followed by crystallization at 40°C, and drying under reduced pressure. Alternatively, it can be obtained using conventional extraction, separation, and purification techniques. It is also commercially available. 6'-O-Caffeoyl arbutin is a compound with diverse biological activities and low toxicity. Prior art reports indicate that 6'-O-Caffeoyl arbutin exhibits anti-inflammatory, antibacterial, antioxidant, and anti-tumor effects. It also has hypoglycemic, hypolipidemic, and hepatoprotective properties, and has potential applications in cosmetics, pharmaceuticals, and functional foods. For example, the prior art "6'-O-Caffeoylarbutin from Que Zuitea ameliorates acetaminophen-induced liver injury via enhancing antioxidantability and regulating the PI3K signaling pathway" reports that 6'-O-caffeoyl arbutin has a protective effect against APAP-induced hepatotoxicity by regulating the PI3K / Akt and Nrf2 signaling pathways. Prior art CN111939190A and CN113499357A also disclose that Que Zuitea tea extracts rich in 6'-O-caffeoyl arbutin have a good therapeutic effect on hyperuricemia and its complications, especially for renal failure caused by hyperuric acid stones. However, there are no reports on the use of 6'-O-caffeoyl arbutin in products for the prevention and / or treatment of atopic dermatitis.
[0006] The inventors unexpectedly discovered through extensive research that 6'-O-caffeoylarbutin has an effective and / or preventive effect on atopic dermatitis (AD). Further in-depth and innovative research revealed that it has unexpected effects on both the pathological inhibition and clinical and / or prevention of atopic dermatitis. Summary of the Invention
[0007] The main purpose of the present invention is to propose an application of 6'-O-caffeoyl arbutin in the preparation of products for preventing and / or treating atopic dermatitis, as well as pharmaceutical preparations and cosmetics thereof, in order to solve the problem that 6'-O-caffeoyl arbutin has not yet been used in products for preventing and / or treating atopic dermatitis.
[0008] To achieve the above objectives, in a first aspect, the present invention provides a use of 6'-O-caffeoylarbutin in preparing a product for preventing and / or treating atopic dermatitis, wherein the product for preventing and / or treating atopic dermatitis includes a pharmaceutical preparation or a cosmetic.
[0009] Furthermore, the weight percentage of the 6'-O-caffeoylarbutin in the product for preventing and / or treating atopic dermatitis ranges from 0.1% to 5%.
[0010] Furthermore, the 6'-O-caffeoylarbutin is prepared by natural plant extraction, chemical synthesis or chemical semi-synthesis.
[0011] Furthermore, the product for preventing and / or treating atopic dermatitis also includes pharmaceutically acceptable excipients.
[0012] Furthermore, the pharmaceutically acceptable excipients include carriers. It should be noted that the aforementioned 6'-O-caffeoylarbutin is the active pharmaceutical ingredient (API) in the drug or cosmetic for preventing and / or treating atopic dermatitis, while the pharmaceutically acceptable excipients are all inactive ingredients in the drug or cosmetic for preventing and / or treating atopic dermatitis other than the API. There are many types of excipients, and carriers are one such type, used to carry the active pharmaceutical ingredient to improve solubility, dispersibility, or delivery efficiency.
[0013] In a second aspect, the present invention further provides a pharmaceutical preparation, wherein the active ingredient in the pharmaceutical preparation is 6'-O-caffeoylarbutin.
[0014] Furthermore, the pharmaceutical preparation is an oral preparation, an external preparation or an injection preparation.
[0015] Furthermore, the weight percentage of the 6'-O-caffeoylarbutin in the pharmaceutical preparation or cosmetic is in the range of 0.1% to 5%. Preferably, the weight percentage of the 6'-O-caffeoylarbutin in the pharmaceutical preparation or cosmetic is in the range of 0.5% to 4.5%; preferably, 1% to 4%; preferably, 1.5% to 3.5%; preferably, 2% to 2.5%; preferably, 2.5% to 3%; preferably, 3%.
[0016] Furthermore, the pharmaceutical preparation is an oral preparation, an external preparation or an injection preparation.
[0017] Furthermore, when the pharmaceutical preparation is an oral preparation, the dosage form of the oral preparation is selected from any one of hard capsules, dripping pills, granules, tablets, mixtures, soft capsules or concentrated pills; when the pharmaceutical preparation is an external preparation, the dosage form of the external preparation is selected from any one of pastes, patches, powders, tinctures, ointments, gels, liniments, lotions, sprays or foams; when the pharmaceutical preparation is an injection preparation, the dosage form of the injection preparation is selected from any one of injection solution or freeze-dried powder injection.
[0018] In a third aspect, the present invention further provides a cosmetic, wherein the active ingredient of the cosmetic is 6'-O-caffeoylarbutin.
[0019] Furthermore, the cosmetic type is selected from essence, cream, gel, lotion, and soluble microneedle patch.
[0020] Compared with the prior art, the present invention has at least the following beneficial effects: (1) The present invention discloses an application of 6'-O-caffeoyl arbutin in the preparation of a product for preventing and / or treating atopic dermatitis, wherein 6'-O-caffeoyl arbutin is used as an active ingredient. The application is the application of 6'-O-caffeoyl arbutin in the preparation of a product for preventing and / or treating atopic dermatitis. The weight percentage of 6'-O-caffeoyl arbutin in the product for preventing and / or treating atopic dermatitis ranges from 0.1% to 5%. The product can significantly inhibit the rash, erythema, and scratching of patients with atopic dermatitis, and has a good therapeutic effect. In addition, 6'-O-caffeoyl arbutin can be obtained from plant sources, has no toxic side effects, skin irritation, or skin allergic reactions, and has better safety and lower treatment costs.
[0021] (2) The present invention discloses a pharmaceutical preparation and a cosmetic, wherein the active ingredient in the pharmaceutical preparation is 6'-O-caffeoyl arbutin. In an atopic dermatitis keratinocyte inflammation model, the regulatory effect of the test substance (6'-O-caffeoyl arbutin) on the expression levels of inflammatory factors CCL26, IL-33, and IL-24 was observed. The results showed that 6'-O-caffeoyl arbutin had a down-regulating effect on the expression of inflammatory factors IL-33 and CCL26; among them, the down-regulation of CCL26 expression was significant, which was better than the positive drug dexamethasone sodium acetate; In the RAW264.7 cell inflammation model, the inhibitory effect of the test substance (6'-O-caffeoyl arbutin) on the inflammatory factors NO and IL-6 was observed. The results showed that 6'-O-caffeoyl arbutin could significantly downregulate the expression of NO and IL-6 in the LPS-induced RAW264.7 cell inflammation model, indicating that 6'-O-caffeoyl arbutin has significant anti-inflammatory ability, and its anti-inflammatory effect is slightly better than that of the control drug (dexamethasone sodium acetate). BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1 These are schematic diagrams of the photos taken of the back skin of mice on the 7th and 14th days in Example 4 of the present application. DETAILED DESCRIPTION
[0023] The technical solution of the present invention will be further described below with reference to the accompanying drawings and through specific embodiments. However, the following examples are merely simplified examples of the present invention and do not represent or limit the scope of protection of the present invention. The scope of protection of the present invention shall be subject to the claims.
[0024] Example 1: Keratinocyte inflammation model test (1) Test samples Test substances: 6'-O-caffeoylarbutin (Uruginin, CA) was provided by Yunnan Yunke Specialty Plant Extraction Laboratory Co., Ltd.; Positive drug: Dexamethasone sodium acetate (Dex) was purchased from Shanghai Aladdin Biochemical Technology Co., Ltd.
[0025] (2) Experimental reagents and instruments Keratinocytes were HaCaT cells purchased from ATCC; DMEM high-glucose medium and fetal bovine serum were purchased from Gibco (USA); Cytokines IL4 and IL13 were purchased from GLPbio (USA); TRIzol reagent was purchased from Life Technologies (USA); PrimeScript™ II 1st Strand cDNA Synthesis Kit high-efficiency reverse transcription (RT) kit was purchased from Takara (Japan); SYBR Green Supermix triplicate qPCR reaction reagent was purchased from Roche (Switzerland).
[0026] (3) Experimental methods ① Cell culture HaCaT cells are human keratinocytes cultured in complete DMEM (10 wt% FBS, 100 U / ml penicillin, and 100 μg / ml streptomycin) at 37°C in a 5% CO2 atmosphere. Cells in logarithmic growth phase were seeded in 24-well plates. Experiments were performed when cells reached approximately 60% of the bottom of the culture flask (microscopic observation).
[0027] ②Th2 activation and drug administration Blank control group (Ctrl): no Th2 activation and drug administration; Model group (Th2 activation group): HaCaT cells were activated with 50 ng / ml of IL4 and IL13; Positive control group (Dex): HaCaT cells were activated with 50 ng / ml of IL4 and IL13, and 5 μg / ml of dexamethasone sodium acetate (Dex) was administered simultaneously; 6'-O-caffeoylarbutin group (Ujinin, CA): 50 ng / ml of IL4 and IL13 were used to activate HaCaT cells. At the same time, the test substance (6'-O-caffeoylarbutin) was administered at concentrations of 300 μg / ml (low-dose group), 450 μg / ml (medium-dose group), and 600 μg / ml (high-dose group), respectively. Three replicate wells were set for each concentration gradient of the low-dose group, medium-dose group, and high-dose group.
[0028] ③ RNA extraction and qPCR detection Total RNA was extracted from cells using TRIzol reagent, and mRNA was reverse transcribed using the PrimeScript™ II 1st Strand cDNA Synthesis Kit to synthesize cDNA templates. qPCR was performed using SYBR Green Supermixin triplicate qPCR reaction reagents. All target genes were normalized using the internal reference gene GAPDH. -ΔΔCT The mRNA level was calculated by the method. The GAPDH primer sequence used in the experiment was: The primer sequence for CCL26 was "F'CACCATCTTCCAGGAGCGAG; R'GCAGGAGGCATTGCTGAT"; the primer sequence for CCL26 was "F'GGAGTGACATATCCAAGACCTG; R'CTTGGATGGGTACAGACTTTCT." The remaining primers were from Primer Bank: IL24 (5803086a1); IL33 (314122336c1). Data are expressed as mean ± SD (n = 3). Experiments were performed in triplicate.
[0029] (4) Experimental results The experimental results showed that compared with the blank control group (Ctrl), the expression levels of the inflammatory cytokines CCL26, IL-33, and IL-24 in the model group (Th2 activation group) were significantly elevated. However, after drug intervention, the expression levels of CCL26, IL-33, and IL-24 were all downregulated in the positive control group (Dex) and the 6'-O-caffeoylarbutin (Uroquinone, CA) groups at concentrations of 300 μg / ml (low-dose group), 450 μg / ml (medium-dose group), and 600 μg / ml (high-dose group). The 6'-O-caffeoylarbutin (Uroquinone, CA) group significantly downregulated the expression of the inflammatory cytokines IL-33 and CCL26. The 6'-O-caffeoylarbutin (Uroquinone, CA) group significantly downregulated the expression of the inflammatory cytokines IL-33 more effectively than the positive drug dexamethasone (see Table 1).
[0030] Table 1: Effects of 6'-O-caffeoylarbutin on the expression levels of CCL26, IL-33, and IL-24
[0031] Example 2: RAW264.7 cell inflammation model test (1) Test samples Test substances: 6'-O-caffeoylarbutin (Uruginin, CA) was provided by Yunnan Yunke Specialty Plant Extraction Laboratory Co., Ltd.; Positive drug: Dexamethasone sodium acetate (Dex) was purchased from Shanghai Aladdin Biochemical Technology Co., Ltd.
[0032] (2) Experimental materials, reagents and instruments Cell lines: Mouse macrophage cell line RAW264.7 cells were obtained from the Shanghai Cell Bank of the Chinese Academy of Sciences.
[0033] Materials and reagents: DMEM medium (Gibco, 11995065), fetal bovine serum (FBS) (Gibco, 10099141); LPS (Sigma), CCK-8 detection kit (Dojindo), or MTT (Sigma); Mouse IL-6, IL-1β ELISA kits (Lianke Biotechnology); Serum-free cell freezing medium (New Saimei Biotechnology, Cat. No. C40100); 96-well plates, 24-well plates, and 10 cm cell culture dishes (corning).
[0034] instrument: Microplate reader (Multiskan FC, Thermo Fisher); CO2 incubator (Series 2 Water Jacketed, Thermo Fisher); Microcentrifuge (Fresco 21, Thermo Fisher).
[0035] (3) Experimental methods and steps ① Cell culture: Complete culture medium preparation: 90wt% DMEM medium, 10wt% fetal bovine serum; Cell culture and passaging: Resuscitated cells were seeded into 10 cm cell culture dishes, and 10 ml of complete medium was added. The cells were incubated at 37°C in a 5% CO2 incubator, with the medium changed every 2 days. Cell growth was observed. If the cell density exceeded 70% of the dish bottom area (observed under a microscope), the cells were passaged at a 1:2 passaging ratio and collected using a cell scraper.
[0036] Cell freezing: Collect cells in the growth phase into a centrifuge tube, centrifuge at 1000 rpm for 5 min to collect the cell pellet, completely discard the supernatant in the centrifuge tube, add an appropriate amount of serum-free cell freezing solution to the centrifuge tube to make the cell concentration about 5×10 5 cells / ml to 1×10 7 cells / ml, gently resuspend the cells, dispense into cryopreservation tubes, 1-1.5 ml per tube, and store in a -80℃ ultra-low temperature freezer in time.
[0037] ②Cell inoculation and drug administration Inoculation: RAW264.7 cells with good morphology and in logarithmic growth phase were prepared with complete medium to form 1×10 5 cells / ml of cell suspension, 100 μl per well was inoculated into a 96-well plate, i.e. 1×10 4 cells / well, add 200 μl PBS around the outer circumference of the 96-well plate, and incubate in a 37°C, 5% CO2 incubator for 24 h.
[0038] Administration: The test substance (6'-O-caffeoylarbutin) was diluted with complete culture medium at five concentration gradients (15 μg / ml, 30 μg / ml, 60 μg / ml, 120 μg / ml, and 140 μg / ml). Three replicate wells were set for each concentration gradient and the cells were incubated in a 37°C, 5% CO2 incubator for 24 h.
[0039] ③Cell activity detection Add 10 μl of CCK-8 solution directly to each well and incubate in a 37°C, 5% CO2 incubator for 1-2 hours. Use a microplate reader to measure the absorbance at a wavelength of 450 nm and a reference wavelength of 620 nm (MTT method refers to the pharmacopoeia method).
[0040] ④Calculate cell viability The optimal concentration range of the test substance (6'-O-caffeoylarbutin) was determined, and the cell viability was calculated using the following formula:
[0041] The cell viability of the test substance was calculated according to the above formula, and the concentration corresponding to CV90 was selected as the anti-inflammatory verification dosage concentration.
[0042] ⑤Data processing software analysis, expressed as mean ± standard deviation (n=6), the experiment was repeated 6 times.
[0043] (4) ELISA method to detect the inhibitory effect of the test substance on IL-6 and NO ① Inoculation: Select RAW264.7 cells in logarithmic growth phase with good morphology and prepare them into 1×10 5 cells / ml of cell suspension, 1000 μl per well was inoculated into a 24-well plate, i.e. 1×10 5 cells / well and incubate in a 37°C, 5% CO2 incubator for 24 h.
[0044] ②Administration of medication and LPS Blank control group (Ctrl): complete culture medium was added to each well; Model group (LPS-induced stimulation): LPS at a concentration of 1 μg / ml was added to each well; Positive control group (Dex): 5 μM (equivalent to 2.5 μg / ml) dexamethasone sodium acetate (Dex) diluted in complete culture medium was added to each well; 6'-O-Caffeoylarbutin group (Ujinin, CA): The test substance corresponding to the CV90 cell viability rate diluted in complete medium was added to each well, i.e., 60 μg / ml (low-dose group), 120 μg / ml (medium-dose group), and 140 μg / ml (high-dose group), respectively. Three replicates were set up for each group. Incubate in a 37°C, 5% CO2 incubator for 1-2 hours; except for the blank control group, add LPS with a final concentration of 1 μg / ml to each well and incubate in a 37°C, 5% CO2 incubator for 22-24 hours.
[0045] ③Detection of inflammatory factors in cell supernatant The cell supernatant was collected by centrifugation in a low-temperature centrifuge at 4°C, 1000 rad / min, and 10 min. The ELISA kit and nitric oxide detection kit were used for detection according to the instructions to detect the IL-6 and NO contents in the collected cell supernatant.
[0046] The experimental results showed that the 6'-O-caffeoylarbutin group (Ujinin, CA) at 60μg / ml, 120μg / ml, and 140μg / ml was able to significantly downregulate the expression of NO and IL-6 in the LPS-induced RAW264.7 cell inflammation model, indicating that 6'-O-caffeoylarbutin has significant anti-inflammatory ability; in particular, the anti-inflammatory effect of the 6'-O-caffeoylarbutin group (Ujinin, CA) at 60μg / ml, 120μg / ml, and 140μg / ml was slightly better than that of dexamethasone as a whole, see Table 2.
[0047] Table 2: Effects of 6'-O-caffeoylarbutin on IL-6 and NO expression levels
[0048] Example 3: In vitro cell safety test (1) Test samples Test substances: 6'-O-caffeoylarbutin (Uruginin, CA) was provided by Yunnan Yunke Specialty Plant Extraction Laboratory Co., Ltd.; (2) Experimental materials, reagents and instruments DMEM high-glucose medium and fetal bovine serum were purchased from Gibco (USA); Keratinocytes were HaCaT cells purchased from ATCC.
[0049] (3) Test methods and steps ① In vitro cell culture HaCaT cells are human keratinocytes cultured in DMEM supplemented with 10 wt% fetal bovine serum (FBS), 100 U / ml penicillin, and 100 μg / ml streptomycin. The cells were cultured in 96-well plates at 37°C in a humidified incubator with 5% CO₂ for 24 hours.
[0050] ② CCK 8 assay was used to detect cell viability and proliferation ability Experimental Design: Cells in the blank control (Ctrl) group received no drug intervention. Cells in the experimental groups were treated with different concentrations of urogynoside solution (27.82 μg / ml, 55.63 μg / ml, 112.5 μg / ml, 225 μg / ml, 450 μg / ml, and 900 μg / ml) for 48 hours. Each well was treated with 10 μL of CCK8 solution and incubated for an additional 2 hours. Optical density (OD) was measured at 450 nm using a Multiskan Spectrum (Thermo Fisher Scientific). Data are presented as mean ± SD (n = 5). Experiments were repeated five times.
[0051] (4) Test results The test results showed that at concentrations of 6'-O-caffeoylarbutin of 27.82 μg / ml, 55.63 μg / ml, 112.5 μg / ml, 225 μg / ml, 450 μg / ml, and 900 μg / ml, the survival rate of HaCaT cells exceeded 80%, indicating that 6'-O-caffeoylarbutin had no cytotoxicity to HaCaT cells (i.e., 6'-O-caffeoylarbutin had no cytotoxicity to HaCaT cells at concentrations of 27.82 μg / ml to 900 μg / ml), see Table 3.
[0052] Table 3: Cytotoxicity assay of 6'-O-caffeoylarbutin
[0053] Example 4: Mouse atopic dermatitis model test (1) Experimental animals SPF-grade Balb / c mice, weighing 20-25 g and aged 7-8 weeks, were provided by Beijing Weitonglihua Experimental Animal Technology Co., Ltd., male, with free access to food, and housed in an SPF-grade animal room at a temperature of 20-26°C.
[0054] (2) Animal grouping Thirty-six Balb / c mice were randomly divided into 6 groups, with 6 mice in each group. The 6 groups were blank control group, model control group, experimental group A, experimental group B, experimental group C, and positive control group.
[0055] (3) Establishment of atopic dermatitis model in mice The day before modeling, mice were anesthetized with isoflurane and their backs were depilated with depilatory cream, covering an area of approximately 2 cm × 2 cm. From day 0 to day 13, 50 μL of a 90 μM MC903 solution was applied to the backs of the mice. The experiment was terminated on day 14, and samples were collected.
[0056] Mice in the blank control group were smeared with the same volume of vehicle (acetone: olive oil = 4:1) using the same method.
[0057] (4) Test drug, dosage and method of administration ① Test drugs: test group A (6'-O-caffeoylarbutin low-dose group), test group B (6'-O-caffeoylarbutin medium-dose group), test group C (6'-O-caffeoylarbutin high-dose group).
[0058] ② Dosage: The test drug solvent (acetone: olive oil = 4:1) of test groups AC was prepared into a solution with a concentration equivalent to 6 mg of the test drug solvent per ml; test group A was given 4.5 mg / kg of 6'-O-caffeoyl arbutin, test group B was given 9 mg / kg of 6'-O-caffeoyl arbutin, and test group C was given 18 mg / kg of 6'-O-caffeoyl arbutin.
[0059] ③Dosage method From day 0 to day 13, mice in the experimental group AC were treated by adding 60 μL of the test substance dropwise to evenly cover the modeling area 30 minutes before applying MC903. The test substance was then gently spread evenly with fingers. Mice in the blank control group and model control group were given the same volume of the excipient (acetone: olive oil = 4:1) in the same manner. The positive control drug dexamethasone was prepared with a solvent (acetone: olive oil = 4:1) to a concentration equivalent to 0.4 mg / ml. The dosage was 1.2 mg / kg based on the tolerance of mice to dexamethasone in the preliminary experiment, and was administered in the same way as the experimental groups AC.
[0060] (5) Test method ① Statistics of weight and spleen coefficient Weigh the animals daily from the start of the experiment until its completion. At the end of the experiment, dissect and remove the spleen, photograph it, weigh it, and calculate the spleen coefficient (spleen coefficient (‰) = spleen weight (mg) / mouse body weight (g).
[0061] ② Take photos The back skin of the mice was photographed on the 7th and 14th days.
[0062] ③Clinical scoring Evaluation was based on the clinical manifestation criteria: erythema, edema / papule, dryness / scaling, and lichenification, which were divided into four grades: none, mild, moderate, and severe, scored as 0, 1, 2, and 3 points respectively. The back skin of the animals was scored every day.
[0063] ④Itching evaluation After the last modeling and before the end of the experiment, mice were filmed from above using a camera, and video footage was collected for 30 minutes after modeling. The number and duration of scratching within 30 minutes after modeling were analyzed based on the video footage (scratching behavior: contact of the mouse's forelimb or hindlimb with the modeling site accompanied by obvious continuous scratching was counted as one instance).
[0064] (6) Data statistical analysis The general status and other data were analyzed descriptively. The experimental data were processed using Stata / IC 15.0 and Office 2010 software. The measurement data were expressed as mean ± standard deviation.
[0065] (7) Experimental results ① Effects of mouse body weight and body weight change rate After modeling, compared with the blank control group, the body weight of the mice in the model control group showed an overall downward trend, and the body weight and relative body weight gradually stabilized at a certain level after the 8th day; compared with the model control group, the body weight and relative body weight of the mice in the AC groups of the experimental groups increased significantly (p<0.05), and the body weight of the mice in the dexamethasone-treated group decreased significantly (p<0.05), see Table 4.
[0066] Table 4: Body weight statistics (g) (Mean±SEM, n=6)
[0067] ②Influence of mouse spleen coefficient At the end of the experiment, the spleen coefficient data showed that there was no significant change in the spleen coefficient of mice after MC903 modeling (p>0.05); compared with the model control group, there was no significant difference in the AC dose groups of the experimental groups (p>0.05), and the spleen coefficient of mice in the dexamethasone group was significantly reduced (p<0.05), see Table 5.
[0068] Table 5: Spleen coefficient statistics (Mean ± SEM, n = 6)
[0069] ③The effects of clinical scores, scratching frequency and scratching duration The clinical scoring results showed that three days after MC903 modeling, mice developed atopic dermatitis-like symptoms, including skin erythema, edema, and scaling, which continued to worsen. Compared with the model control group, the high-dose experimental group C and the dexamethasone positive control group were able to significantly alleviate the atopic dermatitis-like symptoms induced by MC903, and the clinical scores were significantly reduced (p<0.05).
[0070] Video data 30 minutes after the last modeling showed that compared with the blank control group, the mice in the model control group showed high-frequency scratching behavior (p<0.05); compared with the mice in the model control group, the number of scratching and the duration of scratching in the experimental group C high-dose group and the dexamethasone positive control group within 30 minutes were significantly reduced (p<0.05), and the efficacy of the experimental group AC was dose-dependent, see Table 6-7.
[0071] Table 6: Clinical score statistics (Mean ± SEM, n = 6)
[0072] Table 7: Statistics of scratching frequency and scratching duration (Mean ± SEM, n = 6)
[0073] Attachment Figure 1 The figures show pictures of the back skin of mice taken on the 7th and 14th days.
[0074] Results from a mouse atopic dermatitis model showed that MC903-induced atopic dermatitis in mice resulted in increased clinical scores and a significant increase in the frequency and duration of scratching. Furthermore, in experimental groups A and C, application of different doses of 6'-O-caffeoylarbutin (4.5 mg / kg, 9 mg / kg, and 18 mg / kg) to the dorsal skin of mice improved clinical scores, frequency, and duration of scratching to varying degrees. Experimental group C (high-dose 6'-O-caffeoylarbutin) significantly improved MC903-induced atopic dermatitis in mice.
[0075] Furthermore, the body weight and relative body weight of mice administered AC at all doses in the experimental groups significantly increased (p<0.05), while the body weight of mice in the dexamethasone-positive control group decreased significantly (p<0.05). Furthermore, at the endpoint of the study, spleen coefficient data showed no significant change in the spleen coefficient of mice after MC903 modeling (p>0.05). Compared with the model control group, there were no significant differences in the spleen coefficient between the experimental AC dose groups (p>0.05), while the spleen coefficient of mice in the dexamethasone-positive control group decreased significantly (p<0.05), demonstrating a good safety profile. These results suggest that 6'-O-caffeoylarbutin can be used as a therapeutic agent for atopic dermatitis.
[0076] Example 5: Skin irritation test of 6'-O-caffeoylarbutin (1) Test substances and experimental animals Test substance: Prepare a solution with 30% by volume of 1,3-butanediol to a concentration equivalent to 0.5 mg of 6'-O-caffeoylarbutin per ml for later use; Experimental animals: Four New Zealand standard-grade rabbits (females, non-pregnant and non-parous), weighing 2.0-3.0 kg, obtained from Pizhou Dongfang Breeding Co., Ltd., production license number: SCXK (Su) 2022-0004, quality certificate number: B202311300194c. Animals were acclimated to the appropriate environment of the experimental animal room for 3 days before the experiment.
[0077] (2) Test method: Approximately 24 hours before the test, the hair on both sides of the experimental animals' back spine was trimmed, avoiding damage to the epidermis. The hair removal area was 3 cm x 3 cm on each side. Approximately 0.5 ml of the test substance was applied directly to one side of the skin, covering an area of 2.5 cm x 2.5 cm. The other side was treated with 1,3-butanediol solvent as a control. This application was repeated once daily for 14 consecutive days. Starting on the second day, the fur was trimmed before each application, and the test substance was removed with water. The results were observed one hour later, and the skin reactions (erythema and edema) on the rabbits' backs were objectively scored. The skin lesion severity was categorized on a scale of 0-3: 0 (no lesions), 1 (mild lesions), 2 (moderate lesions), and 3 (severe lesions). The experimental data were summarized, and the control and test areas were treated identically.
[0078] (3) Test results: The average score for each animal per day was calculated according to the following formula.
[0079]
[0080] The test results show that the test substance has no skin irritation in multiple skin irritation tests on rabbits, see Table 8.
[0081] Table 8: Results of multiple skin irritation tests on rabbits
[0082] Example 6: 6'-O-caffeoylarbutin skin allergy test (1) Test substances and experimental animals Test substance: Prepare a solution with a concentration of 30% by volume of 1,3-butanediol to a concentration equivalent to 0.5 mg of 6'-O-caffeoylarbutin per ml for later use; Example 6: 6'-O-caffeoylarbutin skin allergy test (1) Test substances and experimental animals Test substance: Prepare a solution with a concentration of 30% by volume of 1,3-butanediol to a concentration equivalent to 0.5 mg of 6'-O-caffeoylarbutin per ml for later use; Positive substance: 2,4-dinitrochlorobenzene, batch number: BCCJ4545, manufacturer: SIGMA-ALDRICH, solvent: 80% ethanol solution by volume, induction concentration: 1.0wt%, excitation concentration: 0.5wt%, dosage: 0.2ml / each.
[0083] Experimental Animals: 50 non-pregnant, pre-parous female Dunkin Hartley guinea pigs (20 in the experimental group, 10 in the negative control group, and 20 in the positive control group) were used. Weight: 200-300g. Source: Pizhou Dongfang Breeding Co., Ltd. Laboratory Animal Production License Number: SCXK (Su) 2022-0004, Quality Certificate Number: NO. 202372043.
[0084] (2) Test method: ① Before the test, the animals were acclimated to the experimental animal room for 3 days and randomly divided into the test group and the control group. The skin allergy test was conducted on the test substance using the local occlusive coating method. About 24 hours before the test, the hair on the left side of the guinea pig's back was removed, and the hair removal range was 4 cm. 2 -6cm 2 .
[0085] ② Induced exposure: Apply 0.2 ml of the test substance to the hairless area on the left side of the experimental animal. Cover with two layers of gauze and one layer of cellophane, then seal with non-irritating tape for 6 hours. The negative control group is treated with the solvent and then similarly treated. The positive control group is treated with an inducing concentration of 2,4-dinitrochlorobenzene solution and then similarly treated. Repeat the same procedure on days 7 and 14.
[0086] ③ Provocative Exposure: 14 days after the last induction, apply 0.2 ml of the test substance to a 2 cm x 2 cm hairless area on the right side of the guinea pig (hair removed 24 hours prior to exposure). The area was then covered with two layers of gauze and one layer of cellophane and secured with non-irritating tape for 6 hours. A negative control group received the same treatment as the provocative exposure, while a positive control group received the same treatment after applying a provocative concentration of 2,4-dinitrochlorobenzene. Skin reactions were observed 24 and 48 hours after the provocative exposure, and objective scoring of skin reactions (erythema and edema) was performed. The skin lesion severity scale was categorized on a 0-3 scale: 0 (no lesions), 1 (mild lesions), 2 (moderate lesions), and 3 (severe lesions). Data were pooled and the control and test areas were treated identically. Animals in the test substance group were considered positive for skin allergy if their skin reaction score was 2 or greater.
[0087] (3) Test results The test results showed that the test substance did not cause skin allergic reaction on guinea pig skin, see Table 9-10.
[0088] Table 9: Results of the skin allergy test on guinea pigs (BT method) of the test substance (or positive drug)
[0089] Table 10: Results of the guinea pig skin allergy test of the test substance (or positive drug) (BT method)
[0090] Example 7 A liquid preparation containing 6'-O-caffeoylarbutin A preparation method for a liquid external-use medicine containing 6'-O-caffeoyl arbutin comprises the following steps: based on 1000 mL of a solvent system, the liquid comprises 1 g of 6'-O-caffeoyl arbutin, 800 mL of 95% by volume ethanol, 20 mL of glycerol, and 180 mL of purified water; the mixture is stirred evenly and packaged into 10 mL bottles, yielding 100 bottles. Example
[0091] A cream containing 6'-O-caffeoylarbutin A preparation method for a 6'-O-caffeoyl arbutin-containing cream comprises the following steps: (a) 1.5 g of 6'-O-caffeoyl arbutin, 15 mL of a 30% by volume 1,3-butanediol solution, and 15 mL of glycerol are mixed evenly, ultrasonicated for 15-60 minutes, and after dissolution, 0.05 mL of a 50% by volume benzalkonium chloride ethanol solution is added and mixed evenly to obtain a drug solution for later use; (b) 2 g of carbomer is weighed and added to 10 mL of purified water, and the solution is allowed to swell naturally, followed by the addition of 3 g of triethanolamine with stirring to form a transparent colloidal liquid, and then the reserved drug solution is added with stirring, and purified water is added to 50 g of the solution, and the solution is mixed evenly to obtain a finished cream. Example
[0092] A gel containing 6'-O-caffeoylarbutin A gel containing 6'-O-caffeoyl arbutin is prepared by weighing 20 g of carbomer, adding it to 300 mL of purified water, and allowing it to fully swell. 50 g of triethanolamine is then added while stirring to form a gel base. Separately, 50 g of 6'-O-caffeoyl arbutin and 2 g of ethyl hydroxybenzoate are dissolved in 30 g of propylene glycol and 400 mL of ethanol. The mixture is then added to the gel base while stirring. 50 g of glycerin is then added, and purified water is added to bring the total to 1000 g. The mixture is then stirred and packaged into 100 bottles of 10 g each. Example
[0093] A soothing and anti-inflammatory moisturizer containing 6'-O-caffeoyl arbutin cosmetics Preparation of a soothing and anti-inflammatory moisturizing cream containing 6'-O-caffeoyl arbutin, weighing 20g of cetearyl alcohol, Add 20g of squalane and 10g of polydimethylsiloxane to the oil phase pot, stir and heat to 80°C; at the same time, weigh 1g of sodium hyaluronate, 5g of sodium acrylate copolymer, and 60g of glycerin and add them to the water phase pot, add deionized water to 930g, mix well, and stir and heat to 80°C; the materials in the water phase pot and the oil phase pot are vacuum pumped into the emulsification pot, homogenized for 10 minutes, cooled to 40°C, added 50g of 6'-O-caffeoylarbutin, mixed well, and packaged into 20 bottles of 50g each.
[0094] Example 11: Clinical Trial Twelve patients aged 2-5 years who were diagnosed with atopic dermatitis in the hospital were selected from September to October 2024. The main symptoms were rash, erythema and scratching. The present invention uses the cream containing 6'-O-caffeoyl arbutin in Example 8 for treatment. The treatment method is to apply it to the affected area every morning, noon and evening. The treatment is divided into an experimental group of 6 cases and a control group of 6 cases. All of them are added with the cream containing 6'-O-caffeoyl arbutin of the present invention (experimental group) or a blank solvent 1,3-butanediol solution (control group) on the basis of normal medication in the hospital (topical hormone ointment). The results showed that the rash, erythema and scratching of the 6 cases in the experimental group were significantly improved after 5 days of medication, which was significantly different from that of the control group. Among them, taking the cream as an example, the statistical diagram of the efficacy of its clinical trial observation is shown in Table 11: Table 11: Clinical trial efficacy statistics
[0095] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.
Claims
1. Use of 6'-O-caffeoylarbutin in the preparation of a product for preventing and / or treating atopic dermatitis.
2. The use of 6'-O-caffeoylarbutin according to claim 1 in preparing a product for preventing and / or treating atopic dermatitis, characterized in that: The weight percentage of the 6'-O-caffeoylarbutin in the product for preventing and / or treating atopic dermatitis ranges from 0.1% to 5%.
3. The use of 6'-O-caffeoylarbutin according to claim 1 in preparing a product for preventing and / or treating atopic dermatitis, characterized in that: The 6'-O-caffeoylarbutin is prepared by natural plant extraction, chemical synthesis or chemical semi-synthesis.
4. Use of 6'-O-caffeoylarbutin according to any one of claims 1 to 3 in preparing a product for preventing and / or treating atopic dermatitis, characterized in that: The product for preventing and / or treating atopic dermatitis further comprises pharmaceutically acceptable excipients.
5. Use of 6'-O-caffeoylarbutin according to any one of claims 1 to 3 in preparing a product for preventing and / or treating atopic dermatitis, characterized in that: The pharmaceutically acceptable excipients include carriers.
6. A pharmaceutical preparation, characterized in that The active ingredient in the pharmaceutical preparation is 6'-O-caffeoylarbutin, and the pharmaceutical preparation is an oral preparation, an external preparation or an injection preparation.
7. The pharmaceutical preparation according to claim 6, characterized in that The oral preparation is selected from any one of hard capsules, dripping pills, granules, tablets, mixtures, soft capsules or concentrated pills.
8. The pharmaceutical preparation according to claim 6, characterized in that The external preparation is selected from any one of a paste, a patch, a powder, a tincture, an ointment, a gel, a liniment, a lotion, a soluble microneedle, a spray or a foam.
9. The pharmaceutical preparation according to claim 6, characterized in that The injection preparation is selected from injection solution or lyophilized powder injection.
10. A cosmetic, characterized in that: The active ingredient in the cosmetic is 6'-O-caffeoylarbutin, and the cosmetic type is selected from essence, cream, gel, emulsion, and soluble microneedle patch.
Citation Information
Patent Citations
Application of vaccinium dunalianum wight or extract thereof in preparation of medicines or health products for preventing and treating acute liver injury
CN111939190A
Vaccinium dunalianum extract for treating hyperuricemia and related diseases as well as preparation method, preparation and application of the extract
CN113499357A