T4-protein-based trimer vaccine platform and application thereof

Abstract

The present application provides a vaccine comprising: 1) a peptide oligomer consisting of 2-8 copies of a bacteriophage T4 fibrin C-terminal polypeptide and one or more antigen proteins; or 2) a coding nucleic acid of item 1) wherein 2-8 copies of the bacteriophage T4 fibrin C-terminal polypeptides in the peptide oligomer are directly linked in series through chemical bonds or each of the bacteriophage T4 fibrin C-terminal polypeptides is linked to each other through a peptide linker, and the peptide oligomer and the antigen protein are directly connected through a chemical bond or connected through a peptide linker. In the bi-T4-virus antigen vaccine platform provided by the invention, the antigen can be subjected to multi-component change, that is, the antigen can form a trimer, so that the use flexibility of the vaccine platform is enhanced, the application range of the vaccine platform is widened, and the bi-T4 structure can enhance the formation of trimer protein and enhance the immune aging.

Description

Technical Field

[0001] The present application relates to the fields of genetic engineering and biomedical technology, and specifically to a T4-protein-based trimer vaccine platform and its application. Background Art

[0002] Vaccines worldwide are primarily based on inactivated or attenuated pathogens, recombinant protein vaccines, and nucleic acid vaccines. Due to the long production cycles of traditional vaccines, they are unable to respond quickly to the emergence of major infectious diseases or produce vaccines that can induce strong antibodies and immune responses. After 30 years of development, mRNA vaccines are more effective and adaptable than traditional vaccines. Their rapid expression of antigens in the body, which in turn triggers a rapid immune response, has led to their widespread application.

[0003] Influenza virus surface glycoproteins include hemagglutinin (HA), neuraminidase (NA) and membrane protein (M2). HA is the main surface glycoprotein of influenza (80%), and the trimer it forms contains receptor binding sites and neutralizing antibody recognition epitopes, followed by tetrameric NA (17%) and M2 (16-20 molecules / virion). HA protein exists in the form of a trimer on the surface of influenza virus, and mimicking this natural structure helps to induce a stronger and broader immune response. The stable trimeric structure can effectively display complete and correct antigenic epitopes, which are key to the recognition and binding of neutralizing antibodies. The correct antigenic epitope display can improve the immunogenicity of the vaccine and can be presented to the immune system more effectively, thereby better inducing T cell and B cell responses, forming a more lasting and broad-spectrum immune memory, and helping to develop influenza vaccines with broad-spectrum protective efficacy. The stable trimeric structure also helps to maintain the efficacy of the vaccine during storage and transportation, preventing protein degradation or denaturation, thereby ensuring the long-term stability of the vaccine.

[0004] T4 Foldon can spontaneously form a stable trimeric structure. When fused to target proteins, it can promote the trimerization of these proteins, thereby improving their stability and immunogenicity. This property is particularly suitable for antigens that require multivalent display, such as influenza virus hemagglutinin (HA), RSV-F protein, and coronavirus spike protein (S protein). Kanekiyo et al. (2013) used T4 Foldon to develop a self-assembling HA nanoparticle influenza vaccine. Through self-assembly, multiple HA trimers are displayed on the surface of the nanoparticle, significantly enhancing the immunogenicity of the antigen. In influenza vaccine development, T4 Foldon is used to promote the trimerization of HA protein. The HA trimer form is closer to the natural structure of the virus and can more effectively induce neutralizing antibodies.

[0005] As a new subtype of vaccine, mRNA vaccines are fast to develop; protein vaccines are easy to manufacture, low-cost, and do not require freezing or refrigeration. Currently, no vaccine or vaccine structure on the market combines the advantages of both mRNA and protein vaccines. Summary of the Invention

[0006] In view of the existing technology, the purpose of this application is to provide a vaccine characterized by a stable trimer of T4 polypeptide. By changing the antigen components it carries, it can form both trimer antigens and mRNA to express antigens, thereby enhancing the flexibility and scope of application of the vaccine.

[0007] The specific implementation methods of this application are as follows:

[0008] 1. A vaccine comprising:

[0009] 1) a peptide oligomer consisting of 2-8 copies of the bacteriophage T4 fiber protein C-terminal polypeptide and one or more antigenic proteins; or

[0010] 2) the encoding nucleic acid of item 1),

[0011] In which, 2-8 copies of the phage T4 fiber protein C-terminal polypeptide in the peptide oligomer are directly connected in series through a chemical bond or each phage T4 fiber protein C-terminal polypeptide is connected to each other through a peptide linker, and the peptide oligomer and the antigen protein are directly connected through a chemical bond or through a peptide linker.

[0012] 2. The vaccine according to claim 1, wherein the N-terminus of the peptide oligomer is linked to the C-terminus of the antigen protein.

[0013] 3. The vaccine according to item 1 or 2, wherein the C-terminus of the peptide oligomer is linked to the N-terminus of the antigen protein.

[0014] 4. The vaccine according to any one of items 1 to 3, wherein the antigen protein is a viral antigen protein or a bacterial antigen protein having a trimer spatial structure in its natural state. Optionally, the antigen protein is one or more selected from the following: SARS-CoV-2 Spike protein, influenza virus HA protein or its functional fragment or functional derivative.

[0015] 5. The vaccine according to any one of items 1 to 4, comprising one or more of the following amino acid sequences or nucleotide sequences, wherein the amino acid sequence or nucleotide sequence comprises the sequence shown in SEQ ID NO. 1-62,

[0016] Or comprising an amino acid sequence or nucleotide sequence that has at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the amino acid sequence or nucleotide sequence over its entire length.

[0017] 6. The vaccine according to any one of items 1 to 5, wherein the peptide linker is a rigid peptide linker or a flexible peptide linker; preferably, the peptide linker is (EAAAK) n 、(G) n , (GS) n 、(XP) n 、(GGGGS) n or (GSA) n , wherein n is any positive integer between 1-20, 1-15, 1-10, 1-5, or 1-3; more preferably, the peptide linker is selected from one or more of GS, EAAAK, EAAAKEAAAK, PA, GSAGSA, GGASAGG.

[0018] 7. The vaccine according to any one of items 1 to 6 further comprises an adjuvant, wherein the adjuvant is an inorganic adjuvant, an organic adjuvant, an oil-based adjuvant, a cytokine, a particulate adjuvant, a virion, a bacterial adjuvant, a synthetic adjuvant, a synthetic polynucleotide adjuvant and an immunostimulatory oligonucleotide containing unmethylated CpG dinucleotides.

[0019] 8. A fusion protein comprising 2-8 copies of a bacteriophage T4 fiber protein C-terminal polypeptide and one or more antigenic proteins, wherein the 2-8 copies of the bacteriophage T4 fiber protein C-terminal polypeptide are directly connected in series via a chemical bond or each bacteriophage T4 fiber protein C-terminal polypeptide is connected to each other via a peptide linker, and the C-terminal polypeptide and the antigenic protein are directly connected via a chemical bond or via a peptide linker.

[0020] 9. The fusion protein according to item 8, wherein the N-terminus of the bacteriophage T4 fiber protein C-terminal polypeptide is linked to the C-terminus of the antigen protein.

[0021] 10. The fusion protein according to any one of items 8 to 9, wherein the C-terminus of the bacteriophage T4 fiber protein C-terminal polypeptide is linked to the N-terminus of the antigen protein.

[0022] 11. The fusion protein according to any one of items 8 to 10, wherein the antigen protein is a viral antigen protein or a bacterial antigen protein having a trimer spatial structure in its natural state, and optionally, the antigen protein is one or more selected from the following: SARS-CoV-2 Spike protein, influenza virus HA protein or its functional fragment or functional derivative.

[0023] 12. The fusion protein according to any one of items 8 to 11, comprising one or more of the following amino acid sequences: the amino acid sequence comprises the sequence shown in SEQ ID NO. 1-57,

[0024] Or comprising an amino acid sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the entire length of the amino acid sequence.

[0025] 13. The fusion protein according to any one of items 8 to 12, wherein the peptide linker is a rigid peptide linker or a flexible peptide linker; preferably, the peptide linker is (EAAAK) n 、(G) n , (GS) n 、(XP) n 、(GGGGS) n or (GSA) n , wherein n is any positive integer between 1-20, 1-15, 1-10, 1-5, or 1-3; more preferably, the peptide linker is one or more selected from GS, EAAAK, EAAAKEAAAK, PA, GSAGSA, GGASAGG.

[0026] 14. A nucleic acid encoding the fusion protein of any one of items 8-13, optionally comprising a nucleotide sequence selected from any one of the following: SEQ ID NO. 58-62, or a nucleotide sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0027] 15. A vector comprising the nucleic acid according to item 14.

[0028] 16. A host cell comprising the nucleic acid of item 14 or the vector of item 15.

[0029] 17. A pharmaceutical composition comprising the vaccine of any one of items 1 to 7, the fusion protein of any one of items 8 to 13, the nucleic acid of item 14, the vector of item 15, and a pharmaceutically acceptable carrier or excipient.

[0030] 18. A peptide oligomer composed of 2-8 copies of a bacteriophage T4 fibrin C-terminal polypeptide, wherein the 2-8 copies of the bacteriophage T4 fibrin C-terminal polypeptide are directly linked in series by a chemical bond or each bacteriophage T4 fibrin C-terminal polypeptide is linked to each other by a peptide linker. Optionally, the peptide oligomer comprises 2-8 copies of the amino acid sequence shown in SEQ ID NO. 63, or comprises 2-8 copies of an amino acid sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence shown in SEQ ID NO. 63.

[0031] 19. The peptide oligomer according to item 18, comprising any one or more amino acid sequences selected from SEQ ID NO. 64-103, or an amino acid sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0032] 20. Use of the peptide oligomer described in item 18 or 19 for promoting an immune response to an antigen protein in a subject, preferably, the subject is a mammal, more preferably, the subject is a human.

[0033] 21. The use according to item 20, wherein the antigen protein is a viral antigen protein or a bacterial antigen protein having a trimer spatial structure in its natural state, and optionally, the antigen protein is one or more selected from the following: SARS-CoV-2 Spike protein, influenza virus HA protein or its functional fragment or functional derivative.

[0034] 22. The use according to item 21 or 22, wherein the peptide linker is a rigid peptide linker, a flexible peptide linker or other types of peptide linkers; preferably, the peptide linker is (EAAAK) n 、(G) n , (GS) n 、(XP) n 、(GGGGS) n or (GSA) n , wherein n is any positive integer between 1-20, 1-15, 1-10, 1-5, or 1-3; more preferably, the peptide linker is one or more selected from GS, EAAAK, EAAAKEAAAK, PA, GSAGSA, GGASAGG.

[0035] 23. An immunogenic polypeptide comprising the peptide oligomer of item 18 or 19 and one or more antigenic proteins, optionally, the antigenic protein is a viral antigenic protein or a bacterial antigenic protein having a trimer spatial structure in its natural state, optionally, the antigen is the SARS-CoV-2 Spike protein, the influenza virus HA protein or a functional fragment or functional derivative thereof.

[0036] 24. The immunogenic polypeptide according to item 25, comprising one or more amino acid sequences selected from SEQ ID NO. 1-57,

[0037] Or comprising an amino acid sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the amino acid sequence.

[0038] 25. A method for preventing or treating a disease, comprising administering to a subject an effective amount of the vaccine described in any one of items 1-7, the fusion protein described in any one of items 8-13, the nucleic acid described in item 14, the vector described in item 15, the pharmaceutical composition described in item 17, the peptide oligomer described in item 18 or 19, or the immunogenic polypeptide described in item 23 or 24, optionally, the disease comprises a viral infection or a bacterial infection, optionally, the viral infection comprises a new coronavirus or influenza virus infection.

[0039] Beneficial effects of this application:

[0040] In the dual T4-virus antigen vaccine platform provided in the present application, the antigens can be changed into multiple components, that is, they can form trimers, which enhances the flexibility and scope of application of the vaccine platform.

[0041] The dual T4 vaccine platform provided in this application has a dual T4 structure that can enhance the formation of trimeric proteins and increase the duration of immunity;

[0042] The dual T4 vaccine platform provided in this application is expressed in eukaryotic HEK293F cells. The protein expressed by HEK293F cells is closer to the natural protein molecule in terms of molecular structure, physicochemical characteristics, and biological function, with a higher proportion of trimers.

[0043] The vaccine platform provided in this application can be used not only as an mRNA vaccine, but also as a trimeric protein vaccine or other uses;

[0044] The vaccine platform provided in this application can be used directly as a structural unit of a vaccine or as part of other polymer structures. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1Schematic diagram of Western blot detection of supernatant and cell lysate after transfection of 293F cells with mRNA encoding influenza virus HA protein of different structures.

[0046] in, Figure 1 A is Western analysis of the supernatant of 293F cells transfected with MF-9, MF-11, and MF-12 mRNA;

[0047] Figure 1 B is Western analysis of 293F cell lysates transfected with MF-9, MF-11 and MF-12 mRNA.

[0048] Figure 2 Schematic diagram of the immune response of mRNA vaccines encoding influenza virus HA proteins with different structures in Balb / c female mice, where: Figure 2 A is a Balb / c female mouse immunized with MF-9, MF-11, and MF-12 mRNA-LNPs on D0 and D14 at 3 μg / mouse. The anti-HA antibody levels in the serum of the mice immunized on D14, 21, 28, and 35 were detected by ELISA. Figure 2 B is the hemagglutination blocking test (HAI) to detect the antibody titers of sera from immunized mice D21, 28 and 36; Figure 2 C: Balb / c female mice were intramuscularly immunized with MF-9, MF-11, and MF-12 mRNA-LNPs at D0 and D14, 1 μg / mouse. The HA-specific antibody levels in the serum were detected by ELISA at the designated times.

[0049] Figure 3 Schematic diagram of antibody response to mRNA vaccines encoding influenza virus HA proteins with different structures. Figure 3 A: Balb / c female mice were immunized intramuscularly with mRNA-LNPs of different structures at D0 and D14, 3 μg / mouse, and the serum antibody levels of the immunized mice were measured on D21 and D28 by ELISA. Figure 3 B: Balb / c female mice were immunized with mRNA-LNPs of different structures by intramuscular immunization on D0 and D14, 3 μg / mouse, and the HAI titer in serum was detected by HAI method on D28.

[0050] Figure 4 A is a schematic diagram of Balb / c female mice immunized intramuscularly with mRNA-LNPs of different structures at 3 μg / mouse on D0 and D14, and the hemagglutination assay (HAI) was used to detect the serum antibody titer of the immunized mice on D35; Figure 4B is a schematic diagram of Balb / c female mice inoculated with mRNA-LNPs of different structures at 3 μg / mouse on D0 and D14 through intramuscular immunization, and the MN method was used to detect the level of HA-specific neutralizing antibodies in the serum on D35.

[0051] Figure 5 Schematic diagram of the antibody response of mRNA vaccines encoding different structures of influenza virus HA proteins in Balb / c female mice. Figure 5 A: Balb / c female mice were immunized intramuscularly with MF-9, MF-12, MF-32, and MF-33 mRNA-LNPs at 3 μg / mouse on D0 and D14. The anti-HA antibody levels in the sera of the immunized mice on D21 and D28 were measured by ELISA. Figure 5 B is the hemagglutination blocking test (HAI) to detect the antibody titer of the serum of immunized mice D28.

[0052] Figure 6 Balb / c female mice were immunized intramuscularly with mRNA-LNPs of different structures at 3 μg / mouse on D0. The serum antibody titers of the immunized mice on D21 were measured by hemagglutination assay (HAI).

[0053] Figure 7 Antibody responses of mRNA vaccines encoding different structures of influenza virus HA proteins in Balb / c female mice. Figure 7 A: Balb / c female mice were intramuscularly immunized with mRNA-LNPs of different structures at D0 and D14, 3 μg / mouse, and the HA-specific antibody level in the serum was detected by HAI method at D35. Figure 7 B: The HA-specific neutralizing antibody level in serum was detected using the MN method at time point D35.

[0054] Figure 8 Antibody responses to mRNA vaccines encoding influenza virus HA proteins with different structures. Figure 8 A: Balb / c female mice were immunized intramuscularly with MF-18 and MF-45 mRNA-LNPs at 3 μg / mouse on D0 and D14. The serum antibody titers of the immunized mice were measured by hemagglutination assay (HAI) on D14, D21, and D35. Figure 8 B: Balb / c female mice were immunized intramuscularly with MF-18 and MF-46 mRNA-LNPs at 3 μg / mouse on D0 and D14. The serum antibody titers of the immunized mice were measured by hemagglutination assay (HAI) on D14, D21, D28, and D35. Figure 8C: Balb / c female mice were immunized intramuscularly with MF-18, MF-45, and MF-46 mRNA-LNPs at 3 μg / mouse on D0 and D14. The HA-specific neutralizing antibody level in the serum was detected by the MN method on D35.

[0055] Figure 9 A: Balb / c female mice were immunized intramuscularly with MF-9, MF-12, MF-15, and MF-34 mRNA-LNPs at 3 μg / mouse on D0 and D14. The anti-HA antibody levels in the sera of the immunized mice on D21 and D28 were measured by ELISA. Figure 9 B is the hemagglutination blocking test (HAI) to detect the antibody titer of the serum of immunized mice D28.

[0056] Figure 10 Antibody responses of mRNA vaccines encoding different structures of influenza virus HA proteins in Balb / c female mice. Figure 10 A: Balb / c female mice were immunized intramuscularly with MF-15, MF-35, and MF-37 mRNA-LNPs at 3 μg / mouse on D0. The anti-HA antibody levels in the sera of the immunized mice were measured by ELISA on D21. Figure 10 B is the hemagglutination blocking test (HAI) to detect the serum antibody titer of immunized mouse D21.

[0057] Figure 11 Schematic diagram of antigen expression in 293F cells of mRNA vaccines encoding influenza virus HA proteins with different structures; 293F cells were transfected with mRNA of MF-9, MF-12, MF-31, MF-32, MF-33, MF-15, MF-34, MF-35 and MF-37, and the supernatant was analyzed by non-reducing Western blot.

[0058] Figure 12 Antibody responses to mRNA vaccines encoding different structures of influenza virus HA proteins were evaluated. Female Balb / c mice were intramuscularly immunized with mRNA-LNPs of different structures at 3 μg / mouse on days 0 and 14. Serum antibody titers were measured on days 14, 21, and 28 of immunization using a hemagglutination assay (HAI).

[0059] Figure 13 Antibody responses to mRNA vaccines encoding structurally distinct influenza virus HA proteins.

[0060] in, Figure 13 A: Balb / c female mice were immunized intramuscularly with mRNA-LNPs of different structures at 0.3 μg / mouse on D0, and the HA-specific antibody levels in the serum were detected by HAI method on D28, D47, D63 and D75; Figure 13B: Balb / c female mice were intramuscularly immunized with mRNA-LNPs of different structures at 3 μg / mouse on D0, and the HA-specific antibody levels in the serum were detected by HAI method on D28, D47, D63 and D75; Figure 13 C shows Balb / c female mice immunized intramuscularly with mRNA-LNPs of different structures at 0.3 or 3 μg / mouse on D0. The HA-specific neutralizing antibody level in the serum was detected by the MN method on D28.

[0061] Figure 14 Schematic diagram of the antibody response to mRNA vaccines with different structures.

[0062] Balb / c female mice were immunized intramuscularly with mRNA-LNPs of different structures at 1 μg / mouse or 3 μg / mouse on D0. The serum antibody titers of the immunized mice were measured on D14, 21, 42 and 67 by hemagglutination assay (HAI).

[0063] Figure 15 Antibody responses to mRNA vaccines encoding influenza virus HA proteins with different structures. Figure 15 A: Balb / c female mice were immunized intramuscularly with mRNA-LNPs of different structures at D0 and D14, 3 μg / mouse. The serum antibody titers of the immunized mice at D14, 21, 28 and 105 were detected by hemagglutination assay (HAI). Figure 15 B: Balb / c female mice were intramuscularly immunized with mRNA-LNPs of different structures at 3 μg / mouse on D0 and D14, and the HA-specific neutralizing antibody level in the serum was detected by the MN method on D21.

[0064] Figure 16 Antibody responses to mRNA vaccines encoding influenza virus HA proteins with different structures. Figure 16 A: Balb / c female mice were immunized intramuscularly with mRNA-LNPs of different structures at D0 and D14, 3 μg / mouse, and the serum antibody titers of the immunized mice were measured by hemagglutination assay (HAI) on D35. Figure 16 B: Balb / c female mice were immunized intramuscularly with mRNA-LNPs of different structures at 3 μg / mouse on D0 and D14, and the HA-specific neutralizing antibody level in the serum was detected by the MN method on D35.

[0065] Figure 17 Antibody responses of mRNA vaccines encoding different structures of influenza virus HA proteins in Balb / c female mice. Figure 17A: Balb / c female mice were immunized intramuscularly with mRNA-LNPs of different structures at 3 μg / mouse on D0 and D14. The HA-specific antibody levels in the serum were detected by HAI method on D21, D28 and D35. Figure 17 B shows Balb / c female mice immunized intramuscularly with mRNA-LNPs of different structures at 3 μg / mouse on D0. The serum antibody titers of the immunized mice on D21, 28, 35 and 63 were detected by hemagglutination assay (HAI).

[0066] Figure 18 Antibody responses to mRNA vaccines encoding SARS-CoV-2 SPIKE proteins of different structures. Figure 18 A: Balb / c female mice were immunized intramuscularly with mRNA-LNPs of different structures at 3 μg / mouse on D0, and the serum antibody levels of the immunized mice were measured by ELISA on D15. Figure 18 B: Balb / c female mice were immunized intramuscularly with mRNA-LNPs of different structures at 3 μg / mouse on D0, and the serum antibody levels of the immunized mice were measured on D21 and D61 by ELISA. Figure 18 C: Balb / c female mice were immunized intramuscularly with mRNA-LNPs of different structures at 3 μg / mouse on D0, and the serum antibody levels of the immunized mice were measured by ELISA on D74. Figure 18 D is Balb / c female mice immunized intramuscularly with mRNA-LNPs of different structures at 3 μg / mouse on D0, and the neutralizing antibody level in the serum of immunized mice on D74 was detected by pseudovirus neutralization experiment.

[0067] Figure 19 Antibody responses to mRNA vaccines encoding structurally distinct influenza virus HA proteins.

[0068] Balb / c female mice were immunized intramuscularly with MF-18, MF-22, and MF-39 mRNA-LNPs at 3 μg / mouse on D0. The serum antibody titers of the immunized mice were measured by hemagglutination assay (HAI) on D14, 20, 28, 35, 63, 79, 118, and 190.

[0069] Figure 20 Antibody responses to mRNA vaccines encoding structurally distinct influenza virus HA proteins.

[0070] in, Figure 20 A: Balb / c female mice were immunized intramuscularly with mRNA-LNPs of different structures at 0.3 μg / mouse on D0, and the HA-specific antibody levels in the serum were detected by HAI method on D14, D28, D42 and D89; Figure 20B: Balb / c female mice were intramuscularly immunized with mRNA-LNPs of different structures at 3 μg / mouse on D0, and the HA-specific antibody levels in the serum were detected by HAI method on D14, D28, D42 and D89.

[0071] Figure 21 Antibody responses to mRNA vaccines encoding influenza virus HA proteins with different structures. Figure 21 A: Balb / c female mice were immunized intramuscularly with mRNA-LNPs of different structures at 0.3 or 3 μg / mouse on D0, and the serum antibody levels of the immunized mice were measured by ELISA on D21; Figure 21 B: Balb / c female mice were immunized intramuscularly with mRNA-LNPs of different structures at 0.3 μg / mouse on D0, and the serum antibody titers of the immunized mice on D15 and D21 were measured by hemagglutination assay (HAI); Figure 21 C is Balb / c female mice immunized intramuscularly with mRNA-LNPs of different structures at 3 μg / mouse on D0, and the serum antibody titers of the immunized mice on D15 and D21 were measured by hemagglutination assay (HAI); Figure 21 D is Balb / c female mice immunized intramuscularly with mRNA-LNPs of different structures at 0.3 or 3 μg / mouse on D0, and the serum antibody levels of immunized mice on D116 were detected by ELISA; Figure 21 E shows Balb / c female mice immunized intramuscularly with mRNA-LNPs of different structures at 0.3 μg / mouse or 3 μg / mouse on D0. The serum antibody titers of the immunized mice on D116 were detected by hemagglutination assay (HAI).

[0072] Figure 22 Antibody responses to mRNA vaccines encoding influenza virus HA proteins with different structures. Figure 22 A: Balb / c female mice were immunized intramuscularly with mRNA-LNPs of different structures at 3 μg / mouse on D0, and the serum antibody levels of the immunized mice were measured on D21 and D28 by ELISA. Figure 22 B is Balb / c female mice immunized with mRNA-LNP of different structures on D0 at 3 μg / mouse by intramuscular immunization. The serum antibody titers of the immunized mice on D21 and D28 were detected by hemagglutination inhibition assay (HAI).

[0073] Figure 23 To investigate the antibody response to different doses of MF-18 mRNA vaccines, Balb / c female mice were intramuscularly immunized with MF-18 (10 μg / mouse), MF-15 (10 μg / mouse), and MF-18 (3 μg / mouse) mRNA-LNPs on D0. The serum antibody titers of the immunized mice were detected by hemagglutination inhibition assay (HAI) on D21, 28, 35, 123, and 182.

[0074] Figure 24 The protection of Balb / c female mice against influenza virus HA protein after immunization with mRNA vaccines encoding different structures of influenza virus HA protein. Figure 24 A: Balb / c female mice were immunized intramuscularly with mRNA-LNPs of different structures at 2 μg / mouse on D0, and the serum antibody titers of the immunized mice on D19 were measured by hemagglutination assay (HAI); Figure 24 B shows the weight changes of mice after receiving a lethal dose of H1N1 A / PuertoRico / 8 / 1934 challenge; Figure 24 C is the survival rate of immunized mice after receiving a lethal dose of H1N1 A / Puerto Rico / 8 / 1934 virus.

[0075] Figure 25 The protection of Balb / c female mice against influenza virus HA protein after immunization with mRNA vaccines encoding different structures of influenza virus HA protein. Figure 25 A shows the body weight changes of Balb / c female mice after intramuscular immunization with different structures of mRNA-LNP at 1 μg / mouse or 0.25 μg / mouse on D0 and challenge with a lethal dose of H1N1A / Puerto Rico / 8 / 1934 on D19. Figure 25 B is the survival rate of immunized mice after receiving a lethal dose of H1N1 A / Puerto Rico / 8 / 1934 virus.

[0076] Figure 26 To evaluate the antibody response to different doses of MF-18 mRNA vaccine and HA trimer protein, Balb / c female mice were immunized intramuscularly with MF-18 (2 μg / mouse), MF-18 (1 μg / mouse) mRNA-LNP, and HA trimer protein (5 μg / mouse) with aluminum adjuvant on D0. Figure 26 A is the ELISA test of serum antibody levels in immunized mice D15 (serum diluted 1:1000) and D21 (1:10000); Figure 26 B. Hemagglutination inhibition test (HAI) was used to detect the antibody titer of the sera of immunized mice D15 and 21. DETAILED DESCRIPTION

[0077] The following description of exemplary embodiments of the present application includes various details of the embodiments of the present application to facilitate understanding, and should be considered as merely exemplary. Therefore, those skilled in the art will recognize that various changes and modifications may be made to the embodiments described herein without departing from the scope and spirit of the present application. Similarly, for the sake of clarity and conciseness, descriptions of well-known functions and structures are omitted in the following description.

[0078] It should be noted that certain words are used in the specification and claims to refer to specific components. Those skilled in the art should understand that technicians may use different nouns to refer to the same component. This specification and claims do not use the difference in nouns as a way to distinguish components, but use the difference in the functions of the components as the criterion for distinction. As mentioned throughout the specification and claims, "including" or "comprising" are open-ended terms and should be interpreted as "including but not limited to". The subsequent description of the specification is a preferred embodiment of the present application, but the description is based on the general principles of the specification and is not intended to limit the scope of the present application. The scope of protection of this application shall be as defined by the attached claims.

[0079] The present application provides a vaccine, which comprises 1) a peptide oligomer composed of 2-8 copies of the bacteriophage T4 fiber protein C-terminal polypeptide and one or more antigenic proteins, or 2) the nucleic acid of item 1), wherein the 2-8 copies of the bacteriophage T4 fiber protein C-terminal polypeptide in the peptide oligomer are directly connected in series by a chemical bond or each bacteriophage T4 fiber protein C-terminal polypeptide is connected to each other by a peptide linker, and the peptide oligomer and the antigenic protein are directly connected by a chemical bond or connected by a peptide linker.

[0080] Throughout this application, the terms "bacteriophage T4 minor fibritin," "T4 fibritin," and "T4 polypeptide" are used interchangeably to refer to a fibrin protein found in the tail of bacteriophage T4. The T4 fibritin-trimerization domain, also known as the Foldon domain, is an amino acid sequence at the C-terminus of the T4 minor fibritin. This region plays an important role in the trimerization and folding of the fibritin. Its native structure consists of a trimeric β-hairpin propeller containing 27 amino acids (GYIPEAPRDGQAYVRKDGEWVLLSTFL (SEQ ID NO.63)), composed of an extended N-terminal region (G1-Q11), a β-hairpin (A12-L23) and a C-terminal helix (L23-L27); the extended N-terminal region contains the P4 and P7 polyproline II helices, and V14-V21 and K16-E19 in the β-hairpin form hydrogen bonds and stabilize the hairpin structure through hydrophobic interactions between the N-terminus (A12-V14) and C-terminus (V21-L23) and diagonal interactions between Y13 and W20; a stable trimer is formed by establishing a salt bridge between E5 and R15 and hydrogen bonds between Y13 and R15 subunits.

[0081] In the present application, the trimer structure formed by the C-terminus of T4 fibrin refers to the trimer structure formed by the 27 amino acids at the C-terminus of T4 fibrin as described in the above paragraph.

[0082] In one embodiment, the vaccine comprises 1 to 16 copies of the bacteriophage T4 fibrin C-terminal polypeptide, preferably 2 to 8 copies of the bacteriophage T4 fibrin C-terminal polypeptide, more preferably 2 to 4 copies of the bacteriophage T4 fibrin C-terminal polypeptide, and even more preferably 2 to 3 copies of the bacteriophage T4 fibrin C-terminal polypeptide. For example, the vaccine may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 copies of the bacteriophage T4 fibrin C-terminal polypeptide. It should be understood that, in this article, the term "double T4" means that the number of trimer structures formed at the C-terminus of T4 fibrin is two, and it is a polymer formed by two trimer structures. It should also be understood that the term "double T4" in this article means "2-copy phage T4". Similarly, terms such as "triple T4" and "multiple T4" refer to the same or similar structures as "3-copy phage T4" and "multiple copy phage T4", and all describe the number of trimer structures formed at the C-terminus of T4 fibrin, and should not be understood as limiting the present application.

[0083] In this application, an antigen is any substance that can induce an immune response. Foreign molecules can be recognized by immunoglobulins on B cells or processed by antigen-presenting cells and bind to the major histocompatibility complex to form a complex that reactivates T cells, triggering a continuous immune response.

[0084] In this application, "functional fragment" means a polypeptide fragment that contains a portion of the amino acid sequence of a complete antigen or polypeptide, but still has the basic function of the complete antigen or polypeptide (such as stimulating the body to produce an immune response). For example, for viral or bacterial antigens, the functional fragment of the antigen can be a fragment that contains a portion of the complete antigen that has an immunogenic function. In some embodiments, the functional fragment of the antigen contains the ligand binding domain of the complete antigen polypeptide. For example, it contains the ligand binding domain of the new coronavirus Spike protein or the influenza virus HA protein.

[0085] In this application, "functional derivative" refers to a modified form of an antigen or polypeptide, for example, one or more amino acids of the antigen or polypeptide may be deleted, inserted, substituted and / or modified, but still has the basic function of the unmodified antigen or polypeptide (e.g., the function of stimulating the body to produce an immune response). For example, for a viral or bacterial antigen, a functional derivative of a viral or bacterial antigen may have a modified amino acid sequence that has at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity compared to the amino acid sequence of the unmodified viral or bacterial antigen. In some embodiments, the functional derivative of a viral or bacterial antigen is a non-conservative substitution or conservative substitution derivative of the native form of the antigen. In some embodiments, the functional derivative of a viral or bacterial antigen is a non-conservative substitution or conservative substitution derivative of the native form of the antigen, having an amino acid sequence that has at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity compared to the amino acid sequence of the native form of the antigen. In some embodiments, a functional derivative of a viral or bacterial antigen is a conservatively substituted derivative of the native form of the antigen, having an amino acid sequence that is at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence of the native form of the antigen.

[0086] Amino acids can be grouped according to the properties of their side chains:

[0087] (1) Hydrophobic amino acids: norleucine, Met, Ala, Val, Leu, Ile;

[0088] (2) Neutral hydrophilic amino acids: Cys, Ser, Thr, Asn, Gln;

[0089] (3) Acidic amino acids: Asp, Glu;

[0090] (4) Basic amino acids: His, Lys, Arg;

[0091] (5) Amino acids that affect chain orientation: Gly, Pro;

[0092] (6) Aromatic amino acids: Trp, Tyr, Phe.

[0093] A "conservative substitution" is defined as a substitution between amino acids in the same group, and a "non-conservative substitution" is defined as the replacement of an amino acid from one class with an amino acid from another class. Amino acid substitutions can be introduced into natural viral or bacterial antigen polypeptides, and the products can be further screened for the desired activity (e.g., retaining or improving the immunogenicity of the antigen) to obtain functional derivatives of the viral or bacterial antigen polypeptides described herein, such as functional derivatives of the novel coronavirus Spike protein or influenza virus HA protein.

[0094] In this application, "aa" means "amino acid" or "amino acid". It should be understood that in this document, T4 fibrin, linker or other polypeptide sequences are represented in the form of alphabetical amino acid sequences, and the corresponding numbers represent the positions of the amino acids. For example, the C-terminal helix (L23-L27) of T4 fibrin refers to the 5 amino acids from L (leucine) at position 23 to L (leucine) at position 27. In one embodiment, the N-terminus of the peptide oligomer is connected to the C-terminus of the antigen protein.

[0095] In one embodiment, the C-terminus of the peptide oligomer is linked to the N-terminus of the antigen protein. That is, whether in the case of single T4, double T4, or multiple T4, the C-terminal polypeptide of one of the T4 fiber structures is linked to the N-terminus or C-terminus of the antigen. In one embodiment, whether in the case of single T4, double T4, or multiple T4, the C-terminal polypeptide and the N-terminal polypeptide of one of the T4 fiber protein structures can be linked to the antigen.

[0096] In one embodiment, the antigen protein is a viral antigen protein or a bacterial antigen protein having a trimeric spatial structure in its natural state. Optionally, the antigen protein is one or more selected from the following: SARS-CoV-2 Spike protein, influenza virus HA protein or its functional fragment or functional derivative.

[0097] In one embodiment, the antigen can be a human antigen with a trimeric structure and / or a pathogen antigen, such as respiratory syncytial virus (RSV), rabies virus (Rabies G), herpes simplex virus (HSV), varicella-zoster virus (VZV), Epstein-Barr virus (EBV), human papillomavirus (HPV), Lassa fever virus (Lassa fever), human immunodeficiency virus (HIV), porcine epidemic diarrhea virus (PEDV), Ebola virus (EBOV), parainfluenza virus (ParainfluenzaVirus), tumor necrosis factor-α (TNF-α), collagen (Collagen), laminin (Laminin-5), tumor necrosis factor receptor 1 (TNF-R1), Fas (CD95), TGF-β (Transforming Growth Factor Beta), photoreceptor activating factor (RANK), trefoil factor (Trefoil Factors, TFFs), Interleukin-15 (Interleukin-15, IL-15), Laminin-111 (LN-1), Vascular Endothelial Growth Factor Receptor (Vascular Endothelial Growth Factor Receptor, VEGFR), Interleukin-2 (Interleukin-2, IL-2).

[0098] The antigens described in the present application may also be influenza and SARS-CoV-2 antigens, such as influenza virus surface glycoprotein hemagglutinin (HA) and SARS-CoV-2 virus surface spike protein.

[0099] It should be understood that the structural domain refers to another structural level between the secondary and tertiary structures. Generally speaking, a domain is an independent folding unit within the tertiary structure of a protein, usually a combination of several super-secondary structural units. In larger protein molecules, due to the close connection between adjacent super-secondary structures on the polypeptide chain, they further fold to form one or more relatively independent dense three-dimensional entities, namely domains. The domain is covalently linked to the entire molecule and is generally difficult to separate, which is the difference from the protein subunit structure. Larger proteins have multiple domains, which may be similar or completely different. Therefore, when the domain of a protein is damaged or inhibited, it may cause the domain to lose its effect or destroy its connection with the entire protein to which it belongs, thereby affecting the effect of the protein or inactivating the protein.

[0100] In this application, hemagglutinin (HA) is the most abundant glycoprotein on the surface of influenza virus. Mammalian influenza virus binds to the α-2,6 sialic acid-galactose receptor on the surface of host cells through HA and then enters the cell through endocytosis. Influenza HA is synthesized as an immature precursor (HA0), which is cleaved into HA1 and HA2 polypeptides by proteolysis to activate membrane fusion. HA is a homotrimeric glycoprotein, each monomer of which consists of two regions: (1) the head (HA1), which contains the sialic acid binding pocket and plays a key antigenic role, and (2) the stem (HA2), which is responsible for the fusion of the virus and cell membrane in the endosome. After the human body is infected with influenza virus or vaccinated with influenza vaccine, the immune system mainly produces neutralizing antibodies against HA protein, which can prevent the virus from binding to host cells, thereby neutralizing the virus's infectivity; the HA protein of influenza virus is prone to antigenic drift and antigenic shift, leading to changes in the virus strain. Therefore, HA as an important vaccine target can provide effective protection and better adapt to the mutation of influenza virus.

[0101] Therefore, in one embodiment, the antigen can also be one of the antigenic domains defined by the protein. For example, when the target antigen of the vaccine provided in the present application is the influenza virus HA protein, the antigen carried in the vaccine can be one or more of HA1, HA1 and HA2, HA and transmembrane domain, HA and transmembrane domain and intracellular domain. In this case, the part and domain of the protein carried by the vaccine are sufficient to induce an immune response in the body of the vaccinated subject, and then produce corresponding antibodies.

[0102] In one embodiment, the vaccine comprises one or more of the following amino acid sequences or nucleotide sequences, wherein the amino acid sequence or nucleotide sequence comprises the sequence shown in SEQ ID NO. 1-62, or comprises an amino acid sequence or nucleotide sequence that has at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the entire length of the amino acid sequence or nucleotide sequence, for example, at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity.

[0103] In one embodiment, the bacteriophage T4 fibrin C-terminal polypeptide comprises a peptide linker, which is a rigid peptide linker, a flexible peptide linker, or other types of peptide linkers. In this application, linkers or peptide linkers can be used interchangeably in this application. A peptide linker is an amino acid chain or peptide chain that acts as a link between two fusion proteins, and has a certain flexibility or rigidity to allow the proteins on both sides to complete their respective independent functions. A flexible linker is used to connect two proteins or polypeptides that need to have a certain activity and / or interaction. Flexible linkers usually contain small amino acids, and smaller amino acids provide flexibility in the connecting peptide, allowing the two connected proteins to have a certain activity. Rigid linkers are generally used to maintain a fixed distance between protein domains, two proteins, or polypeptides. In this application, when there are two or more bacteriophage T4 fibrin C-terminal polypeptides, the linker is used to connect different T4 fibrin structures and / or other structures.

[0104] In one embodiment, each of the bacteriophage T4 fiber protein C-terminal polypeptides may contain 0 to 4 linkers, for example, 1, 2, 3, or 4 linkers.

[0105] In the present application, the peptide linker is (EAAAK) n 、(G) n , (GS) n 、(XP) n 、(GGGGS) n or (GSA) n , wherein n is any positive integer between 1-20, 1-15, 1-10, 1-5, or 1-3, for example, n can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.

[0106] In one embodiment, the linker is selected from one or more of GS, EAAAK, PA, GSAGSA, GGASAGG. In the present application, the linker may be 1-20 amino acids in length, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids in length.

[0107] In one embodiment, the vaccine comprises ferritin. In the present application, the ferritin has the property of self-assembling into nanoparticles, which can array multiple antigens on its surface, thereby effectively displaying the antigens and significantly enhancing the immunogenicity of the antigens. The ferritin is linked to the C-terminal polypeptide of the bacteriophage T4 fibrin via a linker. In the present application, the linker used to connect the ferritin and T4 fibrin structures is defined as described above, i.e., in the present application, the ferritin can also be linked to the C-terminal polypeptide of the bacteriophage T4 fibrin via a rigid linker and / or a flexible linker.

[0108] For example, the vaccine can be linked to ferritin to form single T4-ferritin, double T4-ferritin and multi-T4-ferritin structures.

[0109] In one embodiment, the vaccine further includes an immune polypeptide to enhance the immune response. The vaccine includes an immune polypeptide. Preferably, the vaccine includes one or more of an M2e polypeptide, a CC helix sequence, a DC binding peptide, and an Fc receptor peptide. For example, the immune polypeptide can be one or more of SLLTEVETPIRNEWGCRCNDSSD (SEQ ID NO.104), LTNSIKANETNIASVTQEVNTAKGNISSLQGDVQALQEA (SEQ ID NO.105), GNNSAGIKGQVVALNTLVNQEA (SEQ ID NO.106), FYPSYHSTPQRP (SEQ ID NO.107), AYYKTASLAPAE (SEQ ID NO.108), SLSLLTMPGNAS (SEQ ID NO.109), and AQVNSCLLLPNLLGC (SEQ ID NO.110).

[0110] In the vaccine of the present application, the C-terminus of the antigen or antigenic domain is coupled to the T4 fibrin structure via a linker, and the C-terminus of the T4 fibrin structure is linked to T4 and / or ferritin via another linker; the immune polypeptide can be linked to the N-terminus or C-terminus of any of the above fragments via a linker. In one embodiment, the bacteriophage T4 fibrin C-terminal polypeptide is linked to the N-terminus or C-terminus. That is, whether in the case of single T4, double T4, or multiple T4, the C-terminal polypeptide of one of the T4 fibrin structures is linked to the N-terminus or C-terminus of the antigen. In one embodiment, whether in the case of single T4, double T4, or multiple T4, the C-terminal polypeptide and N-terminal polypeptide of one of the T4 fibrin structures can be linked to the antigen.

[0111] Specifically, in one embodiment, when the vaccine is a protein vaccine, those skilled in the art can obtain the amino acid sequence of the vaccine, including the sequence of the linker, ferritin, and immune polypeptide described above contained in the amino acid sequence, through methods well known to those skilled in the art. The corresponding DNA or RNA sequence (or gene sequence) is then designed and edited using the amino acid sequence, and then the gene sequence is integrated into a vector (e.g., a plasmid) by methods well known in the art, and the protein vaccine is obtained through expression from the plasmid. It should be understood that in the design and editing of gene sequences or amino acid gene sequences, the design of other structures such as start codons, stop codons, polyA tails, and / or the cutting or integration of genes are all areas well known to those skilled in the art.

[0112] In one embodiment, the vaccine is an mRNA vaccine comprising a sequence of a bacteriophage T4 fibrin C-terminal polypeptide, comprising an open reading frame with an encoded antigen or antigenic domain. An open reading frame (ORF) starts with a start codon and ends with a continuous base sequence of a stop codon, and is a sequence in a DNA sequence with the potential to encode a protein. An mRNA vaccine is an mRNA containing an encoded antigen protein that is directly translated into the human body to form a corresponding antigen protein, thereby inducing the body to produce a specific immune response and achieving the effect of preventive immunity. In the present application, those skilled in the art can also design antigen proteins of different trimer domains, translate them into encoding DNA sequences through amino acid sequences, and obtain mRNA vaccine fragments by reverse transcription.

[0113] In one embodiment, the mRNA vaccine comprises an RNA sequence encoding n phage T4 fibrin C-terminal polypeptides and an open reading frame encoding an antigen or antigenic domain, wherein the value of n is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16. In one embodiment, the mRNA vaccine may further comprise an RNA sequence expressing the aforementioned ferritin; in one embodiment, the mRNA vaccine may further comprise an RNA sequence expressing the aforementioned linker; in one embodiment, the mRNA vaccine may further comprise an RNA sequence expressing the aforementioned immune polypeptide.

[0114] It should be understood that when the mRNA vaccine is administered to a subject, the mRNA vaccine can not only express the antigen or antigenic domain in the subject through the open reading frame, but can also express the n phage T4 fibrin C-terminal polypeptides, and / or the ferritin, and / or the linker, and / or the immune polypeptide in the subject, and self-assemble to form a "T4 fibrin structure-antigen" structure, and undergo a specific binding reaction between the antigen and the antibody. It should be understood that the "T4 fibrin structure-antigen" structure can contain the ferritin, and / or the linker, and / or the immune polypeptide, and the number, definition, and connection method of the ferritin, and / or the linker, and / or the immune polypeptide are as described above.

[0115] In one embodiment, the vaccine includes an open reading frame encoding the influenza virus HA protein and / or an antigenic domain defined by HA. Specifically, the open reading frame of the mRNA carried by the vaccine can encode one or more protein domains of HA1, HA1 and HA2, HA and a transmembrane domain, HA and a transmembrane domain and an intracellular domain, thereby inducing a specific immune response in the subject. The application also provides the use of the vaccine in drug preparation or pharmaceutical products, as well as the use of the vaccine in treatment.

[0116] In one embodiment, the vaccine comprises an adjuvant, which is an inorganic adjuvant (e.g., an inorganic metal salt such as aluminum phosphate or aluminum hydroxide), an organic adjuvant (e.g., a saponin such as QS21 or squalene), an oil-based adjuvant (e.g., Freund's complete adjuvant and Freund's incomplete adjuvant), a cytokine (e.g., IL-1β, IL-2, IL-7, IL-12, IL-18, GM-CFS, and INF-γ), a particulate adjuvant (e.g., immunostimulatory complexes (ISCOMS), liposomes, or biodegradable microspheres), a virosome, a bacterial adjuvant (e.g., monophosphoryl lipid A, such as 3-de-O-acylated monophosphoryl lipid A (3D-MPL) or muramyl peptide), a synthetic adjuvant (e.g., a nonionic block copolymer, a muramyl peptide analog, or a synthetic lipid A), a synthetic polynucleotide adjuvant (e.g., polyarginine or polylysine), and an immunostimulatory oligonucleotide containing unmethylated CpG dinucleotides ("CpG").

[0117] The vaccine provided in this application can also be prepared into a preventive or therapeutic vaccine preparation or pharmaceutical preparation by means well known to those skilled in the art with preservatives, stabilizers, surfactants, diluents, adjuvants, solvents, etc.;

[0118] For example, the vaccine described in this application can be used as part of a vaccine, a multivalent combination vaccine composed of other viruses or pathogens;

[0119] For example, the vaccine provided herein can be used as a preventive or therapeutic vaccine in combination with other drugs and / or other treatment methods, and a therapeutically effective amount can be administered to a subject in need thereof in a manner well known to those skilled in the art;

[0120] For example, the vaccine described in the present application can be immunized with an adenovirus vaccine, protein vaccine, inactivated vaccine, or DNA vaccine of the same virus or pathogen in a sequential or simultaneous manner through the subject's immunization program.

[0121] In this application, the term "treatment" refers to the elimination of the cause of a disease in a subject and / or the alleviation of symptoms, or the prevention of the onset of a disease condition or health disorder caused by such cause, including the prevention of established medical symptoms with a clear cause, as well as syndromes, that is, a series of symptoms that do not necessarily have an identifiable cause.

[0122] The present application also provides the use of the vaccine in the preparation of SARS-CoV-2 and influenza drugs or pharmaceutical products. The present application also provides the use of the vaccine in the treatment of SARS-CoV-2 and influenza.

[0123] In one embodiment, the present application also provides a fusion protein comprising 2-8 copies of a bacteriophage T4 fibrin C-terminal polypeptide and one or more antigenic proteins, wherein the 2-8 copies of the bacteriophage T4 fibrin C-terminal polypeptide are directly connected in series by a chemical bond or each bacteriophage T4 fibrin C-terminal polypeptide is connected to each other through a peptide linker, and the C-terminal polypeptide and the antigenic protein are directly connected by a chemical bond or through a peptide linker.

[0124] In one embodiment, in the fusion protein, the N-terminus of the bacteriophage T4 fiber protein C-terminal polypeptide is linked to the C-terminus of the antigen protein.

[0125] In one embodiment, in the fusion protein, the C-terminus of the bacteriophage T4 fiber protein C-terminal polypeptide is linked to the N-terminus of the antigen protein.

[0126] In one embodiment, the antigen protein is a viral antigen protein or a bacterial antigen protein having a trimeric spatial structure in its natural state. Optionally, the antigen protein is one or more selected from the following: novel coronavirus Spike protein, influenza virus HA protein or its functional fragment or functional derivative.

[0127] In one embodiment, the fusion protein comprises one or more of the following amino acid sequences, wherein the amino acid sequence comprises a sequence as set forth in SEQ ID NOs. 1-57, or an amino acid sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the amino acid sequence over its entire length, for example, at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity.

[0128] In one embodiment, in the fusion protein, the peptide linker is a rigid peptide linker, a flexible peptide linker or other types of peptide linkers; preferably, the peptide linker is (EAAAK) n 、(G) n , (GS) n 、(XP) n 、(GGGGS) n or (GSA) n , wherein n is any positive integer between 1-20, 1-15, 1-10, 1-5, or 1-3; for example, n can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20. More preferably, the peptide linker is one or more selected from GS, EAAAK, EAAAKEAAAK, PA, GSAGSA, and GGASAGG.

[0129] In one embodiment, the present application further provides a nucleic acid encoding any of the above-mentioned fusion proteins.

[0130] Optionally, the nucleic acid comprises a nucleotide sequence selected from any one of SEQ ID NOs. 58-62, or a nucleotide sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0131] In one embodiment, the present application also provides a vector comprising the above nucleic acid.

[0132] In one embodiment, the present application also provides a host cell comprising the aforementioned nucleic acid or the aforementioned vector.

[0133] In one embodiment, the present application also provides a pharmaceutical composition comprising the vaccine described in any one of the above items, the fusion protein described in any one of the above items, the nucleic acid described in any one of the above items, the vector described in any one of the above items, or the host cell described in any one of the above items, and a pharmaceutically acceptable carrier or excipient.

[0134] In one embodiment, the present application also provides a peptide oligomer composed of 2-8 copies of the bacteriophage T4 fibrin C-terminal polypeptide, wherein the 2-8 copies of the bacteriophage T4 fibrin C-terminal polypeptide are directly connected in series by a chemical bond or each bacteriophage T4 fibrin C-terminal polypeptide is connected to each other by a peptide linker. Optionally, the peptide oligomer contains 2-8 copies of the amino acid sequence shown in SEQ ID NO.63, or contains 2-8 copies of an amino acid sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence shown in SEQ ID NO.63.

[0135] In one embodiment, the peptide oligomer further comprises any one or more amino acid sequences selected from SEQ ID NO. 64-103, or an amino acid sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0136] In one embodiment, the present application also provides the use of the peptide oligomer for promoting the immune response to antigenic proteins in a subject.

[0137] In this application, a subject refers to an individual who participates in drug development-related research, such as clinical trials, pharmacokinetic studies, toxicology studies, etc., receives drug intervention or is exposed to related chemicals, and is observed, measured, and analyzed for changes in various physiological, biochemical, and other indicators. These individuals can be healthy people, patients with specific diseases, or animals, organs, tissues, cells, or bacteria. In one embodiment, the subject is a mammal, preferably a human.

[0138] In the present application, "peptide oligomer" refers to a class of molecules composed of 2-8 copies of the bacteriophage T4 fibrin C-terminal polypeptide, wherein the peptide oligomer includes one or more peptide chain parts, such as the peptide oligomer includes one or more copies of the bacteriophage T4 fibrin C-terminal polypeptide, and / or one or more of the peptide linkers, and / or one or more of the ferritins, and / or one or more immune polypeptides.

[0139] In one embodiment, in the use, the antigen protein is a viral antigen protein or a bacterial antigen protein having a trimeric spatial structure in its natural state. Optionally, the antigen protein is one or more selected from the following: SARS-CoV-2 Spike protein, influenza virus HA protein or its functional fragment or functional derivative.

[0140] In one embodiment, in the use, in the bacteriophage T4 fiber protein C-terminal polypeptide, at most one T4 polypeptide sequence is missing 3, 5, 7, or 11 amino acids. A 3-amino acid deletion refers to a lack of the first 3 amino acids in the N-terminal region (G1-Q11) of the T4 polypeptide sequence, with the fourth amino acid P (polyproline) still functioning; a 5-amino acid deletion refers to a lack of the first 5 amino acids in the N-terminal region (G1-Q11), with the sixth amino acid still functioning; a 7-amino acid deletion refers to a lack of the first 7 amino acids in the N-terminal region (G1-Q11), with the eighth amino acid still functioning; and a 1-amino acid deletion refers to a lack of the first 11 amino acids in the N-terminal region (G1-Q11), with the 12th amino acid A (alanine) still functioning.

[0141] In one embodiment, the present application also provides an immunogenic polypeptide comprising the above-mentioned peptide oligomer and one or more antigenic proteins, optionally, the antigenic protein is a viral antigenic protein or a bacterial antigenic protein having a trimer spatial structure in its natural state, optionally, the antigen is a novel coronavirus Spike protein, an influenza virus HA protein or a functional fragment or a functional derivative thereof.

[0142] In one embodiment, the immunogenic polypeptide comprises one or more of the amino acid sequences selected from SEQ ID NOs. 1-57, or comprises an amino acid sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the entire length of the amino acid sequence, for example, at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity.

[0143] The present application also provides a method for preventing or treating a disease, comprising administering to a subject an effective amount of any of the above-mentioned vaccines, any of the above-mentioned fusion proteins, any of the above-mentioned nucleic acids, any of the above-mentioned vectors, any of the above-mentioned pharmaceutical compositions, or any of the above-mentioned peptide oligomers, or any of the above-mentioned immunogenic polypeptides, optionally, the disease comprises a viral infection or a bacterial infection, optionally, the viral infection comprises a new coronavirus or influenza virus infection.

[0144] In this application, "therapeutically effective amount" refers to the dosage of the composition or drug of the present application that can produce a detectable clinical improvement effect (such as relief, inhibition or cure) on the subject's disease or symptoms when administered single or multiple times, and the dosage does not cause unacceptable toxicity to the subject. The effect can be quantified by objective medical indicators (such as laboratory tests, imaging assessments) or subjective symptom scores (such as pain scales). Those skilled in the art can adjust the specific dosage and frequency of administration based on the patient's age, weight, severity of the disease, and route of administration.

[0145] Example

[0146] This application provides a general and / or specific description of the materials and experimental methods used in the experiments. In the following examples, unless otherwise specified, the reagents or instruments used without indicating the manufacturer are all conventional reagent products that can be obtained commercially.

[0147] Experimental methods

[0148] mRNA synthesis in vitro

[0149] Relevant vaccine structural units (i.e., polypeptide fragments to be linked to antigens in subsequent examples) were synthesized at GenScript (GenScript Biotech Co., Ltd.) and constructed into pcDNA3.1 / Hygro(+) vectors to obtain plasmids that can obtain templates.

[0150] PCR was used to obtain an in vitro transcribed mRNA template. PCR was performed according to the following system and procedure. The product was recovered using a DNA cleaning kit and the concentration of the RNA template was measured using a gene amplifier (Hangzhou Longji Scientific Instrument Co., Ltd., T02).

[0151] Components and dosage of PCR program

[0152]

[0153] PCR program execution steps:

[0154]

[0155] Calculate the volume required for 2 μg of DNA template and perform enzyme digestion on the linearized DNA template according to the following system to expose the poly(A) tail at 50°C for 1 hour.

[0156] Components and dosage of enzyme digestion system

[0157] Element Dosage (total volume 100 μL) DNA template + enzyme-free sterile water 88μL 10xBspQIBuffer 10 μL BQ 2μL

[0158] The transcription template after enzyme digestion was recovered using a DNA cleaning and recovery kit (US Everbright, UE-PCR-250), and the concentration of the RNA transcription template was measured.

[0159] Based on the measured template concentration, the volume corresponding to 1 μg of template was calculated, and mRNA transcription was performed according to the following system at 37°C for 3 h.

[0160] Components and dosage of mRNA transcription (total volume 40 μL)

[0161]

[0162]

[0163] After transcription is completed, 1 μL DNase was added directly to the system to remove the transcription template and incubated at 37°C for 30 min. RNA recovery kit ( RNA Cleanup Kit) to recover the transcribed mRNA and detect the mRNA concentration.

[0164] Recycling steps:

[0165] Heat sterile enzyme-free water in a metal bath at 60°C;

[0166] For every 50 μL of volume to be recovered, add 100 μL of RNA Clean-up Binding Buffer. If the starting volume is less than 50 μL, adjust to 50 μL with sterile, enzyme-free water. If the starting volume is greater than 50 μL, increase the amount of RNA Cleanup Binding Buffer accordingly. Samples with a starting volume greater than 150 μL need to be passed through the column in batches. Add 150 μL of anhydrous ethanol (1 volume = 50 μL + 100 μL). Mix by pipetting or gently flicking the test tube; do not vortex. This allows for binding of mRNA greater than or equal to 25 nt. If binding of mRNA around 15 nt is required, add two volumes (300 μL) of anhydrous ethanol.

[0167] Insert the purification column into the collection tube. Based on the estimated transcription yield and the collection limit of each purification tube (50 μg / 500 μg), add the sample to the purification column (volume no more than 750 μL) and incubate at 13,000 rpm for 1 min.

[0168] Discard the filtrate, reinsert the column into the tube, add 500 μL W2 Buffer, incubate at 13,000 rpm for 1 min, discard the filtrate, and repeat once;

[0169] The column was transferred to an RNase-free 1.5 ml centrifuge tube and centrifuged at 13,000 rpm for 1 min.

[0170] 80 μL of H 2 O (preheated at 60° C.) was added to the column, and the purification column and centrifuge tube were placed in a 60° C. metal bath for 5 min to fully dissolve the mRNA in water, followed by centrifugation at 13,000 rpm for 1 min.

[0171] dsRNA removal

[0172] Calculate the volume of mRNA per 100-500 μg based on the RNA concentration and perform cellulose purification to remove dsRNA according to the following steps:

[0173] Weigh 0.2 g of cellulose and dissolve it in 1 ml of Chromatography buffer, shaking vigorously for 10 min;

[0174] Take 700 μL and add it to the recovery tube (equipped with purification column) of the DNA cleaning recovery kit (PCR Clean-up Kit), and centrifuge at 14000g for 60 seconds;

[0175] Discard the waste solution, resuspend the cellulose in 500 μL of buffer, and shake vigorously for 5 min;

[0176] After centrifugation at 14,000 g for 5 min, 500 μL of buffer containing 100 μg–500 μg of mRNA was added, the tube was shaken vigorously for 30 min, and centrifuged at 14,000 g for 60 s;

[0177] Take the filtrate and use RNA recovery kit RNA Cleanup Kit to recover mRNA;

[0178] Measure the concentration of purified mRNA.

[0179] mRNA gel verification

[0180] Take the mRNA sample recovered after cellulose purification, dilute it to the same concentration (100 ng / μL) with sterile enzyme-free water, add an equal volume of 2× RNA Loading Buffer, denature at 75°C for 10 min, load 3 μL of the sample for agarose gel electrophoresis, and the electrophoresis conditions are 110V for 20 min (low temperature is controlled throughout the electrophoresis process).

[0181] LNP-mRNA encapsulation and encapsulation efficiency detection

[0182] LNP-mRNA was prepared by Nanoassemblr™ Spark™ (PRECISIONNANOSYSTEMS, NIS0001) using a molar percentage of 1.5%: 10%: 38.5%: 50% DMG-mPEG2000 (1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol 2000, 160743-62-4): phosphorylcholine (DSPC, 816-94-4): cholesterol (Cholesterol, 57-88-5): ionizable aminolipid (2089251-47-6) and mRNA. LNP-mRNA was lysed using 2% Triton and the total mRNA content was detected using Ribogreen reagent. LNP-mRNA was dissolved using 1×TE solution and the free mRNA content was detected using Ribogreen reagent. The fluorescence signal intensity was measured using a multifunctional microplate reader with an excitation light of 485 nm and an emission light of 528 nm to calculate the encapsulation efficiency.

[0183] 293F transfected cell WB (Western blot) sample preparation

[0184] Preparation of liposome-mRNA complex:

[0185] 1 μg of mRNA to be transfected was diluted to 50 μL with Opti-MEM, and 2.67 μL EndoFectin was diluted to 50 μL with Opti-MEM. TM Add Expi293 (GeneCopoeia, EF009) to 50 μL and mix gently. After standing for 5 minutes, add mRNA to EndoFectin TM In Expi293, gently mix and let stand for 20 minutes; for cell transfection, dilute 293F cells, in a 12-well plate, 1mL 1.0×10 6 The cells were incubated in a shaker at 37°C for 19 h, and then the cells were added with the complexes after the liposome-mRNA complexes were incubated. The cells were observed and collected after incubation at 37°C for 19 h.

[0186] Observe the positive control under an inverted fluorescence microscope, and prepare the sample after confirmation; centrifuge at 500g for 5 minutes at 4°C to separate the supernatant and cells; prepare a RIPA+protease inhibitor (100×) mixture as needed; add 150 μL of RIPA mixture to the cell pellet, pipette to mix, lyse on ice for 30 minutes, and then ultrasonically disrupt and mix for 10 minutes; aspirate 80 μL of supernatant and cell lysate respectively, add 40 μL of non-reducing (trimeric structure can remain intact) 3× loading buffer or reducing (can interrupt the coupling of trimers to form monomers) 3× loading buffer, and denature in a metal bath for 10 minutes.

[0187] Electrophoresis: Dissolve the commercially available powder in 1 L of pure water to prepare the electrophoresis solution. Run an 11-well 4-20% gradient gel, 20 μL sample and 4 μL marker per well. Run at 130 V for 45 min.

[0188] Electroporation: Prepare the transfer solution by adding 800 mL of pure water and 200 mL of methanol to the commercial powder package. Activate the PVDF membrane with methanol for 1 minute, then equilibrate it with the buffer solution at 110 V for 50 minutes.

[0189] Blocking: briefly rinse with 1×TBST, and block with 5% skim milk powder (prepared with 1×TBST) at room temperature for 80 mins, 60 rpm.

[0190] Primary antibody incubation: Wash three times with 1× TBST at 85 rpm for 5 min each. Incubate with PR8 antibody at a 1:500 dilution at 60 rpm for 1 h at room temperature.

[0191] Secondary antibody incubation: Wash 7 times with 1× TBST at 85 rpm for 5 min each time. Incubate with rabbit HRP antibody at a dilution of 1:10,000 at 60 rpm for 40 min at room temperature.

[0192] ELC development: Wash 6 times with 1×TBST, prepare the developer in a 1:1 ratio according to the kit instructions (mix black and white and protect from light), evenly add the developer onto the PVDF membrane and then photograph.

[0193] ELISA detection of serum antibodies

[0194] ELISA plates were coated with 100 ng / well recombinant HA (Sino Biological 11684-V08H) or 200 ng / well RBD (GenScript, Z03483) and washed three times with PBST (0.1% Tween 20 in PBS) and blocked with PBST containing 3% BSA. Diluted immune mouse serum (0.5% BSA in PBS) was added and incubated at 37°C for 60 min. After washing five times with PBST, HRP Goat Anti-Mouse IgG (H+L) (ABclonalAS003, diluted 1:5000 in PBS / 0.5% BSA) or SARS-COV2-2 spike RBD, mouse Pab (Sino Biological, 40592) was added to each well and incubated at 37°C for 60 min. After washing five times with PBST, TMB (beyotime, P0209) was added and incubated at 37°C for 20 min in the dark. 50 μl of The reaction was terminated with 3 M phosphoric acid, and the absorbance values ​​of OD450 and OD630 were read on a chemiluminescent immunoassay (Thermo).

[0195] Pseudovirus neutralization experiment

[0196] 50 μL of poly-L-lysine (Sigma, P4832-50 mL) was added to each well of a 96-well cell culture plate (Corning 3603, black transparent bottom). The plates were coated for 1 hour in a 37°C incubator (Thermo, SERIES II WATER JACKET). The plates were washed twice with 200 μL of sterile water and once with 300 μL of PBS. HEK-293T-ACE2 cells (Yeasen, 41107ES03) were plated and 1.5×10 4 Cells / well, cultured at 37°C for 20 hours; 8 μL of mouse serum was placed in an eight-tube strip and heated at 56°C in a PCR instrument for 30 minutes; the starting dilution ratio of the 3-fold (RBD antibody-mouse serum)-culture medium mixture was 1:10, and it was serially diluted 3-fold in a V-type 96-well plate (basal culture medium as the dilution medium) to a final volume of 40 μL; a pseudovirus-culture medium mixture was prepared in a 1.5 mL centrifuge tube: 5640 μL, 18.8 μL of pseudovirus (Yeasen, 11906ES50) and 5621.2 μL of basal culture medium were mixed; control well: A-culture medium: 60 μL of basal culture medium; B-pseudovirus + culture medium: 30 μL of pseudovirus culture medium mixture was taken into the well, and then 30 μL of basal culture medium was added; experimental well: 30 μL of diluted serum + 30 μL of pseudovirus culture medium mixture; the mixture was plated in a round-bottom 96-well plate (Corning 7007) at 37°C for 1 hour, discard all the original culture medium in the hACE2 / 293T cell culture plate wells, and then take 50 μL of the mixed solution into each well; incubate at 37°C for 6 hours, then change the medium (discard the original culture medium in the wells and add 120 μL complete culture medium); continue to culture at 37°C for 24 hours, add luciferase reporter gene detection reagent (Beyotime, RG055M) in a 1:1 ratio of the volume of the culture medium in the wells, pipette 10 times to fully lyse the cells (avoid bubbles), react on a shaker (speed of 140 rpm) for 5 minutes, and then use a multi-function microplate reader (Thermo, Varioskan LUX) to measure the RLU.

[0197] Hemagglutination inhibition (HAI)

[0198] First, treat with immune mouse serum. Use a single-channel pipette to aspirate 1 volume of serum into a sterile EP tube. Then, change the pipette tip and add 4 volumes of RDE. Mix thoroughly by pipetting. Place the tube in a 37°C water bath for 16–18 hours overnight. Remove from the 37°C water bath and inactivate the tube by placing it in a 56°C water bath for 30 minutes.

[0199] To test for residual nonspecific agglutinins in treated serum: In a 96-well V-shaped plate, add 25 μL of serum sample in a two-fold serial dilution series to 25 μL of PBS and 50 μL of a 1% chicken red blood cell suspension. Incubate at room temperature for 30 minutes and observe for agglutination. If agglutination occurs, residual nonspecific agglutinins are present in the serum, and the serum must be adsorbed with a high concentration of red blood cells to remove these nonspecific agglutinins before use. To remove these nonspecific agglutinins, add 1 volume of 20% chicken red blood cells to 20 volumes of RDE-treated serum. Mix thoroughly, incubate at 2-8°C, and mix thoroughly by inverting every 15 minutes. After incubation for 1 hour, centrifuge at 2000 rpm for 5 minutes, recover the serum supernatant, and retest for complete removal of nonspecific agglutinins.

[0200] To prepare an antigen that produces 4 hemagglutination units (HFUs), the virus hemagglutination titer (HA titer) is determined by an HFU assay. Dividing the HA titer by 8 gives the dilution that produces 4 HFUs. For example, if the HA titer of a virus is 64, dividing it by 8 equals 8. A 1:8 dilution (1 mL virus solution plus 7 mL PBS) of this virus will produce 4 HFUs / 25 μL of antigen.

[0201] When performing the hemagglutination inhibition test in a V-shaped 96-well microplate, add 50 μL of serum to the initial well, then add 25 μL of Aldrich's solution to each of the remaining wells. Then, pipette 25 μL of each well to dilute the antibody in two-fold dilutions. The last well serves as a control. Add 25 μL of freshly prepared 4-unit antigen to each well. For the serum control plate, add 25 μL of Aldrich's solution to each well. Gently tap the microplate to thoroughly mix the antigen and antibody, and incubate at room temperature for 30 minutes. Add 50 μL of a 1% chicken red blood cell suspension to all wells, let stand at room temperature for 30-60 minutes, and observe the results of the hemagglutination inhibition test. The hemagglutination inhibition test includes the following controls: an RBC control; a negative control serum to prevent the influence of other nonspecific antibodies; and a reference serum control to prevent interference from nonspecific agglutinins and inhibins.

[0202] Influenza virus microneutralizing antibody test (MN test method)

[0203] Mouse serum samples were incubated in a 37°C waterbath overnight with RDE at a ratio of 1:4, then inactivated at 56°C for 30 minutes. Five volumes of PBS (serum samples diluted 10-fold) were added. A two-fold dilution ratio (influenza antibody-mouse serum / positive serum)-to-virus dilution buffer was used, with a starting dilution ratio of 1:10. Three-fold serial dilutions (virus dilution buffer-to-medium) were performed in a V-shaped 96-well plate (Thermo) to a final volume of 50 μL.

[0204] Dilute the virus to 100 TCID50 / 50 μL. Pipette 50 μL of the virus solution and add it to the serum sample, except for the cell-negative control (50 μL of virus diluent is added to the cell-negative well). Verify the virus titer. Add 100 μL of the 200 TCID50 / 100 μL virus solution to the first well. Adjust the micropipette range to 50 μL, insert and secure the pipette tip, and pipette 50 μL of the virus. Make serial dilutions to 100 TCID50, 50, 25, 12, 6, 3, 1.5, and 0.7. Gently mix the virus-serum mixture and incubate in a 37°C incubator for 1 hour.

[0205] 100 μL of DMCK cells (1.5×10 4 cells / well, and add TPCK-trypsin at a final concentration of 4 μg / mL). Incubate in a 37°C, 5% CO2 incubator for 16-22 h.

[0206] Aspirate the culture medium and slowly pour PBS into the sample reservoir. Adjust the sample volume of the pipette gun (multichannel micropipette) to 200 μL and wash once with PBS. Discard the PBS (do not allow the cells to dry out), add 200 μL of 4% PFA fixative, and fix at room temperature for 40 minutes. Discard the PBS (do not allow the cells to dry out), slowly pour the fixative (pre-chilled at 4°C) into the sample reservoir, adjust the sample volume of the pipette gun (multichannel micropipette) to 100 μL, insert and secure the pipette tip, and pipette 100 μL of fixative into the 96-well plate, so that each well contains 100 μL of fixative. Discard the pipette tip into a waste container containing disinfectant. Cover the 96-well plate and fix the cells at room temperature for 10 minutes. Discard the fixative and allow the 96-well plate to dry at room temperature.

[0207] Wash with PBS three times, 1 min each time. After discarding the PBS, pat the remaining liquid on absorbent paper as much as possible to remove the residual fixative; add 100 μL of blocking solution, incubate at 37°C for 1 hour, and discard the blocking solution; add 100 μL of primary antibody diluent (influenza virus NP antibody (Pan Influenza A Nucleoprotein Antibody, Rabbit Mab, Sino Biological, 40208-R113), the use ratio is 1:2000, diluted in antibody diluent), incubate at 37°C for 1 hour; wash with PBST five times, 1 min each time; add 100 μL of enzyme-labeled secondary antibody diluent (goat anti-rabbit secondary antibody, the use ratio is 1:5000, diluted in antibody diluent), incubate at 37°C for 1 hour; wash with PBST five times, 1 min each time;

[0208] Color development: Add 200 μL TMB, apply sealing glue, place in a constant temperature incubator, set the temperature to 37°C, and incubate in the dark for 20 minutes;

[0209] Stop: Add 50 μL 3M phosphoric acid and pipette for 5 times until the blue color disappears, the liquid turns yellow, and the color is uniform;

[0210] Reading: Read the OD450 and OD620 nm absorbance values ​​within 10 minutes.

[0211] In this application, the names, structures and corresponding amino acid sequences of the prepared experimental samples are shown in the following table:

[0212] Table 1

[0213]

[0214]

[0215]

[0216]

[0217]

[0218]

[0219]

[0220]

[0221]

[0222]

[0223]

[0224]

[0225]

[0226]

[0227]

[0228]

[0229]

[0230]

[0231]

[0232]

[0233]

[0234]

[0235]

[0236]

[0237]

[0238]

[0239]

[0240] Table 2

[0241]

[0242]

[0243]

[0244]

[0245] Note: When the sequences in Table 2 above represent nucleotide sequences, "T" represents uridine.

[0246] Table 2 continues the information of peptide oligomers involved in this application

[0247]

[0248]

[0249]

[0250]

[0251] Example 1. Double T4 structure vaccine

[0252] T4 trimers are commonly used in molecular biology and vaccine development, particularly as immunogens or delivery vectors. Their primary advantage is their ability to rapidly self-assemble into a stable trimer structure without the need for complex external aids. However, large-scale production of T4 trimers often faces the problem of low trimer formation rates. Particularly in recombinant protein expression systems, T4 trimer formation may not achieve the desired purity or yield due to obstacles during folding or polymerization. Even if T4 trimer formation is successful, purification can still present challenges. The native structure of T4 consists of a trimeric β-hairpin propeller, comprising 27 amino acids (GYIPEAPRDGQAYVRKDGEWVLLSTFL (SEQ ID NO. 63)). It is composed of an extended N-terminal region (G1-Q11), a β-hairpin (A12-L23), and a C-terminal helix (L23-L27). The extended N-terminal region contains the P4 and P7 polyproline II helices. Hydrogen bonds form between V14-V21 and K16-E19 in the β-hairpin, and the hairpin structure is stabilized by hydrophobic interactions between the N-terminus (A12-V14) and the C-terminus (V21-L23), as well as by diagonal interactions between Y13 and W20. The trimer is stabilized by salt bridges between E5 and R15, and by hydrogen bonds between Y13 and R15. Because the subunits of the T4 trimer are tightly bound together, any slight variation could lead to structural collapse, limiting the potential for direct engineering.

[0253] During the mRNA vaccine research, the extracellular domain (18-526aa) of the PR8 strain HA (H1 / Puerto Rico / 8 / 1934 (EPI159360)) was used as an antigen to study the immunogenicity of the HA antigen in female BALB / c. The structural sequence and samples were obtained by in vitro mRNA synthesis, 293F transfected cell WB (Western blot) sample preparation (reduction, non-reduction) and LNP-mRNA encapsulation and encapsulation rate detection methods; the serum antibody detection of mice after immunization was carried out by ELISA detection of serum antibodies, hemagglutination inhibition (HAI) and influenza virus micro-neutralizing antibody detection; the mRNA acquisition method and serum detection in subsequent examples are consistent with this example.

[0254] The extracellular domain (18-526aa) of the PR8 strain HA (H1 / Puerto Rico / 8 / 1934 (EPI159360)) was used as an antigen, and vaccines with different structures were designed as shown in Tables 3 to 7 below.

[0255] Table 3

[0256]

[0257] The samples were treated with non-reducing and reducing methods. WB results showed that the expression of HA antigen could be detected in the cell lysate, and the trimer antigen could be detected in the non-reducing treated samples ( Figure 1 A); MF-9, MF-11 (HA antigen fused with double T4) and MF-12 (HA antigen fused with double T4) can express obvious HA antigen in the cell supernatant, and the non-reducing treated samples have trimer or multimer bands. The double T4 structure (MF-11 and MF-12) (7.5%) is superior to the single T4 structure (MF-9) (2.8%) ( Figure 1 B)

[0258] MF-9, MF-11 and MF-12 were immunized by intramuscular injection at D0 and D14, 3 μg / mouse. Blood samples were collected on D14, D21, D28 and D35. ELISA results showed that antibodies were produced 14 days after the initial immunization, but the antibody level was low. The antibody level increased significantly on the 7th day after the booster immunization, reached a peak 14 days after the booster immunization, and remained stable until the 35th day. Figure 2 A); The anti-HAIgG antibody levels in mice immunized with MF-11 and MF-12 structure vaccines were higher than those in MF-9 structure vaccines. The results of HAI testing of serum from mice immunized on D21, D28 and D36 showed that the HAI titer was proportional to the anti-HAIgG antibody level. The HAI titer of serum from mice immunized with MF-11 and MF-12 structure vaccines reached a peak on D28. The HAI titer of serum from mice immunized with MF-11 and MF-12 structure vaccines was at least 1280, which was better than the 640 of MF-9 ( Figure 2 B) The results showed that under the conditions of double immunization, the double T4 structure was superior to the single T4 structure and enhanced the immune response to the antigen.

[0259] At a dose of 1 μg / mouse, ELISA detected the anti-HA IgG antibody content in the serum of mice immunized with different structures of mRNA vaccines, which reached a peak on D28. High levels of anti-HA IgG antibodies could also be detected 105 days after immunization ( Figure 2 C), and was lower than 3 μg / mouse at the same time point, indicating that the antibodies in the serum of immunized mice could be continuously stabilized at a certain level, showing a certain dose-positive correlation.

[0260] Here, it was found that the deletion of the double T4 sequence could lead to an increase in the expression of trimeric antigen in vitro ( Figure 11 ), double T4 constructs with different deletions were designed to test their effects on antigen immune responses. The vaccine antigens used were PR8 strain HA or HA2, and the signal peptides were either IgG K (METPAQLLFLLLLWLPDTTG (SEQ ID NO. 111)) or the native signal peptide. The results are summarized in Tables 4 and 5. The number and definition of the missing amino acids are as described above.

[0261] Table 4

[0262]

[0263] The antibody content in the serum of mice immunized with MF-31 was slightly lower than that of MF-12, but higher than that of MF-9. However, the HAI titer was lower than that of MF-12 and MF-9. Figure 3 ).

[0264] Table 5

[0265]

[0266] Mice were immunized with one dose each on day 0 and day 14, and sera from the immunized mice were collected on day 35. The HAI titer of the serum from mice immunized with MF-18 was greater than 2560, the HAI titer of the serum from mice immunized with MF-42 was 1280, the HAI titer of the serum from mice immunized with MF-43 was between 640 and 1280, and the HAI titer of the serum from mice immunized with MF-44 was 640. The HAI of MF-46 was superior to that of MF-47. The number of aa missing in the second T4 structure in the double T4 structure was inversely proportional to the immune response ( Figure 4 A). The first T4 deletion 5aa (MF-55) immunized mice had a serum HAI titer of more than 1280 on day 35, which was better than MF-43 but slightly worse than MF-18 ( Figure 4 A) Microneutralization assay was performed on MF-18, MF-42, and MF-46 with HAI titers above 1280 in immunized mice. The results showed that the IC 50 Better than MF-42( Figure 4 A and B). The above results indicate that the double T4 structure has better immune activity than the single T4, and the amino acid deletion in the T4 structure affects the immunogenicity of the T4 structure antigen and is positively correlated with the number of amino acid deletions.

[0267] The tandem administration of two T4 constructs can enhance antigen trimer production and enhance immune responses. Triple and quadruple T4 constructs were designed to investigate the immune efficacy of the vaccine. Six- to eight-week-old female BALB / c mice were obtained from Zhejiang Weitong Lihua Laboratory Animal Technology Co., Ltd. Mice were immunized intramuscularly with a total volume of 100 μL for each test vaccine, with 50 μL administered into each quadriceps muscle. The group number and vaccine dose for each test vaccine are shown in Table 6 below. It should be noted that experiments exploring dual and multiple T4 constructs used different batches of vaccine or constructs than those used in single and dual T4 experiments to ensure experimental stability and reliability and minimize operational errors.

[0268] Table 6

[0269]

[0270] Mice were immunized with one dose each on days 0 and 14, and sera were collected from the immunized mice on days 21 and 28. ELISA showed that the anti-HAIgG antibody level in the serum of mice immunized on day 28 was slightly higher than that on day 21, and the anti-HAIgG antibody level in the serum of mice immunized with the double T4, triple T4, and quadruple T4 structure vaccines was higher than that of the single T4 structure ( Figure 5 A); The serum HAI titers of mice immunized with double T4, triple T4 and quadruple T4 structure vaccines were similar and higher than those of the single T4 structure vaccine ( Figure 5 B) The results showed that triple T4 and quadruple T4 can achieve similar immune activity as double T4.

[0271] To investigate the immune efficacy of the vaccine, a series of additional T4 vaccines were designed. Six- to eight-week-old female BALB / c mice were obtained from Zhejiang Weitong Lihua Laboratory Animal Technology Co., Ltd. Mice were immunized intramuscularly with a total volume of 100 μL for each vaccine tested, with 50 μL administered intramuscularly to the quadriceps femoris. The group numbers and vaccine doses for each vaccine tested are shown in Table 7 below:

[0272] Table 7

[0273]

[0274]

[0275] Mice were immunized with one dose each on day 0, and serum was collected from the immunized mice on day 21. The HAI titer of the serum of the immunized mice on day 21 was detected by the HAI method, which showed that the HAI titer of the serum of the mice immunized with single T4 was 80, while the HAI titer of the serum of the mice immunized with double T4, triple T4, 4T4, and 8T4 was greater than 80, and the HAI titer of the serum of the mice immunized with 16T4 was less than 80 ( Figure 6 The results showed that triple T4 and quadruple T4 could achieve similar immune activity to double T4, the immune activity of octa T4 was greater than that of single T4, and the immune activity of hexadecane T4 was weaker than that of single T4.

[0276] In summary, the immunoreactivity of the di-, tri-, and tetra-T4 structures is similar, with the octa-T4 structure exhibiting superior immunoreactivity to that of the mono-T4. Therefore, when multiple T4 structures are connected in series, immunoreactivity will be enhanced, but the number of T4 structures connected in series should not be too large.

[0277] Example 2. Dual T4 Optimization

[0278] Different linkers between the two T4s were designed to investigate the immune efficacy of the vaccine. Six- to eight-week-old female BALB / c mice were obtained from Zhejiang Weitong Lihua Laboratory Animal Technology Co., Ltd. Mice were immunized intramuscularly with a total volume of 100 μL for each test vaccine, with 50 μL administered into the quadriceps femoris. The group numbers and vaccine doses for each test vaccine are shown in Table 8 below.

[0279] Table 8

[0280]

[0281]

[0282] Mice in groups 1-18 were immunized with one dose each on days 0 and 14, and sera from the immunized mice were collected on day 35. Flexible linkers GS (MF-11), GGGSGG (MF-21), and GGGGSGGGG (MF-26) were used between the double T4s. The HAI of MF-11 and MF-21 showed no difference, but was superior to that of MF-26. Furthermore, the HAI of MF-11 and MF-21 was positively correlated with MN ( Figure 7 A and B). Rigid linkers EAAAK (MF-18), EAAAAKEAAAK (MF-22), and EAAAAKEAAAKEAAAK (MF-27) were used between the two T4s. The HAI of MF-18 and MF-22 showed no difference, but was superior to that of MF-27. Moreover, the HAI of MF-18, MF-22, and MF-27 was positively correlated with MN ( Figure 7 A and B). The rigid linkers PAPAP (MF-19), PAPAPAPAP (MF-23), and PAPAPAPAPAPA (MF-28) were used between the two T4s. The HAI of MF-19 and MF-28 had no difference, and was superior to MF-23. The HAI of MF-19 and MF-28 was positively correlated with MN ( Figure 7 A and B). The semi-flexible linkers GGASAGG (MF-20), GGASPAAPAPGG (MF-24), and GGASPAAPAPASPAGG (MF-29) were used between the two T4s. The HAI titer of MF-20 was better than that of MF-24, and MF-24 was better than that of MF-29. The HAI titer of the serum of mice immunized with MF-24 and MF-29 on Day 35 was less than 640, and the neutralization titer was not tested. The HAI titer of the serum of mice immunized with MF-20 on Day 35 was greater than 1280, and the neutralization titer test showed significant differences between mice ( Figure 7 A and B). The semi-flexible linkers GSAGSA (MF-12), GSAGSAGSA (MF-25), and GSAGSAGSAGSA (MF-30) were used between the two T4s. The HAI titers of MF-12, MF-25, and MF-30 were the same ( Figure 7 A) Microneutralization assays detected a positive correlation between the hemagglutination inhibition titer and neutralization titer of MF-12. The results showed that the rigid linker EAAAK was optimal for linking the two T4s, with a shorter linker structure being even more optimal.

[0283] The above results indicate that the use of rigid EAAAK is optimal and the EAAAK linker cannot be shortened again.

[0284] A rigid AP linker and a linker-free structure were used to explore the effect of the double T4 structure on the immunogenicity of the influenza virus HA protein mRNA vaccine in mice. The designed structures are shown in Tables 9 and 10 below.

[0285] Table 9

[0286]

[0287] Table 10

[0288]

[0289] The results showed that the HAI titer of serum of mice immunized on D35 with shortened linker between double T4, rigid AP linker (MF-45) and no linker structure (MF-46) reached 2560, and there was no statistical difference in IC50 between serum of mice immunized on D35. However, MF-18 showed a trend of being superior to MF-45 and MF-46 in terms of the numerical value. Figure 8 In summary, the effect of using a rigid linker between two T4s is better than that of using a flexible linker, and the effect of using a short linker is better than that of using a long linker. Among them, the EAAAK linker is the best for MF-18.

[0290] Example 3. T4 structure coupled to ferritin

[0291] The ectodomain (18-526 aa) of the PR8 strain HA (H1 / Puerto Rico / 8 / 1934 (EPI159360)) was used as the antigen, with a single T4 construct conjugated to ferritin. Six- to eight-week-old female BALB / c mice were obtained from Zhejiang Weitong Lihua Laboratory Animal Technology Co., Ltd. Mice were immunized intramuscularly with a total volume of 100 μL for each vaccine tested, with 50 μL administered into the quadriceps femoris. The group number and vaccine dose for each vaccine tested are shown in Table 11 below.

[0292] Table 11

[0293]

[0294] Rigid linker structure MF-34 mice were immunized with one dose each on day 0 and day 14, and sera were collected from the immunized mice on day 21 and day 28. The anti-HA IgG antibody level in the serum of the immunized mice on day 28 was slightly increased compared with that on day 21 ( Figure 9 A); The serum antibody levels of mice immunized with MF-15 and MF-34 structure vaccines at D21 and D28 were not much different from those of MF-12, and were higher than those of MF-9 ( Figure 9A), HAI results showed that the serum HAI titers of antigen fusion ferritin (MF-15) and HA antigen fusion T4 and ferritin (MF-34) structure vaccines on D28 were not much different, and were 2 times and 4 times that of HA antigen fusion double T4 (MF-12) and HA antigen fusion T4 (MF-9) ( Figure 9 B).

[0295] The immunogenicity of different constructs was explored by varying the linker between T4 and ferritin or by increasing the amount of T4. Mice were immunized intramuscularly with a total volume of 100 μL for each test vaccine, with 50 μL administered per quadriceps femoris muscle. The group number, construct, and vaccine dose for each test vaccine are shown in Table 12 below.

[0296] Table 12

[0297]

[0298] Mice were immunized with one dose on day 0, and serum was collected on day 21. The antibody content in serum of mice immunized with MF-35 (HA antigen fused with T4 and ferritin structure 2) and MF-37 (HA antigen fused with double T4 and ferritin structure) was higher than that of MF-15, and the HAI titer also showed similar results. Among them, MF-37 was better than MF-35, and the immune effect of MF-35 was slightly stronger than that of MF-15 ( Figure 10 A and B), the immune effect of MF-34 is consistent with that of MF-15 ( Figure 9 MF-34 is a rigid PAPAP linker, and MF-35 is a flexible and rigid GSGGGGEAAAKEAAAK linker, indicating that the different linkers between T4 and ferritin have a great influence on the antigen protein structure and immunity.

[0299] In summary, it can be seen that when ferritin and linkers are added to the T4 structure, the immune effect of the vaccine is greatly improved or remains the same as when no ferritin is added. The choice of flexible or rigid linkers should be determined based on the structure of the antigen. Whether ferritin can exert an ideal immune effect should be judged in combination with the type and length of the linker. Moreover, the immune effect of the double T4 structure-coupled ferritin vaccine is better than that of the single T4-coupled ferritin vaccine.

[0300] Example 4. Effects of different amounts of T4 fold domains and / or ferritin combinations on the expression of influenza virus HA protein mRNA vaccine in 293F cells

[0301] Combinations of T4 and combinations of T4 and ferritin induce different immune effects in mice. HA antigen designs containing 1, 2, 3, and 4 T4 structures, as well as shortened T4 structures (lacking 11 aa) and T4 / ferritin mixed structures are compared in Table 13. The expression and distribution of these antigens in 293F cells were detected by transfecting the corresponding mRNA.

[0302] Table 13

[0303]

[0304] After non-reducing treatment, HA antigen protein was detected in the cell supernatant of MF-9, MF-12, MF-32, MF-33, MF-31 and MF-15, among which the proportion of trimer was less than that of monomer T4 structure (MF-9) than that of di / tri / tetra T4 structure (MF-12 / MF-32 / MF-33) ( Figure 11 ), the double / triple / quadruple T4 structures were expressed and distributed in the same manner in 293F cells, and induced similar immunity in mice ( Figure 5 and 6 MF-34 and MF-35 detected a small amount of HA antigen protein, while MF-37 did not detect any obvious HA antigen protein ( Figure 11 ), a large number of proteins are expressed in cells, and they can stimulate the immune response in mice ( Figure 10 The grayscale calculation and statistical WB gel image of Image showed that the supernatant MF-31 trimer accounted for 41.7% of the total supernatant HA antigen protein, which was higher than other structures ( Figure 11 ), while the protein content in the cell lysate was less than that of MF-9.

[0305] The results showed that although the expression patterns of different structural mRNAs in 293F cells were not completely consistent with the immunity in mice, different numbers of T4 folding domains and / or ferritin combinations could induce normal immune responses in mice, indicating that the combinations between T4s and between T4 and ferritin were highly flexible, and various combinations would not affect the effect of the immune response.

[0306] Example 5. Effects of Dual T4 and Different HA Sequence Length Combinations on the Immunogenicity of Influenza Virus HA Protein mRNA Vaccine in Mice

[0307] Here, the extracellular domain (18-526aa) of the PR8 strain HA (H1 / Puerto Rico / 8 / 1934 (EPI159360)) was initially selected as the antigen design, and the full-length HA sequence (1-565aa), full-length HA and double T4 combination were used to design mRNA vaccines for comparative analysis as shown in Table 14 below.

[0308] Table 14

[0309]

[0310] The full length of HA includes the extracellular domain, transmembrane region and intracellular domain. No HA protein was detected in the supernatant of 293F cells. Mice were immunized with one dose each on day 0 and day 14, and sera from immunized mice were collected on day 14, day 21 and day 28. The HAI titer of the serum from mice immunized on day 14 showed that MF-9 produced a weak immune response with an HAI titer of less than 40; the HAI titer of the serum from mice immunized with MF-39 was greater than 160, indicating a strong immune response; the HAI titer of the serum from mice immunized with other structural vaccines was also greater than 80 ( Figure 12 The HAI titer of the serum of the immunized mice increased significantly after immunization. The HAI titer of the serum of the MF-9 immunized mice reached 640 on D21 and 1280 on D28. The HAI titer of the serum of the MF-39 immunized mice on D21 and D28 was greater than 2560 ( Figure 12 ), the results showed that the full-length HA sequence outperformed the T4 construct (MF-9) and ferritin construct (MF-15) in previous D28 data. Serum HAI titers in mice immunized with MF-12 and MF-40 were above 2560 on D28, indicating that the dual T4 construct plus the full-length or extracellular domain antigens had the same immune effect.

[0311] MF-18 is slightly weaker than MF-39 at the initial stage of immunization. The study was conducted using doses of 3 and 0.3 μg / mouse and an antigen sequence containing a transmembrane region (TM, represented herein as HA (1-555aa)). See Table 15 for details.

[0312] Table 15

[0313]

[0314]

[0315] Mice were immunized with one dose on day 0, and sera were collected on days 28, 47, 63, and 75. In the 0.3 μg / mouse immunization group, the HAI titers of sera from mice immunized with MF-18 and MF-61 on day 28 varied greatly from individual to individual, while the HA titers of sera from mice immunized with MF-39 were uniform. The HAI titers of sera from mice immunized with MF-18 on days 47, 63, and 75 were higher than those of MF-39 and MF-61 ( Figure 13 A). In the 3 μg / mouse immunization group, the HAI titers of the serum of mice immunized with MF-61 on D28 were quite different, while the HAI titers of the serum of mice immunized with MF-18, MF-39 and MF-61 on D47, D63 and D75 were all above 640 ( Figure 13 The neutralizing antibodies in serum of immunized mice D28 were detected by microneutralization test. The neutralization titer of MF-61 in the 0.3μg / mouse and 3μg / mouse immunization groups was slightly better than that of MF-39 and MF-18 ( Figure 13 C).

[0316] HA1 is the main antigenic determinant that can induce neutralizing antibodies. Due to the antigenic drift and antigenic conversion of HA1, the conservation of HA1 is very poor. Some strategies attempt to induce protective immune responses against HA1 and HA2 across subtypes, thereby providing broader protection.

[0317] Here, HA1 and HA extracellular domain were selected as antigens for study, as shown in Table 16 below.

[0318] Table 16

[0319]

[0320] Mice were immunized with one dose on day 0, and sera from the immune mice were collected on days 14, 21, 42, and 67. HA1 antigens used were single T4 (MF-13) and double T4 (MF-75). At a dose of 3 μg / mouse, the HAI titer of serum from mice immunized with MF-13 on D14 was 20, while that of serum from MF-75 was 80. The HAI titer of serum from mice immunized with MF-13 on D42 and D67 remained stable at 320, while that of serum from MF-75 was 640 ( Figure 14 ), indicating that the dual T4 structure is superior to the single T4 structure. MF-18 uses the HA extracellular domain antigen, and MF-75 uses the HA1 antigen. At a dose of 3 μg / mouse, the serum HAI titer of MF-18-immunized mice on D14 was 160-640, while the serum HAI titer of MF-75 was 80-160; the serum HAI titer of MF-18-immunized mice on D67 was 1280-2560, while the serum HAI titer of MF-75 was 640-1280, which is a very significant difference ( Figure 14 ); The serum HAI titer of mice immunized with MF-18 at a dose of 1 μg / mouse was lower than that of the 3 μg / mouse group and was the same as that of the 3 μg / mouse group with MF-75 ( Figure 14 The results showed that under single immunization conditions, antigens containing HA1 and HA2 fragments could stimulate more immune responses.

[0321] In summary, the single, double, and multi-T4 fibrin structures provided herein are all compatible with the antigenic structure of the HA protein. Furthermore, regardless of whether the HA protein antigenic structure is full-length, partial, or even a portion of the structural domain, the trimer structure provided herein exhibits significant compatibility without compromising the immune response. Furthermore, it can be seen that when the antigenic structure includes both HA1 and HA2 fragments and the vaccine is a double or multi-T4 fibrin structure, the immune response is even greater.

[0322] Example 6. Effect of immune polypeptides on the immunogenicity of dual T4-HA protein mRNA vaccine in mice

[0323] The influenza virus HA protein mRNA vaccine sequence can enhance immunogenicity by adding additional polypeptide sequences.

[0324] The polypeptide sequences tested in this example include the influenza virus M2e sequence (SLLTEVETPIRNEWGCRCNDSSD (SEQ ID NO. 104)); the CC helix sequence capable of forming a trimer (LTNSIKANETNIASVTQEVNTAKGNISSLQGDVQALQEA (SEQ ID NO. 105) and GNNSAGIKGQVVALNTLVNQEA (SEQ ID NO. NO.106); Aβ16–36 peptide, which can assemble into hexamers in solution; dendritic cells (DCs), which play a key role in adaptive immunity by presenting antigens and thereby priming naive T cells; using a phage-displayed peptide library to identify specific DC-binding peptides, the DC-peptide was fused with the hepatitis C virus nonstructural protein 3 (NS3), while retaining DC targeting selectivity and antigen immunogenicity. The NS3-DC peptide fusion protein was effectively presented to CD4+ and CD8+ T cells derived from HCV-positive blood cells, inducing their activation and proliferation; Fc-receptor peptides compete with the Fc portion of IgG for binding to the Fc receptor. The results are summarized in Tables 17 and 18.

[0325] Table 17

[0326]

[0327]

[0328] Mice were immunized with one dose on day 0, and sera were collected from the immune mice on days 14, 21, 28, and 105. The HAI titer of mice immunized with the M2e peptide as a guide peptide and the antigen (MF-63) structure vaccine was greater than 40 on day 14, which was lower than the HAI titer of MF-18 (over 160). The HAI titer of the serum of mice immunized with MF-63 on day 21 was above 160, lower than the HAI titer of MF-18 (over 640). The neutralizing antibody titer of MF-63 serum was lower than that of MF-18 by microneutralization test, which was consistent with the HAI titer. The HAI titer of the serum of mice immunized with MF-63 on day 28 was above 320, lower than the HAI titer of MF-18 (over 640). The M2e antibody content was not tested. The M2e peptide as a guide peptide weakened the immune effect of HA of MF-18 vaccine ( Figure 15A and B). The HAI titer of mice immunized with CC helical structures (MF-64 and MF-65) at D14 was greater than 80, which was lower than the HAI titer of MF-18 (over 160); the HAI titer of the serum of mice immunized with MF-64 at D21 was above 160, which was lower than the HAI titer of MF-18 (over 640); the HAI titer of the serum of mice immunized with MF-65 at D21 was above 320, which was lower than the HAI titer of MF-18 (over 640); the neutralizing antibody titer of MF-65 serum was lower than that of MF-18 as detected by microneutralization test, which was consistent with the HAI titer; the HAI titer of the serum of mice immunized with MF-65 at D105 was above 640, which was consistent with the HAI titer of MF-18 (over 640) (such as 15A and B). The highest HAI titer of the serum of mice immunized with hexameric polypeptide structure (MF-66) was 320, which was lower than the 1280 of MF-18, and there was a significant difference ( Figure 15 A).

[0329] The polypeptide FYPSYHSTPQRP (SEQ ID NO.107) can bind to DC cells and is placed at the N-terminal structure of HA antigen (MF-68) and the C-terminal of T4 protein (MF-67). The HAI titer of the serum of immunized mice on D14 after immunization is lower than that of MF-18, and the HAI titer of the serum of immunized mice on D21 and D28 is lower than that of MF-18; the neutralizing antibody titer of the serum of immunized mice on D21 is higher than that of MF-67, and higher than that of MF-68 ( Figure 15 A and B). The peptide AYYKTASLAPAE (SEQ ID NO.108) was placed at the C-terminus of the antigen and T4 (MF-69). The HAI titer of the serum of the immunized mice on D21 after immunization was lower than that of MF-18; the neutralizing antibody titer of the serum of the immunized mice on D21 after immunization was higher than that of MF-69 ( Figure 15 A and B). The peptide SLSLLTMPGNAS (SEQ ID NO.109) was placed at the C-terminus of the antigen and T4 (MF-70). The HAI titer of the serum of the immunized mice on D21 after immunization was slightly lower than that of MF-18; the neutralizing antibody titer of the serum of the immunized mice on D21 was not much different between MF-18 and MF-69, and the HAI of the serum of the immunized mice on D105 of MF-18, MF-67 and MF-70 were the same, indicating that the addition of the short peptides FYPSYHSTPQRP (SEQ ID NO.107) and SLSLLTMPGNAS (SEQ ID NO.109) to the C-terminus of the double T4 structure caused the same antigen immunity as the double T4 structure ( Figure 15 A and B). The HAI titer of the serum of mice immunized with the FC receptor peptide structure (MF-71) was lower than that of MF-18, and the neutralizing antibody titer of the serum of mice immunized with D21 MF-71 was also lower than that of MF-18 ( Figure 15It should be understood that the polypeptides used in MF-67 to MF-71 are all referred to as peptides in Table 1, which should not be regarded as a limitation of the present application.

[0330] This example also tested the unique Exin21 (CAACCGCGGTTCGCGGCCGCT (SEQ ID NO. 112)) sequence, which encodes a 7-mer peptide (QPRFAAA) to increase protein expression and secretion by increasing mRNA synthesis and stability. The vaccine antigen was selected from the PR8 strain HA or full-length, with an IgG K signal peptide (METPAQLLFLLLLWLPDTTG (SEQ ID NO. 111)) or its own signal peptide.

[0331] Table 18

[0332]

[0333] The HAI titer of serum from mice immunized with the fusion structure of Exin21 sequence (MF-48) on day 35 was the same as that of MF-18 ( Figure 16 ).

[0334] In summary, for the double T4 structure vaccine provided in this application, the addition of Fc guide peptide on the basis of HA antigen has an effect on HA immunity, while the addition of Exin21 and DC binding peptide has no effect on HA immunity.

[0335] Example 7. Effect of immunization dose

[0336] The mRNA vaccine was administered twice, on days 0 and 14. The serum HAI titer of mice immunized on day 14 was significantly lower than that on day 21, indicating that the second dose enhanced the mice's immunity. Here, two doses and a single dose were performed with different double T4 modified constructs, as shown in Table 19 below.

[0337] Table 19

[0338]

[0339]

[0340] Mice in groups 6-9 were immunized with one dose on day 0, and sera from the immunized mice were collected on days 21, 28, 35, and 63. The results showed that the HAI titer of MF-9 was less than 40 21 days after the initial immunization and reached 80 on day 35; the HAI titer of MF-15 was greater than 80 21 days after the initial immunization and greater than 160 28 days after the initial immunization; the HAI titer of MF-12 was greater than 40 21 days after the initial immunization and reached more than 160 63 days after the initial immunization; the HAI titer of MF-22 was greater than 80 21 days after the initial immunization and reached more than 160 on day 28, and was significantly different from that of MF-9 ( Figure 17B). Groups 1-4 mice were immunized with one dose each on days 0 and 14, and sera from the immunized mice were collected on D21, D28, and D35. The HAI titer of the sera from the immunized mice was greater than that of a single immunization ( Figure 17 A), indicating that immunization with 3 μg / mouse can enhance the immune response in mice. Serum HAI titers in mice immunized with MF-12 and MF-22 alone reached over 160 on Day 28, demonstrating that even a single immunization can produce an effective immune response. Furthermore, serum HAI titers in mice immunized with MF-9 double immunization were over 160 on Day 21, indicating that a single immunization with the dual T4 vaccine can achieve the same initial protective effect as a single T4 double immunization. The efficacy of two immunizations is greater than that of a single immunization, demonstrating that the vaccines provided herein can provide ideal immune responses, and that immune strength is positively correlated with the number of immunization doses.

[0341] Example 8. Immunogenicity experiment of novel coronavirus Spike protein (RBD domain) mRNA vaccine in mice

[0342] The SARS-CoV-2 Spike protein (WT RBD domain, 334-535aa) was used as the antigen. The immune responses to SARS-CoV-2 vaccine antigens delivered using an mRNA-LNP platform were compared against different base backbones. Female BALB / c mice, aged 6-8 weeks, were obtained from Zhejiang Weitong Lihua Laboratory Animal Technology Co., Ltd. Mice were immunized intramuscularly with a total volume of 100 μL for each test vaccine, with 50 μL administered into the quadriceps femoris. The group number and vaccine dose for each test vaccine are shown in Table 20 below.

[0343] Table 20

[0344]

[0345] Mice were immunized with one dose on day 0, and sera were collected on days 15, 21, 61, and 74. ELISA was used to detect the antibody content in the sera of immunized mice. The OD values ​​of MF-81 and MF-82 in the sera of immunized mice on day 15 were similar, while the OD values ​​of MF-83 and MF-84 were higher than those of MF-81 and MF-82 ( Figure 18 A). The OD value of MF-82 in the serum of immunized mice D21 and D61 was greater than that of MF-81, but lower than that of MF-84 ( Figure 18 B). The OD values ​​of MF-82, MF-83 and MF-84 in the serum of immune mice D74 were similar, and all were superior to MF-81 ( Figure 18 C); ELISA results showed that the serum antibody level of immunized mice reached a peak on D21 and continued to decrease thereafter ( Figure 18B and C). The neutralizing antibody levels in the serum of mice immunized with D74 were detected by pseudovirus neutralization experiments. The results showed that the IC90 of the serum of mice immunized with MF-81 was 60.6, the IC90 of the serum of mice immunized with MF-82 was 149, the IC90 of the serum of mice immunized with MF-84 was 332, and the IC90 of the serum of mice immunized with MF-83 was 289 ( Figure 18 D).

[0346] In summary, for the novel coronavirus Spike protein, the vaccine provided in this application, the double T4 structure produces higher neutralizing antibody titers than the single T4 structure, indicating that both single T4 and double T4 structures can produce effective immune responses in the novel coronavirus RBD antigen, and the double T4 vaccine structure is superior to the single T4 vaccine structure, which is consistent with the situation of HA protein.

[0347] Example 9. Long-term effects of the double T4 structure on the immunogenicity of influenza virus HA protein mRNA vaccine in mice

[0348] MF-18 can activate the immune response in mice after a single immunization, which lasts up to 105 days ( Figure 15 A) Comparing the immunization of T4 structure and full-length HA mRNA in mice, an mRNA vaccine with a dual T4 structure (MF-18 and MF-22) with a rigid EAAAK linker and a full-length HA sequence was selected, 3 μg / mouse. After a single immunization, the serum of the immune mice was continuously observed for 190 days. The experimental design is shown in Table 21 below.

[0349] Table 21

[0350]

[0351]

[0352] Also, when the mRNA vaccine sequence is the same, the late advantages of the dual T4 structure under different antigen doses are verified, and the results are statistically recorded in Table 22.

[0353] Table 22

[0354]

[0355] According to Table 21, mice were immunized with one dose on day 0, and serum was collected on days 14, 20, 28, 35, 63, 79, 118, and 190 after immunization. The HAI titer continued to increase after a single dose of immunization, reaching a maximum on day 35, and remained stable until day 190. MF-18 and MF-22 structure vaccines were slightly worse than MF-39 on day 14 after immunization. The serum HAI titer of mice immunized with MF-18 and MF-22 structure vaccines on day 28 was the same as that of MF-39. The serum HAI titer of mice immunized on day 35 and thereafter was slightly better than that of MF-39, and continued to be stable until day 190 (e.g., Figure 19The double T4 structure vaccine induced a slightly weaker immune level on D20 after a single immunization than the full-length sequence. After D28, the antibody level in the sera of immunized mice was slightly better than that of the full-length sequence and lasted until D190. The HAI titer of the serum of immunized mice on D35 after a single immunization with MF-18 was 1280 and maintained until D190. The HAI titer of the serum of immunized mice on D28 / D35 after a double immunization with single T4 structure MF-9 was 640-1280, indicating that a single double T4 immunization can achieve the effect of a single T4 double immunization.

[0356] According to Table 22, mice were immunized with one dose on day 0, and sera from the immunized mice were collected on days 14, 28, 42, and 89. The HAI titers of the sera from the immunized mice in the 0.3 μg / mouse group varied greatly from individual to individual. The HAI titers of the sera from the immunized mice on day 28 were above 160, and the HAI titers of the sera from the immunized mice on day 89 were stable at above 160 ( Figure 20 ); The serum HAI titer of mice immunized with MF-72 vaccine on D14 was slightly lower than that of MF-39, and the data after D28 showed that it was stronger than MF-39 ( Figure 20 The HAI titer of the serum of mice immunized with 3μg / mouse was uniform, and the HAI titer of the serum of mice immunized with 3μg / mouse was above 320 on D14, and the HAI titer of the serum of mice immunized with 3μg / mouse was stable above 640 on D89. Figure 20 ); The serum HAI titer of mice immunized with MF-72 vaccine on D14 was equivalent to that of MF-39, and the data after D28 showed that it was stronger than that of MF-39 ( Figure 20 ).

[0357] In summary, the double T4 structure vaccine provided in this application has a longer immune time when used as an antigen than when the full-length HA sequence is used as an antigen. The long-term immune activation of the double T4-HA sequence is better than that of the full-length HA sequence with a transmembrane region. The double T4 structure vaccine provided in this application can maintain a high serum HAI titer for 90 days or more, proving that the vaccine provided in this application has a long-term immune effect.

[0358] Example 10. Sequence Optimization of Influenza Virus HAmRNA Vaccine

[0359] Sequence optimization in mRNA vaccines is a critical step in improving vaccine expression efficiency and immunogenicity. By optimizing codons, adjusting GC content, and avoiding unfavorable mRNA structures, the efficacy and safety of mRNA vaccines can be significantly enhanced. These optimization strategies not only improve mRNA stability and translation efficiency but also ensure the correct localization and efficient expression of antigenic proteins, thereby enhancing the immune response.

[0360] Here, based on the MF-18 sequence, the sequence was optimized using artificial intelligence algorithm software (Algorithm for optimized mRNA design improves stability and immunogenicity), as shown in Table 23 below.

[0361] Table 23

[0362]

[0363] The vaccine antigen was the PR8 strain HA sequence, and the signal peptide was IgG K (METPAQLLFLLLLWLPDTTG (SEQ ID NO. 111)). Female BALB / c mice aged 6-8 weeks were obtained from Zhejiang Weitonglihua Experimental Animal Technology Co., Ltd.

[0364] Mice were immunized intramuscularly with a total volume of 100 μL for each test vaccine, with 50 μL administered per quadriceps muscle. The group number and vaccine dose for each test vaccine are shown in Table 24 below.

[0365] Table 24

[0366]

[0367] Based on MF-18, the sequence was optimized using artificial intelligence algorithm software, with λ values ​​of 2, 3, 4, and 7. At a dose of 0.3 μg / mouse, ELISA results showed that the serum antibody content of mice immunized with MF-77 on D21 was positively correlated with the λ value; the serum antibody content and HAI titer of mice immunized with MF-77 on D21 were weaker than those of MF-18; the serum antibody content and HAI titer of mice immunized with MF-78 on D21 were the same as those of MF-18; the OD values ​​of MF-74 and MF-79 were higher than those of MF-18, while the HAI titer was slightly lower than that of MF-18 ( Figure 21 A and B). At a dose of 3 μg / mouse, the HAI titer of the serum of D21-immunized mice was above 320 ( Figure 21 C). At a dose of 0.3 μg / mouse, the serum antibody levels of immunized mice D116 showed no difference in MF-18, MF-76, MF-77, and MF-78, while the antibody levels of MF-74 and MF-79 were higher than those of MF-18; at a dose of 3 μg / mouse, the antibody levels of MF-74 and MF-79 were also higher than those of MF-18 ( Figure 21 D). At a dose of 0.3 μg / mouse, the serum HAI titer of D116 mice immunized with MF-18 was higher than 160, which was better than the algorithm-optimized sequence. At a dose of 3 μg / mouse, the serum HAI titer of D116 mice immunized with MF-18 was higher than 320, which was better than MF-76. The serum HAI titer of mice immunized with the algorithm-optimized sequence was above 640, and the serum HAI titer of mice immunized with MF-74 was 1280 ( Figure 21E). These results suggest that sequence optimization in mRNA vaccines can improve immune responses. Based on a certain optimization foundation (MF-18), MF-74 can maintain higher antibody levels for a longer period of time after further optimization using artificial intelligence algorithm software.

[0368] Example 11. Antigen coupling at the N-terminus and C-terminus of double T4

[0369] Different antigens were conjugated to the N- and C-termini of the double T4 construct: the N-terminus was conjugated to the extracellular domain (18-526 aa) of the PR8 strain HA (H1 / Puerto Rico / 8 / 1934 (EPI159360)), and the C-terminus was conjugated to the SARS-CoV-2 RBD region (334-535 aa, WT RBD). Six- to eight-week-old female BALB / c mice were obtained from Zhejiang Weitong Lihua Laboratory Animal Technology Co., Ltd. Mice were immunized intramuscularly. Each vaccine was administered in a total volume of 100 μL, with 50 μL administered intramuscularly to the quadriceps femoris. The group number and vaccine dose for each vaccine tested are shown in Table 25 below.

[0370] Table 25

[0371]

[0372] Mice were immunized with one dose on day 0, and serum was collected on days 21, 28, and 32 after immunization. The anti-RBD antibody levels in serum of mice immunized with MF-83 and MF-91 on days 21 and 28 were detected by ELISA. The results showed that MF-91 could also detect a higher antibody level ( Figure 22 A); HAI method was used to detect serum HAI in mice immunized with MF-72 and MF-91 on day 32. The results showed that the average HAI titer of serum in mice immunized with MF-91 was above 80 ( Figure 22 B) The above results indicate that the N-terminus and C-terminus of Dual T4 can be coupled to different antigens simultaneously.

[0373] Example 12. Influenza virus mRNA vaccine challenge protection experiment after immunization of mice

[0374] 3μg / mouse. 21 days after a single immunization, mice were able to produce antibodies with HAI above 160. The immune response could be improved by increasing the immunization dose. The experimental design is shown in Table 26 below.

[0375] Table 26

[0376]

[0377] When MF-18 and MF-15 were immunized at 10 μg / mouse, the serum HAI titer of MF-18 was higher than that of MF-15 on D21, which lasted for 182 days. When MF-18 was immunized at 10 μg or 3 μg / mouse, the serum HAI titer of 3 μg / mouse was lower than that of 10 μg / mouse on D35. At the later stage, the serum HAI titer of mice immunized with 10 μg or 3 μg was the same, and the HAI titer was above 320 ( Figure 23 ), indicating that MF-18 elicited the same late-stage immune response at 3 μg / mouse as at 10 μg / mouse. Furthermore, the protective effects of the HA sequence with double T4s and the full-length HA sequence with transmembrane regions against a lethal dose of influenza virus were compared when mice were immunized at the same dose.

[0378] The protective efficacy of the mRNA vaccine was verified by reducing the immunization dose to 2 μg / mouse. The group number and vaccine dose for each test vaccine are shown in Table 27 below. Female BALB / c mice, aged 6-8 weeks, were obtained from Zhejiang Weitong Lihua Laboratory Animal Technology Co., Ltd. Mice were immunized intramuscularly with a total volume of 100 μL for each test vaccine, with 50 μL administered into each quadriceps femoris muscle.

[0379] Table 27

[0380]

[0381] Mice were immunized with one dose on day 0, and serum was collected on day 19. Twenty-two days after immunization, the anesthetized mice were infected with a lethal dose of A / PR8 influenza virus via nasal drops. The mice were observed and weighed every day after infection. The HAI titer of serum from immunized mice on day 19 was above 160 ( Figure 24 A) After intranasal administration of a lethal dose of A / PR8 influenza virus (50 μL / mouse) on D22, the body weight of the PBS group decreased significantly on D3, and the body weight decreased by more than 30% on D7, leading to ethical death. The body weight of mice immunized with MF-18, MF-72, and MF-39 showed no significant changes, indicating that MF-18, MF-72, and MF-39 vaccines showed good protection against influenza virus infection at the administered doses ( Figure 24 B and C).

[0382] In another mouse immunization study, the immune response to influenza virus vaccine antigens delivered using the mRNA-LNP platform was compared at different doses using different base backbones. The vaccine antigen selected was the PR8 strain HA sequence, and the signal peptide was its own signal peptide. Female BALB / c mice aged 6-8 weeks were obtained from Zhejiang Weitong Lihua Laboratory Animal Technology Co., Ltd. Mice were immunized intramuscularly, with a total volume of 100 μL for each test vaccine, and 50 μL / quadriceps immunization. The group number and vaccine dose of each test vaccine are shown in Table 28 below, to verify the protection test at a lower dose (1 / 0.25 ug dose).

[0383] Table 28

[0384]

[0385] Mice were immunized with one dose on day 0. 21 days after immunization, the anesthetized mice were infected with a lethal dose of A / PR8 influenza virus via nasal drops. The mice were observed and weighed daily after infection. On day 21, a lethal dose of A / PR8 influenza virus (50 μL / mouse) was administered intranasally. The body weight of the PBS group showed a significant decrease on day 4, and on day 8, the weight loss exceeded 30%, reaching ethical death. There was no significant change in the body weight of mice immunized with MF-72 and MF-39, indicating that MF-72 and MF-39 vaccines showed good protection against influenza virus infection at a dose of 0.25 μg / mouse. Figure 25 A and B).

[0386] Therefore, it can be seen that when the vaccine provided by this application is administered to mice, an excellent immune response can be generated within D19-D21 days. This immune response can stabilize the weight of mice under the administration of a lethal dose of virus, thereby preventing the death of mice, proving that the vaccine provided by this application can still provide good protection to subjects when infected with a lethal dose of virus. In addition, the vaccine structure provided by this application can trigger an immune response well at high or low immunization doses, indicating that the long-term immune effect brought about by the vaccine structure provided by this application is not affected by the immunization dose.

[0387] Example 13. Immunization of Influenza Virus mRNA Vaccine and Protein Vaccine in Mice

[0388] The mRNA vaccine MF-18 structure produced favorable immune and protective effects in mice ( Figure 24 ) were compared with HA trimer protein (TargetMol, Influenza A H1N1 (A / Puerto Rico / 8 / 1934) Hemagglutinin / HA trimer Protrin, TMPY-06331). Mice were immunized intramuscularly. Each vaccine was administered in a total volume of 100 μL, with 50 μL administered per quadriceps femoris muscle. The group number, structure, and vaccine dose of each vaccine tested are shown in Table 29 below.

[0389] Table 29

[0390]

[0391] Mice were immunized with one dose of HA protein added with aluminum adjuvant on day 0. Sera of the immunized mice were collected on D15 and D21. ELISA results showed that the anti-HA antibody content in the serum of mice at the dose of MF-18 of 1 μg / mouse and 2 μg / mouse was higher than that of the 5 μg / mouse HA protein vaccine, and the difference was significant ( Figure 26 A); HAI titer test results show that the MF-18 structural immune effect is due to the HA protein vaccine ( Figure 26 B).

[0392] Therefore, it can be seen that in the case of single-dose immunization, the MF-18 structure mRNA vaccine is superior to the 5μg / mouse HA protein vaccine at a dose of 1μg / mouse.

[0393] Although the embodiments of the present application are described above with reference to the accompanying drawings, the present application is not limited to the above-mentioned specific embodiments and application fields. The above-mentioned specific embodiments are merely illustrative and instructive, and not restrictive. A person of ordinary skill in the art, guided by this specification and without departing from the scope of protection of the claims of this application, may also devise various forms, all of which fall within the scope of protection of this application.

Claims

1. A vaccine comprising: 1) a peptide oligomer consisting of 2-8 copies of the bacteriophage T4 fiber protein C-terminal polypeptide and one or more antigenic proteins; or 2) the encoding nucleic acid of item 1), in, In the peptide oligomer, 2-8 copies of the phage T4 fiber protein C-terminal polypeptide are directly connected in series through a chemical bond or each phage T4 fiber protein C-terminal polypeptide is connected to each other through a peptide linker, and the peptide oligomer and the antigen protein are directly connected through a chemical bond or through a peptide linker.

2. The vaccine according to claim 1, wherein the N-terminus of the peptide oligomer is linked to the C-terminus of the antigen protein.

3. The vaccine according to claim 1 or 2, wherein the C-terminus of the peptide oligomer is linked to the N-terminus of the antigen protein.

4. The vaccine according to any one of claims 1 to 3, wherein The antigen protein is a viral antigen protein or a bacterial antigen protein having a trimer spatial structure in its natural state. Optionally, the antigen protein is one or more selected from the following: novel coronavirus Spike protein, influenza virus HA protein or its functional fragment or functional derivative.

5. The vaccine according to any one of claims 1 to 4, comprising one or more of the following amino acid sequences or nucleotide sequences, wherein the amino acid sequence or nucleotide sequence comprises a sequence as shown in SEQ ID NO. 1 to 62, Or comprising an amino acid sequence or nucleotide sequence that has at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the amino acid sequence or nucleotide sequence over its entire length.

6. The vaccine according to any one of claims 1 to 5, wherein the peptide linker is a rigid peptide linker or a flexible peptide linker; preferably, the peptide linker is (EAAAK) n 、(G) n , (GS) n 、(XP) n 、(GGGGS) n or (GSA) n ,in, n is any positive integer between 1-20, 1-15, 1-10, 1-5, or 1-3; more preferably, the peptide linker is selected from one or more of GS, EAAAK, EAAAAKEAAAK, PA, GSAGSA, GGASAGG.

7. The vaccine according to any one of claims 1 to 6, further comprising an adjuvant, wherein The adjuvants are inorganic adjuvants, organic adjuvants, oil-based adjuvants, cytokines, particulate adjuvants, virosomes, bacterial adjuvants, synthetic adjuvants, synthetic polynucleotide adjuvants and immunostimulatory oligonucleotides containing unmethylated CpG dinucleotides.

8. A fusion protein comprising 2-8 copies of a bacteriophage T4 fiber protein C-terminal polypeptide and one or more antigenic proteins, wherein: The 2-8 copies of the bacteriophage T4 fiber protein C-terminal polypeptides are directly connected in series through a chemical bond or each bacteriophage T4 fiber protein C-terminal polypeptide is connected to each other through a peptide linker, and the C-terminal polypeptide and the antigen protein are directly connected through a chemical bond or through a peptide linker. 9 . The fusion protein according to claim 8 , wherein the N-terminus of the bacteriophage T4 fiber protein C-terminal polypeptide is linked to the C-terminus of the antigen protein.

10. The fusion protein according to any one of claims 8 to 9, wherein the C-terminus of the bacteriophage T4 fiber protein C-terminal polypeptide is linked to the N-terminus of the antigen protein.

11. The fusion protein according to any one of claims 8 to 10, wherein The antigen protein is a viral antigen protein or a bacterial antigen protein having a trimer spatial structure in its natural state. Optionally, the antigen protein is one or more selected from the following: novel coronavirus Spike protein, influenza virus HA protein or its functional fragment or functional derivative.

12. The fusion protein according to any one of claims 8 to 11, comprising one or more of the following amino acid sequences: the amino acid sequence comprising the sequence shown in SEQ ID NO. 1-57, Or comprising an amino acid sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the entire length of the amino acid sequence.

13. The fusion protein according to any one of claims 8 to 12, wherein the peptide linker is a rigid peptide linker or a flexible peptide linker; preferably, the peptide linker is (EAAAK) n 、(G) n , (GS) n 、(XP) n 、(GGGGS) n or (GSA) n ,in, n is any positive integer between 1-20, 1-15, 1-10, 1-5, or 1-3; more preferably, the peptide linker is one or more selected from GS, EAAAK, EAAAKAAAK, PA, GSAGSA, GGASAGG.

14. A nucleic acid encoding the fusion protein of any one of claims 8 to 13, optionally comprising a nucleotide sequence selected from any one of SEQ ID NOs. 58 to 62, or a nucleotide sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

15. A vector comprising the nucleic acid of claim 14.

16. A host cell comprising the nucleic acid of claim 14 or the vector of claim 15.

17. A pharmaceutical composition comprising the vaccine according to any one of claims 1 to 7, the fusion protein according to any one of claims 8 to 13, the nucleic acid according to claim 14, the vector according to claim 15, and a pharmaceutically acceptable carrier or excipient.

18. A peptide oligomer composed of 2-8 copies of a bacteriophage T4 fibrin C-terminal polypeptide, wherein the 2-8 copies of the bacteriophage T4 fibrin C-terminal polypeptide are directly linked in series by a chemical bond or each bacteriophage T4 fibrin C-terminal polypeptide is linked to each other by a peptide linker. Optionally, the peptide oligomer comprises 2-8 copies of the amino acid sequence shown in SEQ ID NO. 63, or comprises 2-8 copies of an amino acid sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence shown in SEQ ID NO.

63.

19. The peptide oligomer according to claim 18, comprising any one or more amino acid sequences selected from SEQ ID NO. 64-103, or an amino acid sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

20. Use of the peptide oligomer according to claim 18 or 19 for promoting immune response to antigenic proteins in a subject, preferably, the subject is a mammal, more preferably, the subject is a human.

21. The use according to claim 20, wherein the antigen protein is a viral antigen protein or a bacterial antigen protein having a trimer spatial structure in its natural state, and optionally, the antigen protein is one or more selected from the following: SARS-CoV-2 Spike protein, influenza virus HA protein or its functional fragment or functional derivative.

22. The use according to claim 21 or 22, wherein the peptide linker is a rigid peptide linker, a flexible peptide linker or other types of peptide linkers; preferably, the peptide linker is (EAAAK) n 、(G) n , (GS) n 、(XP) n 、(GGGGS) n or (GSA) n ,in, n is any positive integer between 1-20, 1-15, 1-10, 1-5, or 1-3; more preferably, the peptide linker is one or more selected from GS, EAAAK, EAAAKAAAK, PA, GSAGSA, GGASAGG.

23. An immunogenic polypeptide comprising a peptide oligomer according to claim 18 or 19 and one or more antigenic proteins, optionally wherein the antigenic protein is a viral antigenic protein or a bacterial antigenic protein having a trimer spatial structure in its native state, optionally wherein the antigen is a novel coronavirus Spike protein, an influenza virus HA protein, or a functional fragment or functional derivative thereof.

24. The immunogenic polypeptide according to claim 25, comprising one or more amino acid sequences selected from SEQ ID NOs. 1-57, Or comprising an amino acid sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the amino acid sequence.

25. A method for preventing or treating a disease, comprising administering to a subject an effective amount of the vaccine according to any one of claims 1-7, the fusion protein according to any one of claims 8-13, the nucleic acid according to claim 14, the vector according to claim 15, the pharmaceutical composition according to claim 17, the peptide oligomer according to claim 18 or 19, or the immunogenic polypeptide according to claim 23 or 24, optionally, the disease comprises a viral infection or a bacterial infection, optionally, the viral infection comprises a new coronavirus or influenza virus infection.

Images