Traditional Chinese medicine immunopotentiator for animal vaccines

Abstract

The invention provides a traditional Chinese medicine immunopotentiator for animal vaccines, and belongs to the technical field of animal vaccines. The traditional Chinese medicine immunopotentiator is prepared by compounding ginsenoside, polygonatum polysaccharide and atractylodes macrocephala koidz polysaccharide and carrying out digestion treatment by using helicase. In-vitro tests detect that the hemolysis rate of the traditional Chinese medicine immunopotentiator digested by helicase is reduced to 3.78% and is greatly reduced compared with the hemolysis rate of a conventional traditional Chinese medicine immunopotentiator which is not digested by helicase; and the helicase digestion traditional Chinese medicine immunopotentiator can improve the expression levels of interferon alpha and interferon gamma of the porcine lymphocytes and enhance the immune response of the porcine lymphocytes. The porcine epidemic diarrhea virus subunit vaccine containing the helicase digestion traditional Chinese medicine immunopotentiator is good in safety, and the titer of a porcine epidemic diarrhea virus neutralizing antibody of immune piglet serum is remarkably improved.

Description

Technical Field

[0001] The invention belongs to the technical field of animal vaccines, and in particular relates to a traditional Chinese medicine immunopotentiator for animal vaccines. Background Art

[0002] Vaccination is currently the most effective and reliable method for preventing and controlling numerous infectious diseases in livestock and poultry. While rapid advances in vaccine research have brought many animal infectious diseases under control, challenges remain, such as low vaccination efficiency, short duration of immunity, and the need for multiple vaccinations. Animal vaccine immunopotentiators are a class of adjuvants used to enhance the effectiveness of vaccines and strengthen the immune response in animals. They stimulate the immune system, improve antigen presentation, or modulate immune responses, helping animals develop faster, stronger, and longer-lasting protection.

[0003] Currently, animal vaccine immunopotentiators that are being used or studied extensively in clinical practice primarily fall into the cytokine category, such as interferon (IFN-γ), interleukins (IL-2, IL-12), and tumor necrosis factor (TNF-α). These are rarely used in livestock and poultry vaccines due to their high cost. Microbial derivatives, such as CpG oligonucleotides and bacterial lipopolysaccharides (LPS), can trigger excessive inflammatory responses, leading to redness, swelling, and inflammation at the immunization site, and safety concerns remain. Plant extracts, such as plant polysaccharides and plant saponins, can directly stimulate Th1 immune responses and enhance vaccine efficacy. While single-ingredient plant polysaccharides or saponins often have weak immunopotentiating effects, rational combinations of plant polysaccharides and saponins derived from traditional Chinese medicine can achieve significant immunopotentiating effects. However, safety issues such as hemolysis and swelling at the immunization site, which need to be addressed, are associated with the use of these polysaccharides and saponins. Developing rational combinations of plant polysaccharides and saponins and enhancing their safety through biological treatments is expected to yield safe and effective animal vaccine immunopotentiators. Summary of the Invention

[0004] The present invention aims to provide a traditional Chinese medicine immunopotentiator for animal vaccines, belonging to the technical field of animal vaccines.

[0005] To achieve the above object, the present invention provides the following technical solutions: First, the present invention provides a traditional Chinese medicine immunopotentiator for animal vaccines, which is composed of a compound of ginsenosides, polygonatum polysaccharide, and atractylodes polysaccharide, and is prepared by snail enzyme digestion.

[0006] Furthermore, the mass ratio of ginsenosides, polygonatum polysaccharide and atractylodes macrocephala polysaccharide in the traditional Chinese medicine immunopotentiator is 2:1:1.

[0007] Furthermore, the preparation method of the Chinese medicine immunopotentiator is as follows: (1) Preparation of 0.1 M phosphate buffered saline (PBS, pH 7.2–7.4): Weigh 29 g of Na2HPO4·12H2O and 3 g of NaH2PO4·2H2O, adjust the pH to 7.2–7.4 with HCl / NaOH, and dilute to 1 L with deionized water. (2) Add 20 g of ginsenoside, 10 g of polygonatum polysaccharide, and 10 g of atractylodes macrocephala polysaccharide to 1 L of PBS, stir to dissolve, then add 1 g of snail enzyme, stir and mix, place at 37 ° C for 2 hours, and keep at 70 ° C for 15 minutes; (3) The dry powder collected by spray drying is the enzyme digestion Chinese medicine immune enhancer.

[0008] Furthermore, the final concentration of the Chinese herbal immunopotentiator added to the vaccine is 100 μg / mL.

[0009] Beneficial effects: The present invention prepares a Chinese herbal immunopotentiator by compounding ginsenosides, polygonatum polysaccharides, and atractylodes macrocephala polysaccharides in a mass ratio of 2:1:1 and digesting them with snail enzyme. In vitro tests showed that the hemolysis rate of the snail enzyme-digested Chinese herbal immunopotentiator was reduced to 3.78%, which was significantly lower than the hemolysis rate of conventional Chinese herbal immunopotentiators that had not been digested with snail enzyme. In addition, the amount of interferon α expressed by lymphocytes in the snail enzyme-digested Chinese herbal immunopotentiator group was increased by 54.87% compared with the conventional Chinese herbal immunopotentiator group that had not been digested with snail enzyme, and the amount of interferon γ expressed was increased by 71.98%. When 201 adjuvant and porcine epidemic diarrhea virus S protein were emulsified, the snail enzyme-digested Chinese herbal immunopotentiator was added to a final concentration of 100 μg / mL. The porcine epidemic diarrhea virus subunit vaccine containing the snail enzyme-digested Chinese herbal immunopotentiator was safe, and the porcine epidemic diarrhea virus neutralizing antibody titer in the sera of immunized piglets was significantly increased. The snail enzyme-digested Chinese herbal immunopotentiator of the present invention is safe and effective, and has broad application prospects in the preparation of animal vaccines. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 Hemolysis test of pig red blood cells by Chinese herbal immune enhancers; Figure 2 Effects of Chinese herbal immunopotentiators on interferon expression in porcine peripheral blood lymphocytes. DETAILED DESCRIPTION

[0011] Example 1: Preparation of conventional Chinese medicine immunopotentiators Ginsenosides, Polygonatum sibiricum polysaccharide and Atractylodes macrocephala polysaccharide were mixed in a mass ratio of 2:1:1.

[0012] Example 2: Preparation of snail enzyme digestion Chinese medicine immune enhancer (1) Preparation of 0.1 M phosphate buffered saline (PBS, pH 7.2–7.4): Weigh 29 g of Na2HPO4·12H2O and 3 g of NaH2PO4·2H2O, adjust the pH to 7.2–7.4 with HCl / NaOH, and dilute to 1 L with deionized water.

[0013] (2) Add 20 g of ginsenoside, 10 g of polygonatum polysaccharide, and 10 g of atractylodes macrocephala polysaccharide to 1 L of PBS, stir to dissolve, then add 1 g of snail enzyme, stir to mix, and place at 37 ° C for 2 hours, and then keep at a constant temperature of 70 ° C for 15 minutes.

[0014] (3) The dry powder collected by spray drying is the enzyme digestion Chinese medicine immune enhancer.

[0015] Example 3: Hemolysis detection of pig erythrocytes by Chinese herbal immune enhancers (1) Preparation of 2% porcine red blood cell suspension: 4 ml of Aldrich's solution and 1 ml of porcine peripheral blood were drawn into the syringe, mixed gently, and added to a 50 ml centrifuge tube. 40 ml of normal saline (0.9% sodium chloride solution) was added, shaken, and centrifuged at 1000 r / min for 10 min. The supernatant was discarded, and the electrified red blood cells were washed three times with 0.9% sodium chloride solution as described above until the supernatant no longer showed red color. The obtained red blood cells were used to prepare a 2% red blood cell suspension with 0.9% sodium chloride solution.

[0016] (2) Sample solution preparation: Conventional Chinese herbal immunopotentiators that have not been digested with snail enzyme and Chinese herbal immunopotentiators that have been digested with snail enzyme were dissolved in 0.9% sodium chloride solution and diluted to 1 mg / mL.

[0017] (3) Negative control: normal saline (0% hemolysis).

[0018] (4) Positive control: 0.1% Triton X-100 (100% hemolysis).

[0019] (5) Incubation reaction: Take 0.5 mL of red blood cell suspension and 0.5 mL of sample solution, mix well. Incubate in a 37°C water bath for 3 hours, centrifuge at 1000 rpm for 10 minutes, and collect the supernatant.

[0020] (6) Determine absorbance: Measure the absorbance (OD value) of the supernatant at 540 nm.

[0021] (7) Calculate the hemolysis rate: Hemolysis rate (%) = (OD sample - OD negative control) / (OD positive control - OD negative control) × 100% from Figure 1As can be seen from the data, the hemolysis rate of conventional Chinese herbal immunopotentiators that were not digested with snail enzymes was 42.50%, while the hemolysis rate of the Chinese herbal immunopotentiators digested with snail enzymes was reduced to 3.78%. The Chinese herbal immunopotentiators digested with snail enzymes have good safety.

[0022] Example 4: Effect of Chinese herbal immunopotentiators on interferon expression levels in pig peripheral blood lymphocytes (1) Aseptically collect 10 mL of anticoagulated pig peripheral blood, take 5 mL of peripheral blood, tilt it at 45°C and slowly add it to a test tube containing 5 mL of lymphocyte separation solution, and centrifuge it at 2000 r / min for 10 minutes. Under sterile conditions, use a pipette to discard the upper layer, aspirate the middle layer of light-colored lymphocytes, add 10 mL of sterile PBS (pH 7.2) to wash the lymphocytes, centrifuge it at 1000 r / min for 10 minutes, and discard the supernatant. Repeat this process. Dilute the lymphocytes to 1×10 with RPMI 1640 medium containing 10% fetal bovine serum. 6 / mL, 2ml per well of a 6-well plate. The first group of lymphocytes was treated with RPMI 1640 medium containing only 10% fetal bovine serum as a blank control; the second group of lymphocytes was treated with a conventional traditional Chinese medicine immunopotentiator that had not been digested with snail enzymes to a final concentration of 100μg / mL; the third group of lymphocytes was treated with a traditional Chinese medicine immunopotentiator that had been digested with snail enzymes to a final concentration of 100μg / mL. Four replicate wells were set up for each group of cells and cultured in a 37°C, 5% CO2 incubator for 48 hours.

[0023] (2) Total RNA was extracted from the peripheral blood leukocytes of the pigs cultured for 48 h using the Trizol method and reverse transcribed into cDNA. The mRNA levels of interferon α and interferon γ in the peripheral blood lymphocytes of the pigs in each group were detected by relative real-time fluorescence quantitative PCR using cDNA as template and GAPDH as calibration.

[0024] The primers for fluorescent quantitative PCR are as follows: GAPDH-F:tggacattgtcgccatcaat GAPDH-R: gactgtgccgtggaacttgc INFα-F: ggtgctgctcagctgcaatg INFα-R:cacagcctggctcacaccag INFγ-F:agtgatgaatgatctgtcac INFγ-R:gcaggcaggatgacaattat Real-time fluorescence quantitative PCR detection reaction system (20 μL): 2×SYBR Green supermix 10 μL F / R (upstream / downstream primer) 0.4 μL / 0.4 μL Template cDNA 0.8 μL ddH2O 8.4μL from Figure 2 As can be seen, the expression levels of interferon α and interferon γ in the lymphocytes of the groups containing conventional Chinese herbal immunopotentiators (TCMs) that were not digested with snail enzymes and those digested with snail enzymes were significantly higher than those in the blank control group (P<0.05). The amount of interferon α expressed by the lymphocytes in the TCM immunopotentiators group was 54.87% higher than that in the conventional TCM immunopotentiators group, and the amount of interferon γ expressed was 71.98% higher. This shows that the TCM immunopotentiators digested with snail enzymes can increase the expression levels of interferon α and interferon γ in porcine lymphocytes and enhance the immune response of porcine lymphocytes.

[0025] Example 5: Preparation of Traditional Chinese Medicine Immunopotentiator Vaccine (1) Preparation of conventional Chinese medicine immunopotentiator vaccine: 201 adjuvant and porcine epidemic diarrhea virus S protein (CHO expression) were mixed in a mass ratio of 1:1, and conventional Chinese medicine immunopotentiator that had not been digested with snail enzyme was added to a final concentration of 100 μg / mL, and emulsified at 3000 r / min for 15 min.

[0026] (2) Preparation of snail enzyme digestion Chinese herbal medicine immune enhancer vaccine: 201 adjuvant and porcine epidemic diarrhea virus S protein (CHO expression) were mixed in a mass ratio of 1:1, snail enzyme digestion Chinese herbal medicine immune enhancer was added to a final concentration of 100 μg / mL, and emulsified at 3000 r / min for 15 min.

[0027] Example 6: Safety Test of Traditional Chinese Medicine Immunopotentiator Vaccine Fifteen healthy piglets were randomly divided into three groups of five piglets each. Group 1 received a conventional Chinese herbal immune booster vaccine (2.0 ml / pig) intramuscularly; Group 2 received a snail enzyme-digested Chinese herbal immune booster vaccine (2.0 ml / pig) intramuscularly; and Group 3, serving as the control group, received a normal saline solution (2.0 ml / pig) intramuscularly. Following vaccination, the pigs were observed for 14 days, recording any systemic adverse reactions and any inflammatory reactions such as redness, swelling, nodules, or ulcers at the vaccination site. The pigs' mental state, water intake, and food intake were also observed. Body temperature was monitored in the mornings and afternoons for three consecutive days after vaccination. Statistical data were compared with those of the control group to detect any abnormalities.

[0028] As shown in Table 1, after piglets were injected with the snail enzyme digestive herbal immune booster vaccine, their spirits, feeding, drinking, and body temperature remained normal, with no adverse reactions at the injection site or throughout the body. In contrast, two piglets injected with the conventional herbal immune booster vaccine experienced transient fever and induration at the injection site. The snail enzyme digestive herbal immune booster vaccine has a superior safety profile.

[0029] Table 1 Comparison of safety tests of Chinese medicine immune enhancer vaccines

[0030] Example 7: Efficacy test of Chinese herbal immune enhancer vaccine (1) Vaccine immunization: 30 healthy susceptible piglets were randomly divided into three groups, with 10 piglets in each group. Group 1 received a conventional Chinese herbal immune enhancer vaccine (1.0 ml / pig) intramuscularly; Group 2 received a snail enzyme digestion Chinese herbal immune enhancer vaccine (1.0 ml / pig) intramuscularly; Group 3 served as the control group and received a normal saline solution (1.0 ml / pig) intramuscularly. All immunized pigs received a booster immunization using the same method and dosage 21 days after the first immunization.

[0031] (2) Antibody detection 14 days after the second vaccination, blood was collected from all pigs in the immunized and control groups to separate serum and detect the titer of neutralizing antibodies against porcine epidemic diarrhea virus.

[0032] As shown in Table 2, the porcine epidemic diarrhea virus neutralizing antibody titers in the serum of piglets immunized with the snail enzyme digested traditional Chinese medicine immune enhancer vaccine were all above 1:64, with an average antibody titer of 1:108.8. The porcine epidemic diarrhea virus neutralizing antibody titers in the serum of piglets immunized with the conventional traditional Chinese medicine immune enhancer vaccine were all above 1:32, with an average antibody titer of 1:60.8. The porcine epidemic diarrhea virus neutralizing antibody titers in the serum of piglets in the control group were all 1:2. This shows that the snail enzyme digested traditional Chinese medicine immune enhancer can significantly increase the antibody titer produced by porcine epidemic diarrhea virus vaccine immunization and enhance the immune effect.

[0033] Table 2 Comparison of efficacy tests of Chinese herbal immune enhancer vaccines

Claims

1. A Chinese herbal immunopotentiator for animal vaccines, characterized in that: The traditional Chinese medicine immunopotentiator is prepared by compounding ginsenosides, polygonatum polysaccharide and atractylodes macrocephala polysaccharide and is digested with snail enzyme.

2. The Chinese medicine immunopotentiator according to claim 1, characterized in that The mass ratio of ginsenoside, polygonatum polysaccharide and atractylodes macrocephala polysaccharide in the traditional Chinese medicine immunopotentiator is 2:1:

1.

3. The Chinese medicine immunopotentiator according to claim 1, characterized in that The preparation method of the Chinese medicine immunopotentiator is as follows: (1) Preparation of 0.1 M phosphate buffered saline (PBS, pH 7.2–7.4): Weigh 29 g of Na2HPO4·12H2O and 3 g of NaH2PO4·2H2O, adjust the pH to 7.2–7.4 with HCl / NaOH, and dilute to 1 L with deionized water. (2) Add 20 g of ginsenoside, 10 g of polygonatum polysaccharide, and 10 g of atractylodes macrocephala polysaccharide to 1 L of PBS, stir to dissolve, then add 1 g of snail enzyme, stir and mix, place at 37 ° C for 2 hours, and keep at 70 ° C for 15 minutes; (3) The dry powder collected by spray drying is the enzyme digestion Chinese medicine immune enhancer.

4. The Chinese medicinal immunopotentiator according to claim 1, characterized in that The final concentration of the Chinese herbal immunopotentiator added to the vaccine is 100 μg / mL.

Images