Modified S1 subunit of coronavirus spike protein
By introducing cysteine mutations at the IBV spike protein position 267, the problem of insufficient expansion of IBV vaccines in cell lines and tissues was solved, and effective reproduction and enhanced cross-protection effects in various cell lines and tissue cells were achieved.
Patent Information
- Application Number
- CN202510616288.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2019-11-29
- Filing Date
- 2020-05-06
- Publication Date
- 2025-08-15
AI Technical Summary
Existing IBV vaccine strains have limited tropism in cell lines and tissues, resulting in difficulty in production and lack of extensive protective effects, especially inadequate cross-protection for different genotypes.
Effective reproduction in a variety of cell lines and tissues is achieved by introducing cysteine mutations at amino acid position 267 of avian coronavirus or IBV spike protein.
The extended reproductive capacity of IBV vaccines in a variety of cell lines and tissue cells has been achieved, which enhances the cross-protection effect of different genotypes, simplifies the production process and improves the protective efficacy of the vaccine.
Smart Images

Figure BDA0005401120830000523 
Figure BDA0005401120830000531 
Figure BDA0005401120830000571
Abstract
Description
[0001] This application is a divisional application of Chinese patent application No. 202080049745.0, filed on May 6, 2020, with the invention name “Modified S1 subunit of coronavirus spike protein”.
[0002] Sequence Listing
[0003] This application contains a Sequence Listing pursuant to 37 CFR 1.821-1.825. The Sequence Listing accompanying this application is hereby incorporated by reference in its entirety. Background Art
[0004] Avian coronavirus infectious bronchitis virus (IBV) is a prototype gamma coronavirus of the Nidovirales order, Coronaviridae family. Infectious bronchitis virus primarily infects the upper respiratory epithelium of chickens, causing respiratory disease, often complicated by secondary bacterial pathogens (Cook et al. 2012. Avian Pathol. 41: 239-250). Some IBV strains additionally affect the renal tubules, oviducts, and part of the gastrointestinal tract, leading to pathological damage and clinical symptoms in these organ systems. The virus has a worldwide presence in both commercial chickens and free-range chickens. Due to its high genomic variability, IBV is divided into a wide variety of genotypes, serotypes, and protectotypes. IBV is currently considered one of the most economically relevant viral pathogens in the poultry industry.
[0005] Infectious bronchitis virus is an enveloped virus with a 27.6kb positive single-stranded RNA genome (Cavanagh 2007.Vet.Res.38:281-297). The first two-thirds of the viral genome contains a large coding region (also designated as gene 1), divided into two open reading frames 1a and 1b, which encode at least 15 non-structural proteins involved in RNA replication, editing and transcription. The last third of the viral genome encodes structural proteins: spike protein (S, encoded by gene 2), envelope protein (E, encoded by gene 3c), membrane protein (M, encoded by gene 4), and nucleocapsid protein (N, encoded by gene 6). Proteins S, E and M are part of the viral envelope, while protein N forms the ribonucleoprotein core together with viral RNA. The coronavirus spike protein determines the tropism of the host species (Kuo et al. 2000.J.Virol.74:1393-1406). It is a dimeric or trimeric transmembrane protein that is proteolytically cleaved into two subunits, S1 and S2. The glycosylated S1 domain forms the 'head' of the spike protein and contains the receptor-binding domain that interacts with 2,3-linked sialic acids on the host cell surface (Promkuntod et al. 2014. Virology. 448:26-32). The S2 domain contains the remainder of the extracellular domain (the 'stem'), the transmembrane domain, and the intracellular domain located in the cytoplasm.
[0006] The widely used live attenuated IBV vaccine strains H52 and H120 were developed in the Netherlands in the 1960s by serial passage of the Massachusetts IBV strain in embryonated chicken eggs (Bijlenga et al. 2004; Avian Pathol. 33:550-557). These vaccine strains must also be cultured in embryonated chicken eggs for production. Today, IBV vaccines (both inactivated and live) are still grown in embryonated chicken eggs, which is cumbersome and expensive.
[0007] The only cell line-adapted IBV described to date is the IBV strain Beaudette, which replicates efficiently in Vero and BHK cells. Casais et al. 2003 (J. Virol. 77; 9084-9089) generated recombinant IBV using the extracellular domain sequence of the Beaudette spike and showed that the S protein of Beaudette is the determinant of cell line tropism, which is able to transfer the extended cell line tropism to another IBV (M41). WO 2011 / 004146 discloses that the S2 subunit from Beaudette is responsible for the extended tissue tropism. Sequences within the S2 subunit, derived from the heparan sulfate binding site of Beaudette, have been identified as responsible for the extended cell line tropism. In addition, Bickerton et al. 2018 (Journal of Virology 92 (19)) disclosed an eight-amino acid Beaudette-specific motif. However, recombinant IBV with the Beaudette spike S2 subunit is not suitable as a vaccine. Ellis et al. 2018 (J. Virol. 92 (23)) describe that recombinant Beaudette with a chimeric spike having a heterologous S1 subunit from M41 or QX combined with the Beaudette spike S2 subunit does not confer adequate protection against S1 homologous challenge. In addition, Beaudette wild type does not provide protection against homologous challenge as other licensed vaccines belonging to the Massachusetts serotype (Hodgson et al. 2004: J Virol 78: 13804–13811 or Geilhausen et al. 1973: Archiv für die gesamte Virusforschung 40: 285-290).
[0008] Fang et al. 2005 (Biochemical and Biophysical Research Communication 336; pp. 417-423) disclose that adaptation of Beaudette for propagation in Vero cells resulted in 49 amino acid modifications, 26 of which were located within the spike protein.
[0009] In summary, providing an IBV vaccine with extended cell culture or tissue tropism by exchanging the spike protein for a heterologous Beaudette spike protein does not result in an IBV vaccine that provides sufficient efficacy, and the use of the Beaudette spike sequence will be limited to protection against challenge with a Massachusetts serotype strain and lack cross-protection against further genotypes. Furthermore, the prior art motifs or sites identified in Beaudette have not yet been transferred into IBV vaccines that show both extended cell culture or tissue tropism and protective efficacy (interference between extended tropism and vaccine efficacy has not yet been shown).
[0010] Thus, there is a need for single amino acids or short motifs that can be transferred into IBV or IBV vaccines without affecting vaccine efficacy, but rather enabling extended cell or tissue tropism. DETAILED DESCRIPTION
[0011] Before describing aspects of the present invention, it must be noted that, as used herein and in the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "an antigen" includes a plurality of antigens, reference to "a virus" is a reference to one or more viruses and their equivalents known to those skilled in the art, and so forth. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although preferred methods, apparatus, and materials are now described, any methods and materials similar or equivalent to those described herein may be used in the practice or testing of the present invention. All publications mentioned herein are incorporated herein by reference for the purpose of describing and disclosing cell lines, vectors, and methods as reported in the publications that may be used in conjunction with the present invention. Nothing herein should be construed as an admission that the present invention is not entitled to antedate such disclosures by virtue of prior invention.
[0012] Composition of matter
[0013] The present invention solves the problems inherent in the prior art and provides a significant advancement in the state of the art.
[0014] Generally, the present invention provides an avian coronavirus spike protein or fragment thereof, wherein at least a portion of the S1 subunit is from an avian coronavirus with limited cell tropism or tissue tropism, and wherein at amino acid position 267 is cysteine.
[0015] Furthermore, the present invention provides a recombinant avian coronavirus spike protein or a fragment thereof comprising a mutation to cysteine at amino acid position 267.
[0016] Generally, the present invention also provides an IBV spike protein or a fragment thereof, wherein at least a portion of the S1 subunit is from an IBV with limited cell tropism or tissue tropism, and wherein at amino acid position 267 is cysteine.
[0017] Further, the present invention provides a recombinant IBV spike protein or a fragment thereof comprising a mutation to cysteine at amino acid position 267.
[0018] Advantageously, experimental data show that coronavirus strains (such as, for example, H52, QX SP2013-01478 and CR88 IBV strains) have expanded cell or tissue tropism after modifying a single position within the spike protein, position 267, to cysteine.
[0019] The term "coronavirus" is well known to those skilled in the art. In general, coronaviruses are viruses of the subfamily Coronavirinae in the family Coronaviridae, order Nidovirales. Coronaviruses are enveloped viruses with a positive-sense single-stranded RNA genome containing a helically symmetrical nucleocapsid. The term "coronavirus" includes all strains, genotypes, protective types, and serotypes of infectious bronchitis viruses. Examples of avian coronaviruses are infectious bronchitis virus (IBV); guinea fowl coronavirus (GfCoV) and turkey coronavirus (TCoV; turkey enteritis virus and blue crown virus).
[0020] The term "IBV" refers to the infectious bronchitis virus well known to those skilled in the art. The term "IBV" includes all strains, genotypes, protective types and serotypes of infectious bronchitis virus.
[0021] The term "mutation" includes modifications in viral RNA encoded proteins that result in changes in the encoded proteins. Further, the term "mutation" includes mutations in genetically engineered proteins. The term "mutation" refers to, but is not limited to, substitutions (replacement of one or several nucleotides / base pairs), deletions (removal of one, several or all nucleotides / base pairs), and / or insertions (additions of one or several nucleotides / base pairs). As used herein, mutations may be single mutations or several mutations, and therefore, the term "one or more mutations" is often used, and relates to both single mutations and several mutations. However, the term mutation is well known to those skilled in the art, and those skilled in the art can readily generate mutations.
[0022] The term "Spike" refers to a protein specific to avian coronaviruses or IBVs, well known to those skilled in the art. The Spike protein is the primary inducer of antibodies and protective immune responses. Furthermore, the Spike (S) protein facilitates cellular entry of avian coronaviruses or IBVs by binding to cellular receptors on host cells and mediating virus-cell membrane fusion with the host cell membrane. Furthermore, it determines the tissue and cell tropism of the viral strain.
[0023] The terms "protein," "amino acid," and "polypeptide" are used interchangeably. The term "protein" refers to an amino acid sequence composed of naturally occurring amino acids and their derivatives. Naturally occurring amino acids are well known in the art and are described in standard textbooks of biochemistry. Within an amino acid sequence, the amino acids are linked by peptide bonds. Furthermore, the two ends of an amino acid sequence are referred to as the carboxyl terminus (C-terminus) and the amino terminus (N-terminus). The term "protein" includes substantially purified proteins or protein preparations that additionally contain other proteins. Furthermore, the term also refers to protein fragments. In addition, it includes chemically modified proteins. Such modifications can be artificial or naturally occurring modifications, such as phosphorylation, glycosylation, myristylation, and the like.
[0024] Mutation 267
[0025] In one aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the invention, the cysteine at amino acid position 267 is introduced by mutation. The word "introduced" means that the mutation has been introduced by genetic engineering (artificially, e.g., by human intervention).
[0026] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention, the mutation is an amino acid substitution, deletion or insertion.
[0027] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention, the hydrophobic amino acid at amino acid position 267 is mutated to cysteine; or the phenylalanine or leucine at amino acid position 267 is mutated to cysteine.
[0028] Extended cell tropism or tissue tropism
[0029] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention, the cysteine at amino acid position 267 or the mutation to cysteine at amino acid position 267 results in an extended cell tropism or tissue tropism of the avian coronavirus or IBV.
[0030] The term "cell or tissue" is known to those skilled in the art. The term cell includes cell lines, such as those listed elsewhere herein, as well as primary cells. The term tissue includes cells from tissues such as those listed elsewhere herein, illustratively such as primary chicken embryonic cells or primary chicken fibroblasts from the lung or liver. The term includes the propagation of cells or tissues (cells) in culture outside an organism. The term "culture" relates to the propagation of cells (e.g., cell line cells or primary cells or tissue cells) outside an organism under defined culture conditions known to those skilled in the art.
[0031] The term "extended tropism" means that avian coronavirus of the present invention or IBV can be bred in cells (e.g., cell lines) or tissue cells (except the primary chicken embryo cells from the kidney). In contrast, wild-type coronavirus or IBV (describing the IBV Beaudette strain adapted to cell line) of coronavirus vaccines (e.g., IBV vaccines) or non-cellular culture adaptation can only be bred in embryonated eggs or primary chicken embryo cells from the kidney (after adaptation). Accordingly, the coronavirus of the present invention (e.g., IBV) with expanded cell tropism or tissue tropism has the ability to infect and / or replicate in one or more cell lines or tissue cells except the primary chicken embryo cells from the kidney. Preferably, the coronavirus of the present invention (e.g., IBV) with expanded cell tropism or tissue tropism has the ability to infect and / or replicate in one or more cell lines as listed herein. Accordingly, for example, the coronavirus or IBV with expanded cell tropism or tissue tropism may have the ability to infect and / or replicate in PBS-12SF, EB66 or HEK 293T cells.
[0032] The term "restricted tropism" means that avian coronaviruses or IBVs can only grow on primary chicken embryo cells from kidney. Accordingly, coronaviruses or IBVs with restricted cell or tissue tropism do not have the ability to infect and / or replicate in, for example, PBS-12SF, EB66 or HEK 293T cells.
[0033] Advantageously, experimental data show that IBV strains, such as exemplified by H52 and CR88, have expanded cell or tissue tropism after modifying a single position within the spike protein, position 267, to cysteine. Further, it has been shown that modification to cysteine at position 267 is genetically stable.
[0034] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention, the avian coronavirus or IBV infects and / or replicates in at least one cell line or cell selected from the following list: primary chicken embryo cells or primary chicken fibroblasts from the lung or liver, chicken embryo fibroblast cell line, duck embryo stem cell line, human embryonic kidney cell line, baby hamster kidney cell line, African green monkey kidney cell line, rabbit kidney cell line, canine kidney cell line, chicken liver cell line, bovine kidney cell line, porcine kidney cell line and insect cell line.
[0035] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention, the avian coronavirus infects and / or replicates in at least one cell line selected from the following list: DF-1 (Douglas Foster), EB66 (duck embryo stem cell line), PBS-12, PBS-12SF (serum-free PBS-12), BHK21 (baby hamster kidney), HEK 293T (human embryonic kidney), Vero (Verda Reno), MA104, RK13 (rabbit kidney), LMH (leghorn male liver carcinoma), MDCK (Madin-Darby canine kidney), MDBK (Madin-Darby bovine kidney), PK15 (pig kidney), PK2A (pig kidney), SF9, SF21 and SF+ (Spodoptera frugiperda).
[0036] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention, the avian coronavirus or IBV infects and / or replicates in at least one cell line selected from the following list: DF-1, EB66, PBS-12, PBS-12SF, BHK, HEK 293T, Vero, MA104 and RK13.
[0037] Preferably, IBV infects and / or replicates in EB66, PBS-12SF or HEK 293T cell lines.
[0038] All mentioned cell lines are well known to those skilled in the art and are commercially available and / or publicly available. MDCK cells are exemplarily deposited in the American Tissue Culture Collection under accession number ATCC CCL-34 or ATCC CRL-2285. DF-1 cells are exemplarily deposited in the American Tissue Culture Collection under accession number ATCC CRL-12203. PBS-12SF cells are exemplarily deposited in the American Tissue Culture Collection under accession number ATCC PTA-8565, or are deposited in RRID under CVCL-1K17. BHK-21 cells are exemplarily deposited in the American Tissue Culture Collection under accession number ATCC CCL-10. HEK 293T cells are exemplarily deposited in the American Tissue Culture Collection under accession number ATCC CRL-3216. Vero cells are exemplarily deposited in the American Tissue Culture Collection under accession number ATCC CCL-81. MA104 cells are exemplarily deposited with the American Tissue Culture Collection under accession number ATCC CRL-2378. RK13 cells are exemplarily deposited with the American Tissue Culture Collection under accession number ATCC CCL-37.
[0039] Numbering of amino acid position 267
[0040] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the invention, the numbering of amino acid position 267 refers to amino acid position 267 in the spike protein of IBV H52, IBV H120 or M41.
[0041] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the invention, the numbering of amino acid position 267 refers to amino acid position 267 in the spike protein of IBV H52.
[0042] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the invention, the numbering of amino acid position 267 refers to amino acid position 267 in the spike protein as exemplarily given in SEQ ID NO: 1.
[0043] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention, the amino acid sequence of SEQ ID NO: 1 is used to determine the position number in the spike protein.
[0044] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention, in order to determine the amino acid position 267 in the spike protein, the amino acid sequence is aligned with the amino acid sequence of SEQ ID NO: 1.
[0045] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the invention, amino acid position 267 is within the S1 subunit of the spike protein.
[0046] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the invention, amino acid position 267 corresponds to amino acid position 269 of the spike sequence of IBV CR88.
[0047] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the invention, amino acid position 267 corresponds to amino acid position 270 of the spike sequence of IBV QX.
[0048] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the invention, amino acid position 267 corresponds to amino acid position 271 of the spike sequence of IBV Q1.
[0049] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the invention, amino acid position 267 corresponds to amino acid position 270 of the spike sequence of IBV Var2.
[0050] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the invention, amino acid position 267 corresponds to amino acid position 274 of the spike sequence of IBV Brazil.
[0051] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the invention, amino acid position 267 corresponds to amino acid position 274 of the spike sequence of IBV Ark99.
[0052] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention, the spike protein has one or more of the following amino acids selected from the group consisting of:
[0053] -264 is asparagine, and / or
[0054] -265 is threonine, and / or
[0055] -269 is leucine, and / or
[0056] -271 is asparagine, and / or
[0057] -272 is phenylalanine.
[0058] The amino acid position numbers refer to the amino acid positions within the spike protein as exemplarily given in SEQ ID NO: 1.
[0059] spike
[0060] The present invention also provides a spike protein or a fragment thereof as described above, wherein the spike protein or a fragment thereof is selected from: infectious bronchitis virus (IBV); guinea fowl coronavirus (GfCoV), turkey coronavirus (TCoV; turkey enteritis virus and blue crown virus), feline infectious peritonitis virus (FIPV), feline enteric coronavirus (FECV); transmissible gastroenteritis virus (TGEV), porcine respiratory coronavirus (PRCoV), porcine epidemic diarrhea virus (PEDV), porcine hemagglutinating encephalomyelitis virus (PHEV); severe acute respiratory syndrome coronavirus (SARS-CoV), Middle East respiratory syndrome coronavirus (MERS-CoV), human coronavirus 229E (HCoV-229E), human coronavirus NL63 (HCoV-NL63), human coronavirus HKU1 (HCoV-HKU1), human coronavirus OC43 (HCoV-OC43); canine coronavirus (CCoV), canine respiratory coronavirus (CRCoV), mouse hepatitis virus (MHV), bovine coronavirus (BCV). Thus, the present invention also provides a coronavirus spike protein or a fragment thereof, wherein at least a portion of the S1 subunit is from a coronavirus with limited cell tropism or tissue tropism, and wherein at amino acid position 267 is cysteine, and wherein the spike protein is selected from the group consisting of: infectious bronchitis virus (IBV); guinea fowl coronavirus (GfCoV), turkey coronavirus (TCoV; turkey enteritis virus and blue crown virus), feline infectious peritonitis virus (FIPV), feline enteric coronavirus (FECV); transmissible gastroenteritis virus (TGEV), porcine respiratory coronavirus (PRCoV), porcine epidemic coronavirus (PCoV), Porcine diarrhea virus (PEDV), porcine hemagglutinating encephalomyelitis virus (PHEV); severe acute respiratory syndrome coronavirus (SARS-CoV), Middle East respiratory syndrome coronavirus (MERS-CoV), human coronavirus 229E (HCoV-229E), human coronavirus NL63 (HCoV-NL63), human coronavirus HKU1 (HCoV-HKU1), human coronavirus OC43 (HCoV-OC43); canine coronavirus (CCoV), canine respiratory coronavirus (CRCoV), mouse hepatitis virus (MHV), bovine coronavirus (BCV).Furthermore, the present invention also provides a recombinant coronavirus spike protein or a fragment thereof, which comprises a mutation to cysteine at amino acid position 267, wherein the spike protein is selected from: infectious bronchitis virus (IBV); guinea fowl coronavirus (GfCoV), turkey coronavirus (TCoV; turkey enteritis virus and blue crown virus), feline infectious peritonitis virus (FIPV), feline enteric coronavirus (FECV); transmissible gastroenteritis virus (TGEV), porcine respiratory coronavirus (PRCoV), porcine epidemic diarrhea virus (PEDV), porcine hemagglutinating encephalomyelitis virus (PHEV); severe acute respiratory syndrome coronavirus (SARS-CoV), Middle East respiratory syndrome coronavirus (MERS-CoV), human coronavirus 229E (HCoV-229E), human coronavirus NL63 (HCoV-NL63), human coronavirus HKU1 (HCoV-HKU1), human coronavirus OC43 (HCoV-OC43); canine coronavirus (CCoV), canine respiratory coronavirus (CRCoV), mouse hepatitis virus (MHV), bovine coronavirus (BCV).
[0061] In another specific aspect of the avian coronavirus spike protein or its fragment according to the present invention, the avian coronavirus spike protein or its fragment is selected from: infectious bronchitis virus (IBV); guinea fowl coronavirus (GfCoV) and turkey coronavirus (TCoV; turkey enteritis virus and blue crown virus).
[0062] In another specific aspect of the avian coronavirus spike protein or fragment thereof according to the present invention, the avian coronavirus is IBV (infectious bronchitis virus).
[0063] IBV strains can be classified by serotype and genotype. Serotype classification involves treating the virus with neutralizing antibodies, while genotype classification generally involves examining the sequence of the S1 (spike) protein. However, different IBV strains are well known to those skilled in the art. Infectious bronchitis virus was first discovered in the United States in the 1930s.
[0064] The first IBV serotype identified was Massachusetts, and it remained the only serotype until the discovery of a different IBV serotype in 1956. Today, in addition to the originally identified Massachusetts type, several additional serotypes have been identified in the United States, including Arkansas and Delaware. Today, IBV Mass viruses can be identified in many countries around the world.
[0065] The IBV strain Beaudette is of the Massachusetts type and was derived after at least 150 passages in chicken embryos. The IBV strain Beaudette was originally isolated by Beaudette and Hudson (J. Am. Vet. Med. A. 90, 51-60, 1937) and passaged in chicken embryos. Other Massachusetts-type IBV strains besides Beaudette are H120, H52, and M41. The H120 strain has been passaged 120 times in embryonated chicken eggs.
[0066] IBV QX is described as a virulent field isolate of IBV originally isolated in China. However, the virus has spread to Europe and has been identified in parts of Western Europe, primarily in the Netherlands, as well as in Germany, France, Belgium, Denmark, and the United Kingdom. In addition, the QX genotype or serotype has been described in several countries in Asia and Africa.
[0067] The strain designated "Italien-02" or "Italy-02" was isolated in Italy in the late 1990s. Sequence analysis of one of these isolates was published in 2002 (NCBI-BLAST, accession number AJ457137). However, studies have shown that this Italian-02 strain is widespread in Europe and, in addition to IBV variant 4 / 91, has become one of the most prevalent genotypes in the United Kingdom, Spain, France, and the Netherlands.
[0068] Since 1996, a new infectious bronchitis virus (IBV) genotype, designated Q1, has been circulating in China and was first reported in Italy in 2011. Q1 is associated with increased mortality, renal damage, and proventriculitis.
[0069] In addition, strains D274, B1648 / D8880, D1466, V1397, and Arkansas have been identified in Europe.
[0070] Where to obtain any IBV strain is within the general knowledge of those skilled in the art. IBV strains can be purchased commercially, obtained from scientific institutions, or the genome can be synthesized as complementary DNA, as IBV strains have been sequenced and the sequences have been published and are therefore available. In addition, IBV strains can be isolated from the wild. Methods for isolating and characterizing IBV strains are well known to those skilled in the art. Valter Leonardo deQuadros 2011 (Dissertation, Das Bronchitis Virus(IBV):Molekularbiologische Untersuchungen zur Diagnostik und zum Vorkommen sowiezur des Genotyps IBV QX in spezifisch pathogenfreien(SPF)Broilern, Freie Berlin), Worthington et al. 2009 (Avian Pathology 37(3), 247-257), Liu et al. 2009 (Virus Genes 38:56-65), Dolz et al. 2006 (Avian Pathology 35(2):77-85), Farsang et al. 2002 (Avian Pathology 31:229-236) and Feng et al. 2014 (Virus Genes 49:292-303) describe how to isolate and differentiate different IBV strains.
[0071] IBV strains are typically distinguished by the coding sequence of the S1 subunit of the spike protein (Valastro et al. 2016. Infect Genet Evol. 39:349-364), but can also be distinguished by their complete nucleotide sequence or the sequence of specific proteins, such as the spike protein, nucleocapsid protein, envelope (E) protein, or membrane (M) glycoprotein. Because the spike protein determines the host tropism and antigenicity of IBV, IBV genotypes are classified by the coding sequence of subunit 1 of the spike protein. Alternatively, IBV strains can be distinguished by their serotype. Serotyping involves serological determination of the virus, which involves serotype-specific antibodies.
[0072] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention, the spike protein or fragment thereof is from an IBV having a genotype or serotype or strain selected from the following list: Arkansas (e.g., Arkansas 99), Brazil (e.g., BR-1, BR-2, 23 / 2013, IBV / Brasil / 351 / 1984), California (e.g., California 1734 / 04, California 99), Connecticut, Delaware (e.g., Delaware 98), Dutch (e.g., D207, D212, D274, D3128, D3896, D8880, D1466), Florida, Georgia (e.g., Georgia GA-07, GA-08, GA-12, GA-13), Gray, Holte, Iowa (e.g., Iowa 97 and Iowa 69), Italy02), JMK, LDT3, Maine (e.g., Maine 209), Massachusetts (e.g., M41, H52, H120; excluding Beaudette), Pennsylvania (e.g., Pennsylvania 1220 / 98, Pennsylvania Wolg / 98), PL84084, Qu (e.g., Qu-mv), QX (e.g., GB341 / 96), Q1, SE 17, variant 2 (e.g., IS / 1494 / 06, IBV / Ck / EG / CU / 4 / 2014, gammaCoV / Ck / Poland / G052 / 2016), and 4 / 91 (793B, CR88).
[0073] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention, the spike protein or fragment thereof is not from the Beaudette strain.
[0074] In another specific aspect of the IBV spike protein or its fragment according to the present invention, the spike protein or its fragment is from an IBV selected from the following genotype or serotype or strain list: Massachusetts (not Beaudette), 4 / 91, QX, Q1, Italy 02, Arkansas, Conneticut, Georgia, LDT3, PL84084, variant 2 and Brazil.
[0075] The phrase "not Beaudette" is used to exclude Beaudette. Thus, the phrase "Massachusetts (not Beaudette)" means including spike proteins or fragments thereof from Massachusetts strains such as M41, H52, and H120, but excluding spike proteins or fragments thereof from the Beaudette strain.
[0076] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention, the spike protein or fragment thereof is from an IBV selected from the following list of genotypes or serotypes: Massachusetts (not Beaudette), 4 / 91, QX, Q1, Arkansas, variant 2 and Brazil.
[0077] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention, the spike protein or fragment thereof is from an IBV selected from the following list of genotypes or serotypes: Massachusetts (not Beaudette) and 4 / 91.
[0078] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention, the Massachusetts strain is selected from the following list: H120, H52, Spain / 98 / 308, IBMA5-1, SD / 97 / 01, Spain / 96 / 334 and M41-M21883.
[0079] In another specific aspect of the IBV spike protein or its fragment according to the present invention, the 4 / 91 strain is selected from the following list: Spain / 98 / 328, Spain / 92 / 35, IR-3654-VM, FR-CR88061-88, FR-85131-85, UK-1233-95, UK / 3 / 91, Spain / 00 / 336, UK / 7 / 91, pathogenic 4 / 91, attenuated 4 / 91 and IB4-91.
[0080] In another specific aspect of the IBV spike protein or its fragment according to the present invention, the QX strain is selected from the following list: FR-L1450T-05, FR-L1450L-05, NL-L1449T-04, NL-L1449K-04, IBV / Ck / SP / 170 / 09, IBV / Ck / SP / 79 / 08, IBV / Ck / SP / 248 / 09, HBN, IBVQX, LX4, BJQ, CK / CH / LGD / 03, SP2013-01470, SP2013-014171, SP2013-01478 and GB341 / 96.
[0081] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention, the Q1 strain is selected from the following list: CK / CH / LDL / 98I, CK / CH / LSD / 08-10, J2, Q1, AR08ER22, AR08BA21, 12.185, 12.124, 12.216 and Chile-295-10.
[0082] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention, the Italy 02 strain is selected from the following list: Spain / 99 / 316, Italy-02, UK-L633-04, It-497-02, Spain / 05 / 866, Spain / 04 / 221, Spain / 00 / 337, Spain / 155 / 09 and Spain / 03 / 08.
[0083] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention, the Arkansas strain is selected from the following list: Ark99, ArkGA, ArkDPI, AL / 5364 / 00, ARKDPI11, AL / 0803 / 01, AL / 7149 / 00, ArkDPI101, AL / 1221 / 01, AL / 1793 / 01 and AL / 4614 / 98.
[0084] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention, the variant 2 strain is selected from the following list: IS / 1494 / 06, IBV / Ck / EG / CU / 4 / 2014, gammaCoV / Ck / Poland / G052 / 2016, Eg / CLEVB-2 / IBV / 012, D1344 / 2 / 4 / 10_EG, TR8 and IB VAR2-06.
[0085] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention, the Brazil strain is selected from the following list: BR-1, BR-2, 23 / 2013 and IBV / Brasil / 351 / 1984.
[0086] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention, the spike protein or fragment thereof is from an IBV of the Massachusetts (not Beaudette), QX or 4 / 91 genotype or serotype.
[0087] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention, the spike protein or fragment thereof is from an IBV of the Massachusetts (not Beaudette) genotype or serotype.
[0088] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention, the spike protein or fragment thereof is from IBV of the QX genotype or serotype.
[0089] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention, the spike protein or fragment thereof is from IBV of genotype or serotype 4 / 91.
[0090] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention, the IBV strain is H52, H120, QX SP2013-01478 or CR88.
[0091] In another specific aspect of the IBV spike protein or a fragment thereof according to the present invention, the IBV spike protein or a fragment thereof consists of or comprises: an amino acid sequence as shown in SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 77, or a sequence having at least 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.95%, 99.98% or 99.99% sequence identity thereto.
[0092] The terms "identity" or "sequence identity" are known in the art and refer to the relationship between two or more polypeptide sequences or two or more polynucleotide sequences (i.e., a reference sequence and a given sequence to be compared to the reference sequence). Sequence identity is determined by comparing a given sequence to a reference sequence after the sequences have been optimally aligned to produce the highest degree of sequence similarity, as determined by matching between strings of such sequences. In such an alignment, sequence identity is determined on a position-by-position basis, e.g., if at a particular position, the nucleotides or amino acid residues are identical, the sequences are "identical" at that position. The total number of such positional identities is then divided by the total number of nucleotides or residues in the reference sequence to give the % sequence identity. Sequence identity can be readily calculated by known methods, including, but not limited to, those described in Computational Molecular Biology, Lesk, AN, ed., Oxford University Press, New York (1988), Biocomputing: Informatics and Genome Projects, Smith, DW, ed., Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I, Griffin, AM and Griffin, HG, eds., Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology, von Heinge, G., Academic Press (1987); Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M. Stockton Press, New York (1991); and Carillo, H. and Lipman, D., SIAM J. Applied Math., 48:1073 (1988), the teachings of which are incorporated herein by reference. Preferred methods to determine sequence identity are designed to give the largest match between the sequences tested.Methods to determine sequence identity are codified in publicly available computer programs that determine sequence identity between given sequences.Examples of such programs include, but are not limited to, the GCG program package (Devereux, J. et al., Nucleic Acids Research, 12(1):387 (1984)), BLASTP, BLASTN, and FASTA (Altschul, S. F. et al., J. Molec. Biol., 215:403-410 (1990). The BLASTX program is available from NCBI and other sources (BLAST Manual, Altschul, S. et al., NCBI NLM NIH Bethesda, MD). 20894, Altschul, SF et al., J. Molec. Biol., 215:403-410 (1990), the teachings of which are incorporated herein by reference). These programs optimally align sequences using default gap weights to produce the highest level of sequence identity between a given sequence and a reference sequence. As an example, a polynucleotide having a nucleotide sequence that has at least, for example, 85%, preferably 90%, or even more preferably 95% "sequence identity" to a reference nucleotide sequence is expected to be identical to the reference sequence. The same as above, except that a given polynucleotide sequence may include up to 15, preferably up to 10, even more preferably up to 5 point mutations per 100 nucleotides of the reference nucleotide sequence. In other words, in a polynucleotide having a nucleotide sequence that is at least 85%, preferably 90%, even more preferably 95% identical to a reference nucleotide sequence, up to 15%, preferably 10%, even more preferably 5% of the nucleotides in the reference sequence may be deleted or substituted by another nucleotide, or up to 15%, preferably 10%, even more preferably 5% of the total nucleotides in the reference sequence may be deleted or substituted by another nucleotide. nucleotides can be inserted into the reference sequence. These mutations of the reference sequence may occur at the 5' or 3' terminal positions of the reference nucleotide sequence or anywhere between these terminal positions, interspersed individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence. Similarly, a polypeptide having a given amino acid sequence that has at least, for example, 85%, preferably 90%, even more preferably 95% sequence identity to a reference amino acid sequence is expected to be identical to the reference sequence, except that the given polypeptide sequence may include up to 15, preferably up to 10, even more preferably up to 5 amino acid changes per 100 amino acids of the reference amino acid sequence. In other words, to obtain a given polypeptide sequence that has at least 85%, preferably 90%, even more preferably 95% sequence identity to a reference amino acid sequence, up to 15%, preferably up to 10%, even more preferably up to 5% of the amino acid residues in the reference sequence may be deleted or substituted with another amino acid, or a plurality of amino acids up to 15%, preferably up to 10%, even more preferably up to 5% of the total number of amino acid residues in the reference sequence may be inserted into the reference sequence.These changes in the reference sequence may occur at the amino or carboxyl terminal positions of the reference amino acid sequence or at any position between these terminal positions, individually interspersed among residues in the reference sequence or in one or more contiguous groups within the reference sequence. Preferably, residue positions that are not identical differ by conservative amino acid substitutions. However, conservative substitutions are not included as matches when determining sequence identity.
[0093] The terms "identity", "sequence identity" and "percentage identity" are used interchangeably herein. For the purposes of the present invention, it is defined herein that in order to determine the percentage identity of two amino acid sequences or two nucleic acid sequences, the sequences are compared for optimal comparison purposes (e.g., a gap can be introduced into the sequence of a first amino acid sequence or nucleic acid sequence for optimal comparison with a second amino acid sequence or nucleic acid sequence). The amino acids or nucleotide residues at corresponding amino acid or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid or nucleotide residue as the corresponding position in the second sequence, the molecules are identical at that position. The percentage identity between the two sequences is a function of the number of equivalent positions shared by the sequences (i.e., % identity = the total number of the number of equivalent positions / positions (i.e., overlapping positions) x 100). Preferably, the two sequences have the same length.
[0094] Sequence comparison can be performed over the entire length of the two sequences to be compared or over a fragment of the two sequences. Typically, comparison is performed over the full length of the two sequences to be compared. However, sequence identity can be performed over a region of, for example, twenty, fifty, one hundred or more contiguous amino acid residues.
[0095] Those skilled in the art are aware of the fact that different computer programs can be used to determine the homology between two sequences. For example, comparison of sequences and determination of the percent identity between two sequences can be accomplished using a mathematical algorithm. In a preferred embodiment, the percent identity between two amino acid sequences or nucleic acid sequences is determined using the Needleman and Wunsch (J. Mol. Biol. (48): 444-453 (1970)) algorithm, which has been incorporated into the GAP program in the Accelrys GCG software package (available at http: / / www.accelrys.com / products / gcg / ), using a Blosum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4, and a length weight of 1, 2, 3, 4, 5, or 6. The skilled person will appreciate that all of these different parameters will produce slightly different results, but the overall percent identity of the two sequences does not change significantly when different algorithms are used.
[0096] The protein or nucleic acid sequences of the present invention can further be used as a "query sequence" to search against public databases, for example, to identify other family members or related sequences. Such searches can be performed using the BLASTN and BLASTP programs (version 2.0) of Altschul et al. (1990) J. Mol. Biol. 215:403-10. BLAST protein searches can be performed with the BLASTP program, score = 50, word length = 3, to obtain amino acid sequences homologous to the protein molecules of the present invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al. (1997) Nucleic Acids Res. 25(17):3389-3402. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., BLASTP and BLASTN) can be used. See the homepage of the National Center for Biotechnology Information at http: / / www.ncbi.nlm.nih.gov / .
[0097] As used herein, the term "sequence identical to SEQ ID NO: X" is specifically understood to be equivalent to the term "sequence identical to SEQ ID NO: X over the length of SEQ ID NO: X" or the term "sequence identical to SEQ ID NO: X over the entire length of SEQ ID NO: X," respectively. In this context, "X" is any integer selected from 1 to 84, such that "SEQ ID NO: X" represents any SEQ ID NO mentioned herein.
[0098] In another specific aspect of the IBV spike protein or a fragment thereof according to the present invention, the IBV spike protein or a fragment thereof consists of or comprises the amino acid sequence as shown in SEQ ID NO:2, or a sequence having at least 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.95%, 99.98% or 99.99% sequence identity thereto.
[0099] In another specific aspect of the IBV spike protein or a fragment thereof according to the present invention, the IBV spike protein or a fragment thereof consists of or comprises the amino acid sequence as shown in SEQ ID NO:3, or a sequence having at least 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.95%, 99.98% or 99.99% sequence identity thereto.
[0100] In another specific aspect of the IBV spike protein or a fragment thereof according to the present invention, the IBV spike protein or a fragment thereof consists of or comprises the amino acid sequence as shown in SEQ ID NO:4, or a sequence having at least 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.95%, 99.98% or 99.99% sequence identity thereto.
[0101] In another specific aspect of the IBV spike protein or a fragment thereof according to the present invention, the IBV spike protein or a fragment thereof consists of or comprises: an amino acid sequence as shown in SEQ ID NO:5, or a sequence having at least 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.95%, 99.98% or 99.99% sequence identity thereto.
[0102] In another specific aspect of the IBV spike protein or a fragment thereof according to the present invention, the IBV spike protein or a fragment thereof consists of or comprises the amino acid sequence as shown in SEQ ID NO:6, or a sequence having at least 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.95%, 99.98% or 99.99% sequence identity thereto.
[0103] In another specific aspect of the IBV spike protein or a fragment thereof according to the present invention, the IBV spike protein or a fragment thereof consists of or comprises the amino acid sequence as shown in SEQ ID NO:7, or a sequence having at least 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.95%, 99.98% or 99.99% sequence identity thereto.
[0104] In another specific aspect of the IBV spike protein or its fragment according to the present invention, the IBV spike protein or its fragment consists of or comprises the amino acid sequence as shown in SEQ ID NO:8 or 77, or a sequence having at least 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.95%, 99.98% or 99.99% sequence identity thereto.
[0105] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention, the IBV spike protein or fragment thereof is selected from the following genotype list: GI-2 to 27, GII-1, GIII-1, GIV-1, GV-1, GVI-1.
[0106] Valastro et al. 2016 (Infection, Genetics and Evolution 39; 349–364) described a phylogeny-based classification system combined with a lineage nomenclature for assigning IBV strains. Six genotypes (GI to GVI) were defined, which together comprise 32 distinct viral lineages.
[0107] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention, the spike protein or fragment thereof is not from the GI-1 genotype. The GI-1 genotype relates to the Massachusetts genotype / serotype.
[0108] In another specific aspect of the avian coronavirus spike protein or fragment thereof according to the present invention, at least a portion of the S1 subunit from an avian coronavirus with limited cell tropism or tissue tropism is selected from: infectious bronchitis virus (IBV); guinea fowl coronavirus (GfCoV) and turkey coronavirus (TCoV; turkey enteritis virus and blue crown virus).
[0109] In another specific aspect of the avian coronavirus spike protein or fragment thereof according to the present invention, at least a portion of the S1 subunit from an avian coronavirus with limited cell tropism or tissue tropism is derived from IBV (infectious bronchitis virus).
[0110] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention, at least a portion of the S1 subunit is from an IBV selected from the following genotypes or serotypes or strains: Arkansas (e.g., Arkansas 99), Brazil (e.g., BR-1, BR-2, 23 / 2013, IBV / Brasil / 351 / 1984), California (e.g., California1734 / 04, California 99), Connecticut, Delaware (e.g., Delaware 98), Dutch (e.g., D207, D212, D274, D3128, D3896, D8880, D1466), Florida, Georgia (e.g., Georgia GA-07, GA-08, GA-12, GA-13), Gray, Holte, Iowa (e.g., Iowa 97 and Iowa 69), Italy02, JMK, LDT3, Maine (e.g., Maine 209), Massachusetts (e.g., M41, H52, H120; excluding Beaudette), Pennsylvania (e.g., Pennsylvania 1220 / 98, Pennsylvania Wolg / 98), PL84084, Qu (e.g., Qu-mv), QX (e.g., GB341 / 96), Q1, SE 17, variant 2 (e.g., IS / 1494 / 06, IBV / Ck / EG / CU / 4 / 2014, gammaCoV / Ck / Poland / G052 / 2016), and 4 / 91 (793B, CR88).
[0111] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention, at least a portion of the S1 subunit is from an IBV selected from the following genotypes or serotypes or strains: Massachusetts (not Beaudette), 4 / 91, QX, Q1, Italy 02, Arkansas, Conneticut, Georgia, LDT3, PL84084, variant 2 and Brazil.
[0112] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention, at least a portion of the S1 subunit is from an IBV selected from the following genotypes or serotypes or strains: Massachusetts (not Beaudette), 4 / 91, QX, Q1, Arkansas, variant 2 and Brazil.
[0113] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention, the Massachusetts strain is selected from the following list: H120, H52, Spain / 98 / 308, IBMA5-1, SD / 97 / 01, Spain / 96 / 334 and M41-M21883.
[0114] In another specific aspect of the IBV spike protein or its fragment according to the present invention, the 4 / 91 strain is selected from the following list: Spain / 98 / 328, Spain / 92 / 35, IR-3654-VM, FR-CR88061-88, FR-85131-85, UK-1233-95, UK / 3 / 91, Spain / 00 / 336, UK / 7 / 91, pathogenic 4 / 91, attenuated 4 / 91 and IB4-91.
[0115] In another specific aspect of the IBV spike protein or its fragment according to the present invention, the QX strain is selected from the following list: FR-L1450T-05, FR-L1450L-05, NL-L1449T-04, NL-L1449K-04, IBV / Ck / SP / 170 / 09, IBV / Ck / SP / 79 / 08, IBV / Ck / SP / 248 / 09, HBN, IBVQX, LX4, BJQ, CK / CH / LGD / 03 and GB341 / 96.
[0116] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention, the Q1 strain is selected from the following list: CK / CH / LDL / 98I, CK / CH / LSD / 08-10, J2, Q1, AR08ER22, AR08BA21 and Chile-295-10.
[0117] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention, the Italy 02 strain is selected from the following list: Spain / 99 / 316, Italy-02, UK-L633-04, It-497-02, Spain / 05 / 866, Spain / 04 / 221, Spain / 00 / 337, Spain / 155 / 09 and Spain / 03 / 08.
[0118] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention, the Arkansas strain is selected from the following list: Ark99, ArkGA, ArkDPI, AL / 5364 / 00, ARKDPI11, AL / 0803 / 01, AL / 7149 / 00, ArkDPI101, AL / 1221 / 01, AL / 1793 / 01 and AL / 4614 / 98.
[0119] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention, the variant 2 strain is selected from the following list: IS / 1494 / 06, IBV / Ck / EG / CU / 4 / 2014, gammaCoV / Ck / Poland / G052 / 2016, Eg / CLEVB-2 / IBV / 012, D1344 / 2 / 4 / 10_EG, TR8 and IB VAR2-06.
[0120] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention, the Brazil strain is selected from the following list: BR-1, BR-2, 23 / 2013 and IBV / Brasil / 351 / 1984.
[0121] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention, at least a portion of the S1 subunit is from an IBV genotype or serotype selected from the following list: Massachusetts (not Beaudette), QX and 4 / 91.
[0122] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention, at least a portion of the S1 subunit is from the Massachusetts (not Beaudette) IBV genotype or serotype.
[0123] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention, at least a portion of the S1 subunit is from the QX IBV genotype or serotype.
[0124] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention, at least a portion of the S1 subunit is from the 4 / 91 IBV genotype or serotype.
[0125] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention, at least a portion of the S1 subunit is from IBV strain H120, H52, QX SP2013-01478 or CR88.
[0126] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention, at least a portion of the S1 subunit is from IBV strain H120 or H52.
[0127] In another specific aspect of the avian coronavirus spike protein or fragment thereof according to the present invention, at least a portion of the S1 subunit is at least 1, 5, 10, 15, 20, 25, 50, 100, 150, 200, 250, 300, 350, 400 or 500 contiguous amino acids of an S1 subunit sequence from an avian coronavirus or IBV with limited cell tropism or tissue tropism, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
[0128] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention, at least a portion of the S1 subunit is at least 1, 5, 10, 15, 20, 25, 50, 100, 150, 200, 250, 300, 350, 400 or 500 contiguous amino acids from the S1 subunit sequence of an avian coronavirus or IBV as described herein, or a sequence having at least 90%, 95%, 96%, 97%, 98%, 99% sequence identity thereto.
[0129] In another specific aspect of the IBV spike protein or its fragment according to the present invention, at least a portion of the S1 subunit from IBV with limited cell tropism or tissue tropism has an amino acid sequence as shown in SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 77, or at least 1, 5, 10, 15, 20, 25, 50, 100, 150, 200, 250, 300, 350, 400 or 500 contiguous amino acids of a sequence having at least 90%, 95%, 96%, 97%, 98%, 99% sequence identity thereto.
[0130] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention, the coronavirus or IBV with restricted cell tropism or tissue tropism is restricted to infection and / or replication in embryonated chicken eggs and / or primary chicken kidney cells.
[0131] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention, the coronavirus or IBV with limited cell tropism or tissue tropism does not infect and / or replicate in EB66 cells.
[0132] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention, the coronavirus or IBV with limited cell tropism or tissue tropism does not infect and / or replicate in PBS-12SF and / or HEK 293T cells.
[0133] snippet
[0134] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention, the fragment of the avian coronavirus or IBV spike protein has a length of at least 500, 750, 1000 or 1077 amino acids.
[0135] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention, the fragment of the avian coronavirus or IBV spike protein has a length of at least 1000 amino acids.
[0136] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention, the fragment of the avian coronavirus or IBV spike protein has a length of at least 500, 750, 1000 or 1075 amino acids from the N-terminus.
[0137] The term "N-terminus" is well known to those skilled in the art. The N-terminus is also known as the amino terminus, the NH2 terminus, the N-terminal end, or the amine terminus. When a protein is translated from messenger RNA, it is produced from the N-terminus to the C-terminus. Thus, the N-terminus is the starting point of the amino acid chain (protein or polypeptide) that contains the amine group (-NH2).
[0138] In another specific aspect of the avian coronavirus or IBV spike protein or a fragment thereof according to the present invention, the fragment of the avian coronavirus or IBV spike protein is the extracellular domain of the spike protein.
[0139] The term "extracellular domain" is well known to those skilled in the art. The spike protein comprises different functional parts, a signal sequence, an extracellular domain, a transmembrane domain, and an intracellular domain (from N-terminus to C-terminus). Thus, after cleavage of the signal sequence, the N-terminus of the spike protein begins with the extracellular domain. The IBV spike extracellular domain has a length of approximately 1075 amino acids and varies in length by several amino acids depending on the IBV strain.
[0140] In another specific aspect of the avian coronavirus or IBV spike protein according to the invention, the cysteine at amino acid position 267 or a mutation to cysteine at amino acid position 267 is genetically stable. Advantageously, experimental data show that the cysteine at amino acid position 267 or a mutation to cysteine at amino acid position 267 is genetically stable and remains stable over a period of time (through passages).
[0141] The term "genetically stable" means that the cysteine at amino acid position 267 or the mutation to cysteine at amino acid position 267 remains stable over a period of time (over passages). Preferably, the cysteine at amino acid position 267 or the mutation to cysteine at amino acid position 267 is present after at least 3 passages of the IBV having the avian coronavirus or IBV spike protein according to the present invention in cell culture or tissue culture, more preferably after at least 6 passages, even more preferably after at least 9 passages, even more preferably after at least 12 passages, and most preferably after 15 passages.
[0142] Nucleotide sequences and plasmids
[0143] Furthermore, the present invention provides a nucleotide sequence encoding the spike protein or a fragment thereof as described herein.
[0144] Furthermore, the present invention provides a plasmid comprising the nucleotide sequence as described herein.
[0145] The term "nucleic acid" or "nucleic acid sequence" or "nucleotide sequence" refers to a polynucleotide, including a DNA molecule, an RNA molecule, a cDNA molecule or a derivative. The term includes single-stranded polynucleotides as well as double-stranded polynucleotides. The nucleic acids of the present invention include isolated polynucleotides (i.e., isolated from their natural environment) and genetically modified forms. In addition, chemically modified polynucleotides are also included, including naturally occurring modified polynucleotides such as glycosylated or methylated polynucleotides, or artificially modified polynucleotides such as biotinylated polynucleotides. Further, the terms "nucleic acid" and "polynucleotide" are interchangeable and refer to any nucleic acid. The terms "nucleic acid" and "polynucleotide" specifically also include nucleic acids composed of nucleotides having nucleobases other than the five biologically occurring bases (adenine, guanine, thymine, cytosine and uracil).
[0146] The term "plasmid" refers to cytoplasmic DNA that replicates within a bacterial host cell independently of the bacterial chromosome. In a specific aspect of the invention, the terms "plasmid" and / or "transfer plasmid" and / or "donor plasmid" refer to elements of recombinant DNA technology that can be used to construct, for example, recombinant viruses or expression cassettes for insertion into viral vectors. In another specific aspect, the term "plasmid" can be used to designate a plasmid that can be used for DNA vaccination purposes.
[0147] cell
[0148] Furthermore, the present invention provides a cell comprising a plasmid as described herein.The cell may be a eukaryotic cell or a prokaryotic cell.
[0149] Viruses, avian coronaviruses, and IBV
[0150] Furthermore, the present invention provides a viral particle comprising the spike protein or a fragment thereof as described herein.
[0151] Furthermore, the present invention provides an avian coronavirus comprising the spike protein or a fragment thereof as described herein.
[0152] Furthermore, the present invention provides an IBV (Infectious Bronchitis Virus) comprising the spike protein as described herein.
[0153] In another specific aspect of the avian coronavirus or IBV according to the present invention, the avian coronavirus or IBV is attenuated.
[0154] The term "attenuated" refers to a pathogen that has reduced virulence compared to a wild-type isolate. In the present invention, an attenuated IBV is an IBV whose virulence has been reduced such that it does not cause clinical signs of IBV infection but is able to induce an immune response in a target animal. However, it can also mean that the incidence or severity of clinical signs in animals infected with the attenuated IBV is reduced compared to a "control group" of animals infected with non-attenuated IBV that did not receive the attenuated virus. In this context, the term "reduced / reduced" means a reduction of at least 10%, preferably 25%, even more preferably 50%, even more preferably 60%, even more preferably 70%, even more preferably 80%, even more preferably 90%, even more preferably 95%, and most preferably 100%, compared to a control group infected with non-attenuated IBV as defined above. Thus, an attenuated IBV strain is a strain suitable for incorporation into an immunogenic composition comprising a modified live IBV.
[0155] In another specific aspect of the avian coronavirus or IBV according to the present invention, the avian coronavirus or IBV is inactivated.
[0156] Any conventional inactivation method can be used for the purpose of the present invention. Therefore, inactivation can be carried out by chemical treatment and / or physical treatment well known to those skilled in the art. Preferred inactivation methods include adding cyclized diethyleneimine (BEI), including adding a solution of 2-bromoethylamine hydrobromide (BEA), wherein the 2-bromoethylamine hydrobromide has been cyclized to diethyleneimine (BEI). Preferred further chemical inactivators include but are not limited to Triton X-100, sodium deoxycholate, cetyltrimethylammonium bromide, β-propiolactone, thimerosal, phenol and formaldehyde (formalin). However, inactivation can also include a neutralization step. Preferred neutralizing agents include but are not limited to sodium thiosulfate, sodium bisulfite, etc.
[0157] Preferred formalin inactivation conditions include formalin concentrations of about 0.02% (v / v)–2.0% (v / v), more preferably about 0.1% (v / v)–1.0% (v / v), still more preferably about 0.15% (v / v)–0.8% (v / v), even more preferably about 0.16% (v / v)–0.6% (v / v), and most preferably about 0.2% (v / v)–0.4% (v / v). The incubation time depends on the resistance of the IBV. Generally, the inactivation process is performed until IBV growth is undetectable in a suitable culture system.
[0158] Preferably, the inactivated IBV of the present invention is formalin-inactivated, preferably using the concentrations as described above.
[0159] The inactivated IBV of the present invention can be incorporated into liposomes using known techniques, such as those described in Nature, 1974, 252, 252-254 or Journal of Immunology, 1978, 120, 1109-13. In another embodiment of the present invention, the inactivated IBV of the present invention can be conjugated to a suitable biological compound such as a polysaccharide, peptide, protein, or the like, or a combination thereof.
[0160] In another specific aspect of the avian coronavirus or IBV according to the present invention, the avian coronavirus or IBV is genetically engineered.
[0161] The term "genetically engineered" refers to an avian coronavirus or IBV that has been mutated using a "reverse genetics" approach. Preferably, the avian coronavirus or IBV according to the present invention has been genetically engineered. Reverse genetics techniques involve the preparation of synthetic recombinant viral RNA. However, "reverse genetics" techniques are well known to those skilled in the art.
[0162] In another specific aspect of the avian coronavirus or IBV according to the present invention, the avian coronavirus or IBV is recombinant.
[0163] As used herein, the term "recombinant" refers to an RNA genome (or RNA sequence, cDNA sequence or protein) with any modification that does not occur naturally in the corresponding RNA genome (or RNA sequence, cDNA sequence or protein). For example, if an RNA genome (or RNA sequence, cDNA sequence or protein) comprises an insertion, deletion, inversion, relocation or point mutation that is artificially introduced, for example, by human intervention, it is considered to be "recombinant". Therefore, the RNA genome sequence (or RNA sequence, cDNA sequence or protein) is not combined with all or part of the sequence (or RNA sequence, cDNA sequence or protein) to which it is combined in nature. When used with respect to viruses, the term "recombinant" means a virus produced by artificial manipulation of the viral genome. The term "recombinant virus" includes genetically modified viruses.
[0164] In another specific aspect of the avian coronavirus or IBV according to the present invention, the avian coronavirus or IBV is chimeric.
[0165] The term "chimeric" refers to an avian coronavirus or IBV that contains one or more nucleotide sequences from another coronavirus or IBV. Preferably, the term refers to an IBV virus that contains one or more nucleotide sequences from another IBV strain.
[0166] In another specific aspect of the IBV according to the invention, the IBV is from an IBV having a genotype or serotype or strain selected from the group consisting of Arkansas (e.g., Arkansas 99), Brazil (e.g., BR-1, BR-2, 23 / 2013, IBV / Brasil / 351 / 1984), California (e.g., California 1734 / 04, California 99), Connecticut, Delaware (e.g., Delaware 98), Dutch (e.g., D207, D212, D274, D3128, D3896, D8880, D1466), Florida, Georgia (e.g., Georgia GA-07, GA-08, GA-12, GA-13), Gray, Holte, Iowa (e.g., Iowa 97 and Iowa 69), Italy 02, JMK, LDT3, Maine (e.g., Maine 209), Massachusetts (M41, H52, H120, Beaudette), Pennsylvania (e.g., Pennsylvania 1220 / 98, Pennsylvania Wolg / 98), PL84084, Qu (e.g., Qu-mv), QX (e.g., GB341 / 96), Q1, SE 17, variant 2 (e.g., IS / 1494 / 06, IBV / Ck / EG / CU / 4 / 2014, gammaCoV / Ck / Poland / G052 / 2016), and 4 / 91 (793B, CR88).
[0167] In another specific aspect of the IBV according to the present invention, the IBV is selected from the following list of genotypes or serotypes or strains: Massachusetts, 4 / 91, QX, Q1, Italy 02, Arkansas, Conneticut, Georgia, LDT3, PL84084, variant 2 and Brazil.
[0168] In another specific aspect of the IBV according to the present invention, the IBV is selected from the following list of genotypes or serotypes: Massachusetts, 4 / 91, QX, Q1, Arkansas, variant 2 and Brazil.
[0169] In another specific aspect of the IBV according to the present invention, the Massachusetts strain is selected from the following list: H120, H52, Spain / 98 / 308, IBMA5-1, SD / 97 / 01, Beaudette, Spain / 96 / 334 and M41-M21883.
[0170] In another specific aspect of the IBV according to the present invention, the 4 / 91 strain is selected from the following list: Spain / 98 / 328, Spain / 92 / 35, IR-3654-VM, FR-CR88061-88, FR-85131-85, UK-1233-95, UK / 3 / 91, Spain / 00 / 336, UK / 7 / 91, pathogenic 4 / 91, attenuated 4 / 91 and IB4-91.
[0171] In another specific aspect of the IBV according to the present invention, the QX strain is selected from the following list: FR-L1450T-05, FR-L1450L-05, NL-L1449T-04, NL-L1449K-04, IBV / Ck / SP / 170 / 09, IBV / Ck / SP / 79 / 08, IBV / Ck / SP / 248 / 09, HBN, IBVQX, LX4, BJQ, CK / CH / LGD / 03 and GB341 / 96.
[0172] In another specific aspect of the IBV according to the present invention, the Q1 strain is selected from the following list: CK / CH / LDL / 98I, CK / CH / LSD / 08-10, J2, Q1, AR08ER22, AR08BA21 and Chile-295-10.
[0173] In another specific aspect of the IBV according to the present invention, the Italy 02 strain is selected from the following list: Spain / 99 / 316, Italy-02, UK-L633-04, It-497-02, Spain / 05 / 866, Spain / 04 / 221, Spain / 00 / 337, Spain / 155 / 09 and Spain / 03 / 08.
[0174] In another specific aspect of the IBV according to the present invention, the Arkansas strain is selected from the following list: Ark99, ArkGA, ArkDPI, AL / 5364 / 00, ARKDPI11, AL / 0803 / 01, AL / 7149 / 00, ArkDPI101, AL / 1221 / 01, AL / 1793 / 01 and AL / 4614 / 98.
[0175] In another specific aspect of the IBV according to the present invention, the variant 2 strain is selected from the following list: IS / 1494 / 06, IBV / Ck / EG / CU / 4 / 2014, gammaCoV / Ck / Poland / G052 / 2016, Eg / CLEVB-2 / IBV / 012, D1344 / 2 / 4 / 10_EG, TR8 and IB VAR2-06.
[0176] In another specific aspect of the IBV according to the present invention, the Brazil strain is selected from the following list: BR-1, BR-2, 23 / 2013 and IBV / Brasil / 351 / 1984.
[0177] In another specific aspect of the IBV according to the present invention, the spike protein or fragment thereof is from an IBV of the Massachusetts or 4 / 91 genotype or serotype.
[0178] In another specific aspect of the IBV according to the present invention, the spike protein or fragment thereof is from an IBV of the Massachusetts genotype or serotype.
[0179] In another specific aspect of the IBV according to the present invention, the spike protein or a fragment thereof is from an IBV of genotype or serotype 4 / 91.
[0180] In another specific aspect of the IBV according to the present invention, the IBV strain is H120, H52 or CR88.
[0181] In another specific aspect of the IBV according to the present invention, the IBV strain is H120 or H52.
[0182] In another specific aspect of the IBV according to the present invention, the IBV has an IBV spike protein or a fragment thereof consisting of or comprising the amino acid sequence as shown in SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 77, or a sequence having at least 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.95%, 99.98% or 99.99% sequence identity thereto.
[0183] In another specific aspect of the IBV according to the present invention, the IBV has extended cell tropism or tissue tropism.
[0184] In another specific aspect of the IBV according to the present invention, the IBV infects and / or replicates in at least one cell line or cell as described herein. Preferably, the IBV infects and / or replicates in at least one cell line as described herein.
[0185] Furthermore, the present invention provides a cell comprising:
[0186] - a viral particle as described herein, or
[0187] - an avian coronavirus or IBV as described herein.
[0188] In another specific aspect of the cell according to the invention, the cell is a cell line or cell selected from the following list: primary chicken embryo cells, chicken embryo fibroblast cell line, duck embryo stem cell line, human embryonic kidney cell line, baby hamster kidney cell line, African green monkey kidney cell line, rabbit kidney cell line, canine kidney cell line, chicken liver cell line, bovine kidney cell line, porcine kidney cell line and insect cell line.
[0189] In another specific aspect of the cell according to the present invention, the cell is a cell line selected from the following list: DF-1 (Douglas Foster), EB66 (duck embryo stem cell line), PBS-12, PBS-12SF (serum-free PBS-12), BHK21 (baby hamster kidney), HEK 293T (human embryonic kidney), Vero (Verda Reno), MA104, RK13 (rabbit kidney), LMH (leghorn male liver carcinoma), MDCK (Martin Darby dog kidney), MDBK (Martin Darby bovine kidney), PK15 (pig kidney), PK2A (pig kidney), SF9, SF21 and SF+ (Spodoptera frugiperda).
[0190] In another specific aspect of the cell according to the invention, the cell is a cell line selected from the following list: DF-1, EB66, PBS-12, PBS-12SF, BHK, HEK 293T, Vero, MA104 and RK13.
[0191] In another specific aspect of the cell according to the invention, the primary chicken embryonic cell is a fibroblast or a cell derived from liver or lung tissue.
[0192] Furthermore, the present invention provides an immunogenic composition comprising:
[0193] - a spike protein as described herein, or
[0194] - a viral particle as described herein, or
[0195] - an avian coronavirus or IBV as described herein.
[0196] Therefore, the present invention also provides an immunogenic composition comprising an avian coronavirus or IBV, comprising an avian coronavirus or IBV spike protein or a fragment thereof, wherein at least a portion of the S1 subunit is derived from an avian coronavirus or IBV with limited cell or tissue tropism, and wherein amino acid position 267 is cysteine. Furthermore, the present invention also provides an immunogenic composition comprising an avian coronavirus or IBV, comprising a recombinant avian coronavirus or IBV spike protein or a fragment thereof, comprising a mutation to cysteine at amino acid position 267. Furthermore, the amino acid sequence of SEQ ID NO: 1 is used to determine position numbering within the spike protein. Preferably, the amino acid sequence of the spike protein is aligned with the amino acid sequence of SEQ ID NO: 1.
[0197] Furthermore, the present invention provides a vaccine comprising:
[0198] - a spike protein as described herein, or
[0199] - a viral particle as described herein, or
[0200] - A coronavirus or IBV as described herein.
[0201] Furthermore, the present invention provides an improved live vaccine with expanded cell tropism or tissue tropism, comprising:
[0202] - a spike protein as described herein, or
[0203] - a viral particle as described herein, or
[0204] - A coronavirus or IBV as described herein.
[0205] The term "immunogenic composition" refers to a composition comprising at least one antigen that elicits an immune response in a host to which the immunogenic composition is administered. Such an immune response can be a cellular and / or antibody-mediated immune response to the immunogenic composition of the present invention. Preferably, the immunogenic composition induces an immune response, and more preferably, confers protective immunity against one or more clinical signs of IBV infection. The host is also described as a "subject." Preferably, any host or subject described or referred to herein is an avian or poultry species.
[0206] Typically, an "immune response" includes, but is not limited to, one or more of the following effects: the production or activation of antibodies, B cells, helper T cells, suppressor T cells, and / or cytotoxic T cells and / or gamma-delta T cells specific for one or more antigens included in the immunogenic compositions of the invention. Preferably, the host will exhibit a protective immune response or a therapeutic response.
[0207] A "protective immune response" or "protective immunity" will be demonstrated by a reduction or absence of clinical signs normally exhibited by an infected host, a more rapid recovery time, and / or a reduced duration of infectivity or reduced pathogen titers in the tissues or body fluids or excretions of the infected host.
[0208] In cases where the host displays a protective immune response such that resistance to new infection will be enhanced and / or the clinical severity of the disease will be reduced, the immunogenic composition is described as a "vaccine."
[0209] The terms "modified live" and "attenuated" are used interchangeably herein.
[0210] In another specific aspect of the immunogenic composition or vaccine according to the present invention, the immunogenic composition or vaccine comprises a pharmaceutically acceptable carrier.
[0211] The term "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, stabilizers, diluents, preservatives, antibacterial and antifungal agents, isotonicity agents, absorption delaying agents, adjuvants, immunostimulants, and combinations thereof.
[0212] "Diluents" may include water, saline, dextrose, ethanol, glycerol, etc. Isotonic agents may include, among others, sodium chloride, dextrose, mannitol, sorbitol, and lactose. Stabilizers include, among others, albumin and alkali metal salts of ethylenediaminetetraacetic acid.
[0213] In another specific aspect of the immunogenic composition or vaccine according to the invention, the pharmaceutically acceptable carrier is phosphate buffered saline.
[0214] Preferably, the immunogenic composition further comprises a sucrose gelatin stabilizer.
[0215] Preferably, the pharmaceutically acceptable carrier is chitosan.
[0216] Chitosan is a natural deacetylated polysaccharide from chitin in crustaceans (e.g., shrimp, crab), insects, and other invertebrates. Recently, Rauw et al. 2009 (Vet Immunol Immunop 134:249–258) demonstrated that chitosan enhanced the cellular immune response of a live Newcastle disease vaccine and promoted its protective effect. Furthermore, Wang et al. 2012 (Arch Virol (2012) 157:1451–1461) demonstrated results revealing the potential of chitosan as an adjuvant for use in live attenuated influenza vaccines.
[0217] Preferably, the immunogenic composition may further include one or more other immunomodulators, such as interleukins, interferons or other cytokines.The amounts and concentrations of adjuvants and additives that can be used in the context of the present invention can be readily determined by the skilled person.
[0218] In some aspects, the immunogenic compositions of the present invention contain an adjuvant. As used herein, "adjuvant" may include aluminum hydroxide and aluminum phosphate, saponins such as QuilA, QS-21 (Cambridge Biotech Inc., Cambridge MA), GPI-0100 (Galenica Pharmaceuticals, Inc., Birmingham, AL), water-in-oil emulsions, oil-in-water emulsions, water-in-oil-in-water emulsions. Emulsions may be based in particular on light liquid paraffin oil (European typical); isoprenoid oils such as squalane or squalene; oils resulting from oligomerization of olefins, in particular isobutylene or decene; esters of acids or alcohols containing linear alkyl groups, more particularly vegetable oils, ethyl oleate, propylene glycol di(caprylate / caprate), triglyceride (caprylate / caprate) or propylene glycol dioleate; esters of branched fatty acids or alcohols, in particular isostearates. Oils are used in combination with emulsifiers to form emulsions. Emulsifiers are preferably nonionic surfactants, in particular sorbitan, mannide (e.g., anhydromannide oleate), ethylene glycol, polyglycerol, propylene glycol and esters of oleic acid, isostearic acid, ricinoleic acid or hydroxystearic acid, which are optionally ethoxylated, and polyoxypropylene-polyoxyethylene copolymer blocks, in particular Pluronic products, especially L 121. See Hunter et al., The Theory and Practical Application of Adjuvants (ed. Stewart-Tull, DES), John Wiley and Sons, NY, pp. 51-94 (1995), and Todd et al., Vaccine 15: 564-570 (1997). Exemplary adjuvants are the SPT emulsion described on page 147 of "Vaccine Design, The Subunit and Adjuvant Approach" edited by M. Powell and M. Newman, Plenum Press, 1995, and the emulsion MF59 described on page 183 of the same book.
[0219] A further example of an adjuvant is a compound selected from a polymer of acrylic acid or methacrylic acid and a copolymer of maleic anhydride and an alkenyl derivative. Advantageous adjuvant compounds are polymers of acrylic acid or methacrylic acid, especially cross-linked with polyalkenyl ethers of sugars or polyols. These compounds are known by the term carbomer (Phameuropa Vol. 8, No. 2, June 1996). Those skilled in the art can also refer to U.S. Patent No. 2,909,462, which describes such acrylic polymers cross-linked with polyhydroxylated compounds having at least 3 hydroxyls, preferably no more than 8 hydroxyls, wherein the hydrogen atoms of the at least three hydroxyls are replaced with unsaturated aliphatic radicals having at least 2 carbon atoms. Preferred radicals are those containing 2 to 4 carbon atoms, such as vinyl, allyl and other ethylenically unsaturated groups. The unsaturated radical itself may contain other substituents, such as methyl. Products sold under the name carbomer; (BF Goodrich, Ohio, USA) are particularly suitable. They are cross-linked with allyl sucrose or allyl pentaerythritol. Among them, mention may be made of carbomer 974P, 934P and 971P. Most preferred is the use of carbomer 971P. Among the copolymers of maleic anhydride and alkenyl derivatives is the copolymer EMA (Monsanto), which is a copolymer of maleic anhydride and ethylene. Dissolution of these polymers in water results in an acid solution that will preferably be neutralized to physiological pH in order to give an adjuvant solution into which the immunogenic composition, immunological composition or vaccine composition itself will be incorporated.
[0220] Further suitable adjuvants include, but are not limited to, the RIBI adjuvant system (Ribi Inc.), block copolymers (CytRx, Atlanta GA), SAF-M (Chiron, Emeryville CA), monophosphoryl lipid A, avridine lipid-amine adjuvant, heat-labile enterotoxin from Escherichia coli (recombinant or otherwise), cholera toxin, IMS1314 or muramyl dipeptide, or naturally occurring or recombinant cytokines or analogs thereof, or stimulators of endogenous cytokine release, and the like.
[0221] It is expected that the adjuvant can be added in an amount of about 100 μg to about 10 mg per dose, preferably in an amount of about 100 μg to about 10 mg per dose, more preferably in an amount of about 500 μg to about 5 mg per dose, even more preferably in an amount of about 750 μg to about 2.5 mg per dose, and most preferably in an amount of about 1 mg per dose. Alternatively, the adjuvant can be in a concentration of about 0.01% to 50%, preferably in a concentration of about 2% to 30%, more preferably in a concentration of about 5% to 25%, still more preferably in a concentration of about 7% to 22%, and most preferably in a concentration of 10% to 20% by volume of the final product.
[0222] In another specific aspect of the immunogenic composition or vaccine according to the present invention, the immunogenic composition or vaccine is effective for treating and / or preventing clinical signs caused by IBV in a subject in need thereof. The terms "treating and / or preventing", "clinical signs" and "in need thereof" have been defined elsewhere.
[0223] In another specific aspect of the immunogenic composition or vaccine according to the present invention, said immunogenic composition or vaccine is formulated for single-dose administration.
[0224] Volumes for single doses are defined elsewhere herein.
[0225] Furthermore, it has been shown that one dose of the immunogenic composition of the invention is effective following such single dose administration of such immunogenic composition or vaccine.
[0226] In another specific aspect of the immunogenic composition or vaccine according to the invention, the immunogenic composition or vaccine is administered subcutaneously, intramuscularly, orally, in ovo, via spray, via drinking water or by eye drops.
[0227] In another specific aspect of the immunogenic composition or vaccine according to the present invention, the immunogenic composition or vaccine comprises 1 to 10 log 10 EID50 / IBV dose.
[0228] In another specific aspect of the immunogenic composition or vaccine according to the present invention, the immunogenic composition or vaccine comprises 2 to 5 log 10 EID50 / IBV dose.
[0229] In another specific aspect of the immunogenic composition or vaccine according to the present invention, the immunogenic composition or vaccine comprises 2 to 4 log 10 EID50 / IBV dose.
[0230] Methods for production, cultivation and modification
[0231] Furthermore, the present invention provides a method for changing the cell tropism or tissue tropism of an avian coronavirus, which comprises using the avian coronavirus spike protein or a fragment thereof as described herein.
[0232] Furthermore, the present invention provides a method for expanding the cell tropism or tissue tropism of an avian coronavirus, which comprises using the avian coronavirus spike protein or a fragment thereof as described herein.
[0233] Furthermore, the present invention provides a method for producing or manufacturing an avian coronavirus with extended cell tropism or tissue tropism, which comprises using the avian coronavirus spike protein or a fragment thereof as described herein.
[0234] Furthermore, the present invention provides a method for culturing avian coronavirus in cell culture or tissue culture, comprising using the avian coronavirus spike protein or a fragment thereof as described herein.
[0235] Furthermore, the present invention provides a method for modifying an avian coronavirus, comprising modifying amino acid position 267 in the spike protein of the avian coronavirus.
[0236] Furthermore, the present invention provides a method for mutating amino acid position 267 in the avian coronavirus spike protein, comprising:
[0237] a) provide the avian coronavirus spike nucleotide or protein sequence,
[0238] b) identifying position 267 in the spike protein by alignment with the reference sequence,
[0239] c) mutating position 267 of the spike protein of step b) into cysteine,
[0240] d) Obtaining the mutated spike protein of step c).
[0241] Furthermore, the present invention provides a method for mutating amino acid position 267 in the avian coronavirus spike protein of an avian coronavirus, comprising:
[0242] a) provide avian coronavirus,
[0243] b) Identify position 267 in the spike protein by alignment with the reference sequence,
[0244] c) mutating position 267 of the spike protein of step b) into cysteine,
[0245] d) obtaining the mutated avian coronavirus of step c).
[0246] The term "obtaining" includes harvesting, isolating, purifying and / or formulating (e.g., finishing, inactivating and / or blending) the spike protein or fragments thereof. The term "harvesting" refers to collecting or recovering the avian coronavirus or IBV with a modified spike protein from transfected or infected cells or cell lines. Any conventional method known in the art can be used, such as any separation method. Methods well known in the art include centrifugation or filtration, for example, using a semipermeable membrane with a specific pore size. The term "isolating" includes the step of isolating the avian coronavirus or IBV with a modified spike protein. Methods for isolation from transfected or infected cells or cell lines are known to those skilled in the art. These methods include physical and / or chemical methods, including but not limited to freeze-thaw cycles, sonication, and the like. Methods for "purifying" the avian coronavirus or IBV with a modified spike protein from an isolate are known to those skilled in the art, such as those described in Protein purification methods - a practical approach (eds. E.L.V. Harris and S. Angel, IRL Press at Oxford University Press). These methods include, but are not limited to, separation by centrifugation and / or filtration, precipitation, size exclusion (gel filtration) chromatography, affinity chromatography, metal chelate chromatography, ion exchange chromatography, covalent chromatography, hydrophobic interaction chromatography, and the like. The carrier can be obtained in a purified pure form, or free of or substantially free of other cellular materials or culture medium, etc. After said separation and / or purification, the antigen exhibits a purity of at least 80%, preferably 80%-90%, more preferably 90%-97%, and most preferably more than 97%, up to an absolutely pure form free of any contaminants.
[0247] According to a further aspect, "obtaining" as used herein may also include further finishing steps as part of the final formulation process, such as addition of buffers, inactivation, neutralization steps, etc.
[0248] In another specific aspect of the method according to the invention, the spike protein or fragment thereof has a cysteine at amino acid position 267.
[0249] In another specific aspect of the method according to the invention, the cysteine at amino acid position 267 is introduced by mutation.
[0250] In another specific aspect of the method according to the invention, the mutation is an amino acid substitution, deletion or insertion.
[0251] In another specific aspect of the method according to the invention, the phenylalanine or leucine at amino acid position 267 is modified or mutated to cysteine.
[0252] In another specific aspect of the method according to the invention, the avian coronavirus is an IBV as described herein.
[0253] Therefore, the present invention provides a method for altering the cell tropism or tissue tropism of IBV, comprising using the avian coronavirus spike protein or a fragment thereof as described herein.
[0254] Thus, the present invention provides a method for extending the cell tropism or tissue tropism of IBV comprising using the IBV spike protein or a fragment thereof as described herein.
[0255] Thus, the present invention provides a method for producing or manufacturing an IBV with extended cell tropism or tissue tropism comprising using an IBV spike protein or a fragment thereof as described herein.
[0256] Thus, the present invention provides a method for culturing IBV in cell culture or tissue culture comprising using the IBV spike protein or a fragment thereof as described herein.
[0257] Thus, the present invention provides a method for modifying IBV comprising modifying amino acid position 267 in the Spike protein of said IBV.
[0258] Thus, the present invention provides a method for mutating amino acid position 267 in the IBV spike protein, comprising:
[0259] a) providing the IBV spike nucleotide or protein sequence,
[0260] b) identifying position 267 in the spike protein by alignment with the reference sequence,
[0261] c) mutating position 267 of the spike protein of step b) into cysteine,
[0262] d) Obtaining the mutated spike protein of step c).
[0263] Thus, the present invention provides a method for mutating amino acid position 267 in the IBV Spike protein of IBV, comprising:
[0264] a) Provide IBV,
[0265] b) identifying position 267 in the spike protein by alignment with the reference sequence,
[0266] c) mutating position 267 of the spike protein of step b) into cysteine,
[0267] d) obtaining the mutated IBV of step c).
[0268] In another specific aspect of the method according to the invention, the coronavirus spike protein is the IBV (Infectious Bronchitis Virus) spike protein as described herein.
[0269] In another specific aspect of the method according to the invention, the cysteine at amino acid position 267 or said mutation to cysteine at amino acid position 267 results in an extended cell tropism or tissue tropism.
[0270] In another specific aspect of the method according to the invention, the avian coronavirus or IBV infects and / or replicates in a cell line or cell as described herein.
[0271] In another specific aspect of the method according to the invention, the numbering of amino acid position 267 is done as described herein.
[0272] Reagent test kit
[0273] If desired, the composition may be present in a package or dispenser device which may contain one or more unit dosage forms containing the active ingredient. The package may, for example, comprise metal or plastic foil, such as a blister pack. The package or dispenser device may be accompanied by instructions for administration preferably for administration to a subject, particularly poultry. Associated with such a container may be a notice in a form prescribed by a governmental agency regulating the manufacture, use, or sale of a drug or biological product, reflecting approval for administration by the manufacture, use, or sale agency.
[0274] The present invention provides a kit comprising a viral particle, an avian coronavirus, an IBV, an immunogenic composition or a vaccine as described herein.
[0275] In a specific aspect of the kit according to the invention, the kit further comprises instructions for treating and / or preventing avian diseases, or instructions for treating and / or preventing poultry diseases, or instructions for treating and / or preventing IB.
[0276] In a particular aspect of the kit according to the invention, the kit further comprises a dispenser capable of administering the vaccine to said animal.
[0277] Treatment
[0278] Further, the present invention provides methods for immunizing a subject comprising administering to such a subject an immunogenic composition as described herein.
[0279] The term "immunization" relates to active immunization by administering an immunogenic composition to the subject to be immunized, thereby eliciting an immune response against the antigens included in such immunogenic composition.
[0280] Preferably, the immunization results in a reduced incidence of, or a reduced severity of, clinical signs caused by or associated with, a specific avian coronavirus or IBV infection in a flock of birds.
[0281] Further, immunization of a subject in need thereof with an immunogenic composition as provided herein results in preventing the subject from infection with an avian coronavirus or IBV infection. Even more preferably, the immunization results in an effective, long-lasting immune response against IBV infection. It will be understood that the time period will last for more than 1 month, preferably more than 2 months, preferably more than 3 months, more preferably more than 4 months, more preferably more than 5 months, and more preferably more than 6 months. It will be understood that the immunization may not be effective in all subjects immunized. However, the term requires that a significant proportion of the subjects in the flock be effectively immunized.
[0282] Preferably, in this context, a population of subjects is envisioned that would normally (i.e., if not immunized) develop clinical signs typically caused by or associated with infection with an avian coronavirus or IBV. Whether or not the subjects of said population have been effectively immunized can be readily determined by one skilled in the art. Preferably, immunization should be effective if the clinical signs are reduced by at least 10%, more preferably at least 20%, even more preferably at least 30%, even more preferably at least 40%, even more preferably at least 50%, even more preferably at least 60%, even more preferably at least 70%, even more preferably at least 80%, even more preferably at least 90%, even more preferably at least 95%, and most preferably 100% in the subjects of a given population compared to subjects who were not immunized or immunized with an immunogenic composition available prior to the present invention but subsequently became infected with a specific avian coronavirus or IBV.
[0283] Furthermore, the present invention provides a method for treating or preventing clinical signs caused by IBV in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an immunogenic composition or vaccine as described herein.
[0284] As shown in the Examples, the immunogenic compositions or vaccines provided herein have been shown to be effective in treating or preventing clinical signs caused by IBV in subjects. Thus, the experimental data show that modification of the amino acid at amino acid position 267 to cysteine has no effect on the efficacy of the vaccine.
[0285] The term "treatment or prevention" refers to a reduction in the incidence of a specific IBV infection in a flock of birds, or a reduction in the severity of clinical signs caused by or associated with a specific IBV infection. Thus, the term "treatment or prevention" also refers to a reduction in the number of subjects in a flock of birds that become infected with a specific IBV (= a reduction in the incidence of a specific IBV infection), or a reduction in the severity of clinical signs typically associated with or caused by an IBV infection, or a reduction in viral shedding following infection with a specific IBV, or the prevention or reduction of a drop in egg production in laying hens following infection with a specific IBV, compared to a group of subjects whose subjects have not received such an immunogenic composition.
[0286] "Treatment or prevention" generally involves administering an effective amount of an immunogenic composition of the present invention to a subject or a group of subjects in need of or who may benefit from such treatment / prevention. The term "treatment" refers to the administration of an effective amount of an immunogenic composition once a subject or at least some of the subjects in the group have been infected with such IBV, and wherein such subjects have shown some clinical signs caused by or associated with such IBV infection. The term "prevention" refers to the administration of an effective amount of an immunogenic composition to a subject prior to any infection of such subject with IBV, or at least when none of the subjects in such subject or a group of subjects have shown any clinical signs caused by or associated with such IBV infection. The terms "prophylaxis" and "preventing" are used interchangeably in this application.
[0287] As used herein, the term "effective amount" means, but is not limited to, an amount of an antigen that elicits or is capable of eliciting an immune response in a subject. Such an effective amount is capable of reducing the incidence of a specific IBV infection in a flock of birds, or reducing the severity of clinical signs of a specific IBV infection.
[0288] Preferably, clinical signs are reduced in incidence or severity by at least 10%, more preferably at least 20%, still more preferably at least 30%, even more preferably at least 40%, still more preferably at least 50%, even more preferably at least 60%, still more preferably at least 70%, even more preferably at least 80%, still more preferably at least 90%, still more preferably at least 95%, and most preferably 100%, compared to subjects who have not been treated or who have been treated with an immunogenic composition available prior to the present invention but who are subsequently infected with the particular IBV.
[0289] As used herein, the term "clinical signs" refers to signs of infection of a subject from IBV. The clinical signs of infection depend on the pathogen selected. Examples of such clinical signs include, but are not limited to, respiratory distress, nephritis, salpingitis, abnormal egg production, ruffled feathers, depression, reduced growth rate, and loss of appetite. Signs of respiratory distress include respiratory signs, including gasping, coughing, sneezing, tracheal rales, nasal and ocular discharge, tracheal damage, and ciliary arrest in the trachea. Signs of nephritis include kidney damage and watery diarrhea. Signs of abnormal egg production include decreased egg production, smaller eggs, inferior eggshells, reduced internal egg quality, eggs with thin albumen, and ciliary arrest in the oviduct. However, clinical signs also include, but are not limited to, clinical signs that can be observed directly in live animals. Examples of clinical signs that can be observed directly in live animals include nasal and ocular discharge, coughing, wheezing, sneezing, tracheal rales, ruffled feathers, conjunctivitis, weight loss, reduced growth rate, decreased appetite, dehydration, watery diarrhea, lameness, lethargy, emaciation, and weakness.
[0290] Preferably, the clinical signs of reduced incidence or severity in treated subjects are reduced ciliary arrest, reduced rales, reduced egg production, reduced kidney damage, reduced watery diarrhea, reduced weight loss, lower viral load, reduced viral shedding, or a combination thereof, compared to subjects who are not treated or who are treated with an immunogenic composition available prior to the present invention but who are subsequently infected with a particular IBV.
[0291] As used herein, the term "in need of" or "in need of" means that the administration / treatment is associated with an enhancement or improvement of health or clinical signs, or any other positive medical effect on the health of the subject receiving the immunogenic composition according to the present invention.
[0292] Further, the present invention provides a method of reducing ciliary arrest in a subject in need thereof, compared to a non-immunized control group of subjects of the same species, comprising administering to the subject a therapeutically effective amount of an immunogenic composition or vaccine as described herein.
[0293] As shown in the Examples, the immunogenic compositions or vaccines as provided herein have been shown to be effective in reducing ciliary arrest.
[0294] The term "ciliostasis" refers to a decrease in ciliary motility in the trachea. Thus, ciliary motility can be determined by examining the lining of the tracheal rings for ciliary motility. How to determine ciliary motility in the trachea is within the general knowledge of a person skilled in the art.
[0295] Preferably, ciliary motility is not reduced starting from day 10 after challenge or infection with IBV, more preferably starting from day 5 after challenge or infection, more preferably starting from day 4 after challenge or infection, more preferably starting from day 3 after challenge or infection, and most preferably starting from day 1 or day 2 after challenge or infection, compared to subjects in a non-immunized control group of the same species.
[0296] The term "reduction of ciliary arrest" means a reduction of at least 10%, preferably at least 20%, more preferably at least 30%, even more preferably at least 40%, even more preferably at least 50%, even more preferably at least 60%, even more preferably at least 70%, even more preferably at least 80%, even more preferably at least 90%, even more preferably at least 95%, and most preferably 100% compared to a non-immunized control group of subjects of the same species. How to measure a reduction in ciliary arrest is within the general knowledge of a person skilled in the art.
[0297] Furthermore, the present invention provides an immunogenic composition or vaccine as described herein for use in a method of immunizing a subject, the method comprising administering to the subject a therapeutically effective amount of the immunogenic composition or vaccine.
[0298] Furthermore, the present invention provides an immunogenic composition or vaccine as described herein for use in a method of treating or preventing clinical signs caused by IBV in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the immunogenic composition or vaccine.
[0299] Further, the present invention provides an immunogenic composition or vaccine as described herein for use in a method of reducing ciliary arrest in a subject in need thereof compared to a non-immunized control group of subjects of the same species, the method comprising administering to the subject a therapeutically effective amount of the immunogenic composition or vaccine.
[0300] In a specific aspect of the method or use according to the invention, the subject is a poultry.
[0301] The term "poultry" is well known to those skilled in the art. The term "poultry" includes all birds including poultry.
[0302] In a particular aspect of the method or use according to the invention, the subject is poultry.
[0303] The term "poultry" is well known to those skilled in the art. The term "poultry" includes chickens, turkeys, quail, pheasants, guinea fowl, geese and ducks. Further, the term "chicken" includes broilers, laying hens and breeding flocks for both, also known as breeders.
[0304] In a particular aspect of the method or use according to the invention, the subject is selected from chicken, turkey, quail or pheasant.
[0305] In a specific aspect of the method or use according to the invention, the subject is a chicken.
[0306] In a specific aspect of the method or use according to the invention, the immunogenic composition or vaccine is administered once.
[0307] It will be understood that a single dose is administered only once.As shown in the Examples, the immunogenic compositions as provided herein have been shown to be effective following administration of a single dose to a subject in need thereof.
[0308] The dose volume / bird depends on the route of vaccination and the age of the birds.
[0309] Typically, eye drop vaccines are administered at any age in a volume of 1 to 100 μl / dose. Preferably, a single dose of the eye drop vaccine has a total volume of about 5 μl to 70 μl, and more preferably about 20 μl to 50 μl, with a single 20 μl, 25 μl, 30 μl, 35 μl, 40 μl, 45 μl or 50 μl dose being preferred. Most preferably, a single dose of the eye drop vaccine has a total volume of about 30 μl to 50 μl, with a single 30 μl, 35 μl, 40 μl, 45 μl or 50 μl dose being preferred.
[0310] For day-old poultry, the spray vaccine may contain a dose in a volume of 25 to 1000 μl. Preferably, a single dose for the spray vaccine has a total volume of about 50 μl to 5000 μl, more preferably about 75 μl to 2000 μl, more preferably about 100 μl to 1000 μl, even more preferably about 200 μl to 900 μl, even more preferably about 300 μl to 800 μl, and even more preferably about 400 μl to 700 μl, with a single 400 μl, 425 μl, 450 μl, 475 μl, 500 μl, 525 μl, 550 μl, 575 μl, 600 μl, 625 μl, 650 μl, 675 μl or 700 μl dose being preferred. Most preferably, a single dose has a total volume of 400 μl, 450 μl, 500 μl, 550 μl, 600 μl, 650 μl or 700 μl.
[0311] The vaccine for in ovo vaccination may contain a dose in a volume of 50 to 100 μl, preferably 50 μl. Preferably, a single dose for in ovo vaccination has a total volume of about 10 μl to 250 μl, more preferably about 15 μl to 200 μl, even more preferably about 20 μl to 150 μl, even more preferably about 30 μl to 100 μl, even more preferably about 30 μl to 75 μl, and wherein a single 30 μl, 35 μl, 40 μl, 45 μl, 50 μl, 55 μl, 60 μl, 65 μl, 70 μl or 75 μl dose is preferred. Most preferably, a single dose has a total volume of 40 μl, 45 μl, 50 μl, 55 μl or 60 μl.
[0312] One dose of the vaccine for intramuscular or subcutaneous vaccination or the drinking water vaccine may contain a dose in a volume of 30 μl to 1000 μl. Preferably, a single dose has a total volume of about 30 μl to 1000 μl, more preferably about 50 μl to 500 μl, more preferably about 75 μl to 250 μl, and even more preferably about 100 μl to 200 μl, with a single 100 μl, 110 μl, 120 μl, 125 μl, 130 μl, 135 μl, 140 μl, 145 μl, 150 μl, 160 μl, 170 μl, 175 μl, 180 μl, 190 μl, 155 μl or 200 μl dose being most preferred.
[0313] In a particular aspect of the method or use according to the invention, the immunogenic composition or vaccine is administered in two or more doses.
[0314] However, the immunogenic composition may be administered in two or more doses, with a first dose being administered prior to a second (boost) dose.
[0315] In a preferred aspect of the two-dose regimen, the first and second doses of the immunogenic composition are administered in the same amount. Preferably, each dose is the preferred amount specified above. In addition to the first and second dose regimens, an alternative embodiment comprises further subsequent doses. For example, a third, fourth, or fifth dose may be administered in these aspects. Preferably, the subsequent third, fourth, and fifth dose regimens are administered in the same amount as the first dose, with the time frame between doses being consistent with the time schedule between the first and second doses mentioned above.
[0316] Preferably, the first time of vaccine is used by the method as described below in the first three weeks of age, more preferably in the first week of age, and most preferably carried out in one-day age. The second time of use can be in the first 20 weeks of age, preferably in 16-18 weeks of age, more preferably carried out between 6-12 weeks of age. Exemplarily, initial (first time) vaccination is carried out when 1-10 days of age, and the second time vaccination (reinforcement) is carried out with live vaccine or inactivated vaccine when 6-12 or 16-18 weeks of age. More preferably, initial (first time) vaccination is carried out when one-day age, and the second time vaccination (reinforcement) is carried out with live vaccine or inactivated vaccine when 6-12 or 16-18 weeks of age.
[0317] Where in ovo vaccination is used, the first administration is preferably carried out when the embryo is 15 to 19 days old, preferably at 17, 18 or 19 days old, and most preferably at 18 days old. The second administration may be carried out within the first three weeks of age, preferably within the first 10 days of age.
[0318] In a specific aspect of the method or use according to the invention, the immunogenic composition or vaccine is administered subcutaneously, intramuscularly, orally, in ovo, via spray, via drinking water or by eye drops.
[0319] The immunogenic composition is preferably administered topically or systemically. Suitable routes of administration for conventional use are oral or parenteral administration, such as intranasal, intravenous, intradermal, transdermal, intramuscular, intraperitoneal, subcutaneous, and suction, in an egg, via spray, via drinking water or by eye drops. However, depending on the properties and mode of action of the compound, the immunogenic composition may also be administered by other routes. For example, such other routes include intradermal, intravenous, intravascular, intraarterial, intraperitoneal, intrathecal, intratracheal, intradermal, intracardial, intralobar (intralobally), intralobular, intramedullary, intrapulmonary, rectal, and intravaginal. However, most preferably, the immunogenic composition is administered subcutaneously, intramuscularly, orally, in an egg, via spray, via drinking water or by eye drops.
[0320] The live IBV vaccine is preferably administered individually by eye drops, intranasally, intramuscularly or subcutaneously.
[0321] More preferably, a number of application methods are used, including drinking water and aerosol spray vaccination.Also preferred is the use of the vaccine as an embryonic vaccine (so called in ovo vaccine), as further described below.
[0322] For example, broiler chickens can be vaccinated at one day old or 1-3 weeks old, especially for broilers with high levels of MDA. Egg-laying or breeding flocks can be initially vaccinated at 1-10 days of age and boosted with the vaccine at 7-12 or 16-18 weeks of age.
[0323] In ovo administration
[0324] As outlined above, the present invention also provides an IBV vaccine that can be safely administered via the intra-ovo route and can simultaneously induce a protective immune response. In-ovo administration is well known to those skilled in the art, and those skilled in the art can effortlessly perform intra-ovo administration. In-ovo administration of the vaccine involves administering the vaccine to an avian embryo when contained in an egg (for a review of intra-ovo vaccination, see: Ricks et al., Advances in Vet. Med. 495-515, 1999). As described in the art (Sharma; Am. J. Vet. Res. 45 1619-1623, 1984), the vaccine can be administered to any suitable egg compartment (e.g., allantoic fluid, yolk sac, amniotic membrane, air chamber or embryo). Preferably, the vaccine is administered below the shell (air chamber) membrane and the chorioallantoic membrane.
[0325] Preferably, the vaccine is injected into embryonated eggs during the later stages of embryonic development, generally during the last quarter of the incubation period, preferably 3-4 days before hatching. Preferably, administration is performed when the embryo is 15 to 19 days old, preferably 17, 18 or 19 days old, and most preferably 18 days old. Subsequently, the vaccinated embryonated eggs are transferred to an incubator for hatching. The process of intra-ovo administration can be automated using a robotic injection process as described in the prior art.
[0326] Conventional vaccines used for post-hatching vaccination of poultry cannot be used for in ovo vaccination because late embryos are highly susceptible to infection by most vaccine viruses examined. However, International Patent Application WO 01 / 64244 discloses that an IBV vaccine can be used for in ovo administration, provided that it is administered at very low doses. Further, Wakenell et al. 1986 (Am. J. Vet. Res., 47 933-938) disclose that passage of an IB vaccine virus in tissue culture renders the virus apathogenic to the embryo.
[0327] In a particular aspect of the method or use according to the invention, the immunogenic composition or vaccine is administered via eye drops.
[0328] Typically, live vaccines for post-hatch administration contain 10 1 to 10 8 EID 50 (50% egg infectious dose) / dose concentration of attenuated IBV, preferably 10 2 to 10 5 EID 50 / dose concentration, and more preferably 10 2 to 10 4 EID 50 / unit dose concentration, and even more preferably at 10 2 to 10 3 EID 50 / dose concentration.
[0329] Live vaccines for in ovo administration typically contain 10 2 to 10 7 EID 50 / embryo, preferably 10 2 to 10 3 EID 50 / embryo attenuated IBV amount.
[0330] Preferably, the immunogenic composition of the present invention comprises an amount of about 1 to about 10 log 10 EID (Egg Infectious Dose) 50 / ml / dose of the IBV of the present invention, preferably from about 2 to about 8 log 10 EID 50 / dose, preferably from about 2 to about 7 log 10 EID 50 / dose amount, more preferably from about 2 to about 6 log 10 EID 50 / dose, even more preferably in an amount of about 2 to about 5 log 10 EID 50 / dose amount, even more preferably from about 2 to about 4 log 10 EID 50 / dose amount, most preferably about 2 to about 3 log 10 EID 50 More preferably, the immunogenic composition of the present invention comprises an amount of about 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5 or log 10 EID 50 / dose of IBV of the present invention.
[0331] In a particular aspect of the method or use according to the invention, the immunogenic composition or vaccine comprises 1 to 10 log 10 EID 50 / dose of IBV.
[0332] In a particular aspect of the method or use according to the invention, the immunogenic composition or vaccine comprises 2 to 5 log 10 EID 50 / dose of IBV.
[0333] In a particular aspect of the method or use according to the invention, the immunogenic composition or vaccine comprises 2 to 4 log 10 EID 50 / dose of IBV.
[0334] In a specific aspect of the method or use according to the invention, the immunogenic composition or vaccine is administered to a subject within the first week of age, within the first three days of age, within the first two days of age or within the first day of age.
[0335] Preferably, the subject to be immunized is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 days old. More preferably, the subject to be immunized is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days old. Most preferably, the subject to be immunized is 1, 2, 3, 4, 5, 6, or 7 days old.
[0336] However, it must be understood that after vaccination of subjects at a few days of age, the immune system of poultry does require several days to build up immunity against IBV infection. Therefore, preferably, subjects are immunized within the first 24 hours of age.
[0337] In a specific aspect of the method or use according to the invention, the immunogenic composition or vaccine is administered to a subject within the first day of age. As shown in the Examples, the immunogenic composition as provided herein has been shown to be safe and effective when administered to 1 day old poultry.
[0338] In a specific aspect of the method or use according to the invention, the method results in an improvement in an efficacy parameter selected from the group consisting of: prevention or reduction of ciliary arrest, prevention or reduction of rales, prevention or reduction of decreased egg production, prevention or reduction of kidney damage, prevention or reduction of watery diarrhea, prevention or reduction of weight loss, lower viral load, reduced viral shedding, or a combination thereof, compared to subjects in an untreated control group of the same species.
[0339] The terms "treatment and / or prevention" have been defined elsewhere, wherein the terms "prophylaxis" and "preventing" or "prevention" are used interchangeably in this application. Further, the term "shedding" has also been defined elsewhere.
[0340] The terms "reducing," "reduced," "reduction," or "lowering" mean that the efficacy parameter (ciliostasis, rales, decreased egg production, kidney damage, watery diarrhea, weight loss, viral load, viral shedding) is reduced by at least 10%, preferably at least 20%, more preferably at least 30%, even more preferably at least 40%, even more preferably at least 50%, even more preferably at least 60%, even more preferably at least 70%, even more preferably at least 80%, even more preferably at least 90%, even more preferably at least 95%, and most preferably 100%, compared to an unimmunized control group of the same species. How to measure the improvement of an efficacy parameter is within the general knowledge of those skilled in the art.
[0341] The term "viral load" or "viral titer" is a measure of the severity of an active viral infection and can be determined by methods well known to those skilled in the art. The term "viral titer" is a measure of the viral preparation of infection units / volume. Viral titer is the endpoint in a biological procedure and is defined as the dilution at which a certain proportion of tests performed in parallel show an effect (Reed and Muench, 1938). Determination can be based on, for example, viral protein detection by antibodies bound to viral proteins, and further detection or alternative detection by amplification methods such as RT-PCR viral RNA detection. Monitoring the virion-related viral RNA in blood plasma by nucleic acid amplification methods is a widely used parameter to evaluate the state and progression of retroviral diseases, and to assess the effectiveness of preventive interventions and therapeutic interventions. Exemplarily, viral load or viral titer can be calculated by estimating the viral activity in the body fluids involved, for example, the RNA copy number per milliliter of blood plasma.
[0342] The term "ciliostasis" is well known to those skilled in the art. The surface of the trachea is covered with specialized epithelial cells, which are lined with numerous, motile, hair-like structures called cilia. The term "ciliostasis" includes a reduction or loss of cilia and / or a loss or partial loss of ciliary activity. Ciliosis can be readily determined by those skilled in the art.
[0343] The term "rale" is well known to those skilled in the art. However, the term "rale" includes tracheal rales and refers to sounds emitted from the bronchi. Rales can be easily determined by those skilled in the art.
[0344] The term "drop in egg production" is well known to those skilled in the art. The term "drop in egg production" includes decreased egg production.
[0345] In a specific aspect of the method or use according to the invention, the treatment or prevention results in prevention or reduction of ciliary arrest compared to an untreated control group of subjects of the same species.
[0346] In a specific aspect of the method or use according to the invention the treatment or prevention results in prevention or reduction of kidney damage compared to an untreated control group of subjects of the same species.
[0347] In a specific aspect of the method or use according to the invention the treatment or prevention results in prevention or reduction of a decrease in egg production compared to an untreated control group of subjects of the same species.
[0348] The present invention further provides a viral particle, avian coronavirus, IBV, immunogenic composition or vaccine as described herein for use in therapeutic treatment.
[0349] The present invention further provides a viral particle, avian coronavirus, IBV, immunogenic composition or vaccine as described herein for use as an immunogen or vaccine.
[0350] The present invention further provides a viral particle, avian coronavirus, IBV, immunogenic composition or vaccine as described herein for use as a medicament.
[0351] The present invention further provides the use of a viral particle, avian coronavirus, IBV, immunogenic composition or vaccine as described herein for the manufacture of a medicament.
[0352] The present invention further provides the use of a viral particle, avian coronavirus, IBV, immunogenic composition or vaccine as described herein for treating and / or preventing an IBV infection in a subject.
[0353] Technical Solution
[0354] This article also describes the following technical solutions:
[0355] 1. An avian coronavirus spike protein or a fragment thereof, wherein at least a portion of the S1 subunit is derived from an avian coronavirus with limited cell tropism or tissue tropism, and wherein the amino acid position 267 is cysteine.
[0356] 2. A recombinant avian coronavirus spike protein or a fragment thereof comprising a mutation to cysteine at amino acid position 267.
[0357] 3. An IBV spike protein or a fragment thereof, wherein at least a portion of the S1 subunit is from an IBV with limited cell tropism or tissue tropism, and wherein there is cysteine at amino acid position 267.
[0358] 4. A recombinant IBV spike protein or a fragment thereof comprising a mutation to cysteine at amino acid position 267.
[0359] Mutation 267
[0360] 5. The avian coronavirus or IBV spike protein or a fragment thereof of technical solution 1 or 3, wherein cysteine at amino acid position 267 is introduced by mutation.
[0361] 6. The avian coronavirus or IBV spike protein or fragment thereof of technical solution 2, 4 or 5, wherein the mutation is an amino acid substitution, deletion or insertion.
[0362] 7. The avian coronavirus or IBV spike protein or a fragment thereof according to any one of technical solutions 2 and 4 to 6, wherein the hydrophobic amino acid at amino acid position 267 is mutated to cysteine; or the phenylalanine or leucine at amino acid position 267 is mutated to cysteine.
[0363] Extended cell tropism or tissue tropism
[0364] 8. The avian coronavirus or IBV spike protein or fragment thereof according to any one of technical solutions 1 to 7, wherein the cysteine at amino acid position 267 or the mutation to cysteine at amino acid position 267 results in extended cell tropism or tissue tropism of the avian coronavirus or IBV.
[0365] 9. The avian coronavirus or IBV spike protein or fragment thereof according to any one of technical solutions 1 to 8, wherein the avian coronavirus or IBV infects and / or replicates in at least one cell line or cell selected from the following list: primary chicken embryo cells or primary chicken fibroblasts from the lung or liver, chicken embryo fibroblast cell line, duck embryo stem cell line, human embryonic kidney cell line, baby hamster kidney cell line, African green monkey kidney cell line, rabbit kidney cell line, canine kidney cell line, chicken liver cell line, bovine kidney cell line, pig kidney cell line and insect cell line.
[0366] 10. The avian coronavirus or IBV spike protein or fragment thereof of any one of technical solutions 1 to 9, wherein the avian coronavirus or IBV infects and / or replicates in at least one cell line selected from the following list: DF-1 (Douglas Foster), EB66 (duck embryo stem cell line), PBS-12, PBS-12SF (serum-free PBS-12), BHK21 (baby hamster kidney), HEK293T (human embryonic kidney), Vero (Verda Reno), MA104, RK13 (rabbit kidney), LMH (leghorn male liver cancer), MDCK (Martin Darby dog kidney), MDBK (Martin Darby bovine kidney), PK15 (pig kidney), PK2A (pig kidney), SF9, SF21 and SF+ (Frugiperda).
[0367] 11. The avian coronavirus or IBV spike protein or fragment thereof according to any one of technical solutions 1 to 10, wherein the avian coronavirus or IBV infects and / or replicates in at least one cell line selected from the following list: DF-1, EB66, PBS-12, PBS-12SF, BHK, HEK 293T, Vero, MA104 and RK13.
[0368] Numbering of amino acid position 267
[0369] 12. The avian coronavirus or IBV spike protein or fragment thereof according to any one of technical solutions 1 to 11, wherein the numbering of amino acid position 267 refers to amino acid position 267 in the spike protein of IBV H52, IBV H120 or M41.
[0370] 13. The avian coronavirus or IBV spike protein or fragment thereof according to any one of technical solutions 1 to 12, wherein the numbering of amino acid position 267 refers to amino acid position 267 in the spike protein of IBV H52.
[0371] 14. The avian coronavirus or IBV spike protein or fragment thereof according to any one of technical solutions 1 to 12, wherein the numbering of amino acid position 267 refers to amino acid position 267 in the spike protein as exemplarily given in SEQ ID NO: 1.
[0372] 15. The avian coronavirus or IBV spike protein or a fragment thereof according to any one of technical solutions 1 to 12, wherein the amino acid sequence of SEQ ID NO: 1 is used to determine the position number in the spike protein.
[0373] 16. The avian coronavirus or IBV spike protein or fragment thereof according to any one of technical solutions 1 to 12, wherein in order to determine the amino acid position 267 in the spike protein, the amino acid sequence is compared with the amino acid sequence of SEQ ID NO: 1.
[0374] 17. The avian coronavirus or IBV spike protein or fragment thereof according to any one of technical solutions 1 to 16, wherein the amino acid position 267 is within the S1 subunit of the spike protein.
[0375] 18. The avian coronavirus or IBV spike protein or fragment thereof according to any one of technical solutions 1 to 17, wherein the spike protein has one or more of the following amino acids selected from:
[0376] -264 is asparagine, and / or
[0377] -265 is threonine, and / or
[0378] -269 is leucine, and / or
[0379] -271 is asparagine, and / or
[0380] -272 is phenylalanine.
[0381] spike
[0382] 19. The avian coronavirus spike protein or a fragment thereof of any one of technical solutions 1 and 2 and 5 to 18, wherein the avian coronavirus spike protein or a fragment thereof is selected from: infectious bronchitis virus (IBV); guinea fowl coronavirus (GfCoV) and turkey coronavirus (TCoV; turkey enteritis virus and blue crown virus).
[0383] 20. The avian coronavirus spike protein or a fragment thereof according to any one of technical solutions 1 and 2 and 5 to 19, wherein the avian coronavirus is IBV (infectious bronchitis virus).
[0384] 21. The IBV spike protein or fragment thereof of any one of technical solutions 3 to 20, wherein the spike protein is from an IBV having a genotype, serotype or strain selected from the following list: Arkansas (e.g., Arkansas 99), Brazil (e.g., BR-1, BR-2, 23 / 2013, IBV / Brasil / 351 / 1984), California (e.g., California 1734 / 04, California 99), Connecticut, Delaware (e.g., Delaware 98), Dutch (e.g., D207, D212, D274, D3128, D3896, D8880, D1466), Florida, Georgia (e.g., Georgia GA-07, GA-08, GA-12, GA-13), Gray, Holte, Iowa (e.g., Iowa 97 and Iowa 69), Italy 02, JMK, LDT3, Maine (e.g., Maine 209), Massachusetts (e.g., M41, H52, H120; excluding Beaudette), Pennsylvania (e.g., Pennsylvania 1220 / 98, Pennsylvania Wolg / 98), PL84084, Qu (e.g., Qu-mv), QX (e.g., GB341 / 96), Q1, SE 17, variant 2 (e.g., IS / 1494 / 06, IBV / Ck / EG / CU / 4 / 2014, gammaCoV / Ck / Poland / G052 / 2016), and 4 / 91 (793B, CR88).
[0385] 22. The IBV spike protein or a fragment thereof according to any one of technical solutions 3 to 21, wherein the spike protein is not from the Beaudette strain.
[0386] 23. The IBV spike protein or fragment thereof of any one of technical solutions 3 to 22, wherein the spike protein or fragment thereof is from an IBV selected from the following genotypes or serotypes or strains: Massachusetts (not Beaudette), 4 / 91, QX, Q1, Italy 02, Arkansas, Conneticut, Georgia, LDT3, PL84084, variant 2 and Brazil.
[0387] 24. The IBV spike protein or fragment thereof of any one of technical solutions 3 to 23, wherein the spike protein or fragment thereof is from an IBV selected from the following genotype or serotype list: Massachusetts (not Beaudette), 4 / 91, QX, Q1, Arkansas, variant 2 and Brazil.
[0388] 25. The IBV spike protein or fragment thereof according to any one of technical solutions 3 to 24, wherein the spike protein or fragment thereof is from an IBV selected from the following genotype or serotype list: Massachusetts (not Beaudette) and 4 / 91.
[0389] 26. The IBV spike protein or a fragment thereof of technical solution 24, wherein the Massachusetts strain is selected from the following list: H120, H52, Spain / 98 / 308, IBMA5-1, SD / 97 / 01, Spain / 96 / 334 and M41-M21883.
[0390] 27. The IBV spike protein or a fragment thereof of technical solution 24, wherein the 4 / 91 strain is selected from the following list: Spain / 98 / 328, Spain / 92 / 35, IR-3654-VM, FR-CR88061-88, FR-85131-85, UK-1233-95, UK / 3 / 91, Spain / 00 / 336, UK / 7 / 91, pathogenic 4 / 91, attenuated 4 / 91 and IB4-91.
[0391] 28. The IBV spike protein or a fragment thereof of technical solution 24, wherein the QX strain is selected from the following list: FR-L1450T-05, FR-L1450L-05, NL-L1449T-04, NL-L1449K-04, IBV / Ck / SP / 170 / 09, IBV / Ck / SP / 79 / 08, IBV / Ck / SP / 248 / 09, HBN, IBVQX, LX4, BJQ, CK / CH / LGD / 03, SP2013-01470, SP2013-014171, SP2013-01478 and GB341 / 96.
[0392] 29. The IBV spike protein or a fragment thereof of technical solution 24, wherein the Q1 strain is selected from the following list: CK / CH / LDL / 98I, CK / CH / LSD / 08-10, J2, Q1, AR08ER22, AR08BA21, 12.185, 12.124, 12.216 and Chile-295-10.
[0393] 30. The IBV spike protein or a fragment thereof of technical solution 24, wherein the Arkansas strain is selected from the following list: Ark99, ArkGA, ArkDPI, AL / 5364 / 00, ARKDPI11, AL / 0803 / 01, AL / 7149 / 00, ArkDPI101, AL / 1221 / 01, AL / 1793 / 01 and AL / 4614 / 98.
[0394] 31. The IBV spike protein or a fragment thereof of technical solution 24, wherein the Italy 02 strain is selected from the following list: Spain / 99 / 316, Italy-02, UK-L633-04, It-497-02, Spain / 05 / 866, Spain / 04 / 221, Spain / 00 / 337, Spain / 155 / 09 and Spain / 03 / 08.
[0395] 32. The IBV spike protein or a fragment thereof of technical solution 24, wherein the variant 2 strain is selected from the following list: IS / 1494 / 06, IBV / Ck / EG / CU / 4 / 2014, gammaCoV / Ck / Poland / G052 / 2016, Eg / CLEVB-2 / IBV / 012, D1344 / 2 / 4 / 10_EG, TR8 and IB VAR2-06.
[0396] 33. The IBV spike protein or a fragment thereof of technical solution 24, wherein the Brazil strain is selected from the following list: BR-1, BR-2, 23 / 2013 and IBV / Brasil / 351 / 1984.
[0397] 34. The IBV spike protein or fragment thereof according to any one of technical solutions 3 to 24, wherein the spike protein or fragment thereof is from an IBV of the Massachusetts (not Beaudette), 4 / 91 or QX genotype or serotype.
[0398] 35. The IBV spike protein or a fragment thereof according to any one of technical solutions 3 to 24, wherein the IBV strain is H52, H120, QX SP2013-01478 or CR88.
[0399] 36. The IBV spike protein or fragment thereof of any one of technical solutions 3 to 35, wherein the IBV spike protein or fragment thereof consists of or comprises the following: an amino acid sequence as shown in SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 77, or a sequence having at least 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.95%, 99.98% or 99.99% sequence identity thereto.
[0400] 37. The IBV spike protein or a fragment thereof according to any one of technical solutions 3 to 36, wherein the IBV spike protein or a fragment thereof is selected from the following genotype list: GI-2 to 27, GII-1, GIII-1, GIV-1, GV-1, GVI-1.
[0401] 38. The IBV spike protein or fragment thereof according to any one of technical solutions 3 to 37, wherein the spike protein or fragment thereof is not from the GI-1 genotype.
[0402] 39. The avian coronavirus spike protein or fragment thereof of any one of technical solutions 1 and 5 to 38, wherein at least a portion of the S1 subunit from an avian coronavirus with limited cell tropism or tissue tropism is selected from: infectious bronchitis virus (IBV); guinea fowl coronavirus (GfCoV) and turkey coronavirus (TCoV; turkey enteritis virus and blue crown virus).
[0403] 40. The avian coronavirus spike protein or fragment thereof according to any one of technical solutions 1 and 5 to 38, wherein at least a portion of the S1 subunit from the avian coronavirus with limited cell tropism or tissue tropism is derived from IBV (infectious bronchitis virus).
[0404] 41. The IBV spike protein or fragment thereof of any one of technical solutions 3 and 5 to 40, wherein at least a portion of the S1 subunit is from an IBV selected from the following genotypes or serotypes or strains: Arkansas (e.g., Arkansas99), Brazil (e.g., BR-1, BR-2, 23 / 2013, IBV / Brasil / 351 / 1984), California (e.g., California1734 / 04, California 99), Connecticut, Delaware (e.g., Delaware 98), Dutch (e.g., D207, D212, D274, D3128, D3896, D8880, D1466), Florida, Georgia (e.g., Georgia GA-07, GA-08, GA-12, GA-13), Gray, Holte, Iowa (e.g., Iowa 97 and Iowa 69), Italy 02, JMK, LDT3, Maine (e.g., Maine 209), Massachusetts (e.g., M41, H52, H120; excluding Beaudette), Pennsylvania (e.g., Pennsylvania 1220 / 98, Pennsylvania Wolg / 98), PL84084, Qu (e.g., Qu-mv), QX (e.g., GB341 / 96), Q1, SE 17, variant 2 (e.g., IS / 1494 / 06, IBV / Ck / EG / CU / 4 / 2014, gammaCoV / Ck / Poland / G052 / 2016), and 4 / 91 (793B, CR88).
[0405] 42. The IBV spike protein or fragment thereof of any one of technical solutions 3 and 5 to 41, wherein at least a portion of the S1 subunit is from an IBV selected from the following genotypes or serotypes or strains: Massachusetts (not Beaudette), 4 / 91, QX, Q1, Italy 02, Arkansas, Conneticut, Georgia, LDT3, PL84084, variant 2 and Brazil.
[0406] 43. The IBV spike protein or fragment thereof of any one of technical solutions 3 and 5 to 41, wherein at least a portion of the S1 subunit is from an IBV selected from the following genotypes or serotypes or strains: Massachusetts, 4 / 91, QX, Q1, Arkansas, variant 2 and Brazil.
[0407] 44. The IBV spike protein or a fragment thereof of technical solution 43, wherein the Massachusetts strain is selected from the following list: H120, H52, Spain / 98 / 308, IBMA5-1, SD / 97 / 01, Spain / 96 / 334 and M41-M21883.
[0408] 45. The IBV spike protein or a fragment thereof of technical solution 43, wherein the 4 / 91 strain is selected from the following list: Spain / 98 / 328, Spain / 92 / 35, IR-3654-VM, FR-CR88061-88, FR-85131-85, UK-1233-95, UK / 3 / 91, Spain / 00 / 336, UK / 7 / 91, pathogenic 4 / 91, attenuated 4 / 91 and IB4-91.
[0409] 46. The IBV spike protein or a fragment thereof of technical solution 43, wherein the QX strain is selected from the following list: FR-L1450T-05, FR-L1450L-05, NL-L1449T-04, NL-L1449K-04, IBV / Ck / SP / 170 / 09, IBV / Ck / SP / 79 / 08, IBV / Ck / SP / 248 / 09, HBN, IBVQX, LX4, BJQ, CK / CH / LGD / 03 and GB341 / 96.
[0410] 47. The IBV spike protein or a fragment thereof of technical solution 43, wherein the Q1 strain is selected from the following list: CK / CH / LDL / 98I, CK / CH / LSD / 08-10, J2, Q1, AR08ER22, AR08BA21 and Chile-295-10.
[0411] 48. The IBV spike protein or a fragment thereof of technical solution 43, wherein the Arkansas strain is selected from the following list: Ark99, ArkGA, ArkDPI, AL / 5364 / 00, ARKDPI11, AL / 0803 / 01, AL / 7149 / 00, ArkDPI101, AL / 1221 / 01, AL / 1793 / 01 and AL / 4614 / 98.
[0412] 49. The IBV spike protein or a fragment thereof of technical solution 43, wherein the variant 2 strain is selected from the following list: IS / 1494 / 06, IBV / Ck / EG / CU / 4 / 2014, gammaCoV / Ck / Poland / G052 / 2016, Eg / CLEVB-2 / IBV / 012, D1344 / 2 / 4 / 10_EG, TR8 and IB VAR2-06.
[0413] 50. The IBV spike protein or a fragment thereof of technical solution 43, wherein the Brazil strain is selected from the following list: BR-1, BR-2, 23 / 2013 and IBV / Brasil / 351 / 1984.
[0414] 51. The IBV spike protein or fragment thereof of any one of technical solutions 3 and 5 to 43, wherein at least a portion of the S1 subunit is from an IBV selected from the following genotype or serotype list: Massachusetts (not Beaudette), QX and 4 / 91.
[0415] 52. The IBV spike protein or fragment thereof according to any one of technical solutions 3 and 5 to 43, wherein at least a portion of the S1 subunit is from IBV strain H120, H52, QX SP2013-01478 or CR88.
[0416] 53. The avian coronavirus spike protein or fragment thereof of any one of technical solutions 1 and 3 and 5 to 52, wherein at least a portion of the S1 subunit is an S1 subunit sequence from an avian coronavirus or IBV with limited cell tropism or tissue tropism, or at least 1, 5, 10, 15, 20, 25, 50, 100, 150, 200, 250, 300, 350, 400 or 500 contiguous amino acids of a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
[0417] 54. The avian coronavirus or IBV spike protein or fragment thereof of any one of technical solutions 1 and 3 and 5 to 52, wherein at least a portion of the S1 subunit is the S1 subunit sequence of the avian coronavirus or IBV from any one of technical solutions 36 to 50, or at least 1, 5, 10, 15, 20, 25, 50, 100, 150, 200, 250, 300, 350, 400 or 500 contiguous amino acids of a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
[0418] 55. The IBV spike protein or fragment thereof of any one of technical solutions 3 and 5 to 52, wherein at least a portion of the S1 subunit from an IBV with limited cell tropism or tissue tropism has an amino acid sequence as shown in SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 77, or at least 1, 5, 10, 15, 20, 25, 50, 100, 150, 200, 250, 300, 350, 400 or 500 contiguous amino acids of a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
[0419] 56. The avian coronavirus or IBV spike protein or fragment thereof of any one of technical solutions 1 and 3 and 5 to 55, wherein the avian coronavirus or IBV with limited cell tropism or tissue tropism is limited to infection and / or replication in embryonated chicken eggs and / or primary chicken kidney cells.
[0420] 57. The avian coronavirus or IBV spike protein or fragment thereof of any one of technical solutions 1 and 3 and 5 to 56, wherein the avian coronavirus or IBV with limited cell tropism or tissue tropism does not infect and / or replicate in EB66 cells.
[0421] 58. The avian coronavirus or IBV spike protein or fragment thereof of any one of technical solutions 1 and 3 and 5 to 56, wherein the avian coronavirus or IBV with limited cell tropism or tissue tropism does not infect and / or replicate in PBS-12 and / or HEK 293T cells.
[0422] snippet
[0423] 59. The avian coronavirus or IBV spike protein or a fragment thereof according to any one of technical solutions 1 to 58, wherein the fragment of the avian coronavirus or IBV spike protein has a length of at least 500, 750, 1000 or 1077 amino acids.
[0424] 60. The avian coronavirus or IBV spike protein or a fragment thereof according to any one of technical solutions 1 to 59, wherein the fragment of the avian coronavirus or IBV spike protein has a length of at least 1000 amino acids.
[0425] 61. The avian coronavirus or IBV spike protein of any one of technical solutions 1 to 60, wherein the cysteine at amino acid position 267 or a mutation to cysteine at amino acid position 267 is genetically stable.
[0426] 62. A nucleotide sequence encoding the spike protein or a fragment thereof of any one of technical solutions 1 to 61.
[0427] 63. A plasmid comprising the nucleotide sequence of technical solution 62.
[0428] 64. A cell comprising the plasmid of technical solution 63.
[0429] 65. A virus particle comprising the spike protein or a fragment thereof of any one of technical solutions 1 to 61.
[0430] 66. An avian coronavirus comprising the spike protein or a fragment thereof of any one of technical solutions 1 to 61.
[0431] 67. An IBV (infectious bronchitis virus) comprising the spike protein of any one of technical solutions 3 to 61.
[0432] 68. The avian coronavirus or IBV of technical solution 66 or 67, wherein the avian coronavirus or IBV is attenuated.
[0433] 69. The avian coronavirus or IBV of any one of technical solutions 66 to 68, wherein the avian coronavirus or IBV is genetically modified.
[0434] 70. The avian coronavirus or IBV of any one of technical solutions 66 to 69, wherein the avian coronavirus or IBV is recombinant.
[0435] 71. The avian coronavirus or IBV of any one of technical solutions 66 to 70, wherein the avian coronavirus or IBV is chimeric.
[0436] 72. The IBV of any one of technical solutions 67 to 71, wherein the IBV is from an IBV having a genotype selected from the following list of strains: Arkansas (e.g., Arkansas 99), Brazil (e.g., BR-1, BR-2, 23 / 2013, IBV / Brasil / 351 / 1984), California (e.g., California 1734 / 04, California 99), Connecticut, Delaware (e.g., Delaware 98), Dutch (e.g., D207, D212, D274, D3128, D3896, D8880, D1466), Florida, Georgia (e.g., Georgia GA-07, GA-08, GA-12, GA-13), Gray, Holte, Iowa (e.g., Iowa 97 and Iowa 69), Italy 02, JMK, LDT3, Maine (e.g., Maine 209), Massachusetts (M41, H52, H120, Beaudette), Pennsylvania (e.g., Pennsylvania 1220 / 98, Pennsylvania Wolg / 98), PL84084, Qu (e.g., Qu-mv), QX (e.g., GB341 / 96), Q1, SE 17, variant 2 (e.g., IS / 1494 / 06, IBV / Ck / EG / CU / 4 / 2014, gammaCoV / Ck / Poland / G052 / 2016), and 4 / 91 (793B, CR88).
[0437] 73. The IBV of any one of technical solutions 67 to 72, wherein the IBV is selected from the following genotype or serotype list: Massachusetts, 4 / 91, QX, Q1, Italy 02, Arkansas, Conneticut, Georgia, LDT3, PL84084, variant 2 and Brazil.
[0438] 74. The IBV of any one of technical solutions 67 to 73, wherein the IBV is selected from the following list of genotypes or serotypes: Massachusetts, 4 / 91, QX, Q1, Arkansas, variant 2 and Brazil.
[0439] 75. The IBV of technical solution 74, wherein the Massachusetts strain is selected from the following list: H120, H52, Spain / 98 / 308, IBMA5-1, SD / 97 / 01, Beaudette, Spain / 96 / 334 and M41-M21883.
[0440] 76. The IBV of technical solution 74, wherein the 4 / 91 strain is selected from the following list: Spain / 98 / 328, Spain / 92 / 35, IR-3654-VM, FR-CR88061-88, FR-85131-85, UK-1233-95, UK / 3 / 91, Spain / 00 / 336, UK / 7 / 91, pathogenic 4 / 91, attenuated 4 / 91 and IB4-91.
[0441] 77. The IBV of technical solution 74, wherein the QX strain is selected from the following list: FR-L1450T-05, FR-L1450L-05, NL-L1449T-04, NL-L1449K-04, IBV / Ck / SP / 170 / 09, IBV / Ck / SP / 79 / 08, IBV / Ck / SP / 248 / 09, HBN, IBVQX, LX4, BJQ, CK / CH / LGD / 03 and GB341 / 96.
[0442] 78. The IBV of technical solution 74, wherein the Q1 strain is selected from the following list: CK / CH / LDL / 98I, CK / CH / LSD / 08-10, J2, Q1, AR08ER22, AR08BA21 and Chile-295-10.
[0443] 79. The IBV of technical solution 74, wherein the Italy 02 strain is selected from the following list: Spain / 99 / 316, Italy-02, UK-L633-04, It-497-02, Spain / 05 / 866, Spain / 04 / 221, Spain / 00 / 337, Spain / 155 / 09 and Spain / 03 / 08.
[0444] 80. The IBV of technical solution 74, wherein the Arkansas strain is selected from the following list: Ark99, ArkGA, ArkDPI, AL / 5364 / 00, ARKDPI11, AL / 0803 / 01, AL / 7149 / 00, ArkDPI101, AL / 1221 / 01, AL / 1793 / 01 and AL / 4614 / 98.
[0445] 81. The IBV of technical solution 74, wherein the variant 2 strain is selected from the following list: IS / 1494 / 06, IBV / Ck / EG / CU / 4 / 2014, gammaCoV / Ck / Poland / G052 / 2016, Eg / CLEVB-2 / IBV / 012, D1344 / 2 / 4 / 10EG, TR8 and IB VAR2-06.
[0446] 82. The IBV of technical solution 74, wherein the Brazil strain is selected from the following list: BR-1, BR-2, 23 / 2013 and IBV / Brasil / 351 / 1984.
[0447] 83. The IBV of any one of technical solutions 67 to 74, wherein the spike protein or fragment thereof is from an IBV of the Massachusetts or 4 / 91 genotype or serotype.
[0448] 84. The IBV of any one of technical solutions 67 to 74, wherein the IBV strain is H120, H52 or CR88.
[0449] 85. The BV of any one of technical solutions 67 to 84, wherein the IBV has an IBV spike protein or a fragment thereof consisting of or comprising the following: an amino acid sequence as shown in SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 77, or a sequence having at least 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.95%, 99.98% or 99.99% sequence identity thereto.
[0450] 86. The IBV of any one of technical solutions 67 to 85, wherein the IBV has extended cell tropism or tissue tropism.
[0451] 87. The IBV of any one of technical solutions 67 to 86, wherein the IBV infects and / or replicates in at least one cell line or cell of any one of technical solutions 9 to 11.
[0452] 88. A cell comprising:
[0453] -The virus particle of technical solution 65, or
[0454] -The avian coronavirus or IBV of any one of technical solutions 66 to 87.
[0455] 89. The cell of technical solution 88, wherein the cell is a cell line or cell selected from the following list: primary chicken embryo cells, chicken embryo fibroblast cell line, duck embryo stem cell line, human embryonic kidney cell line, baby hamster kidney cell line, African green monkey kidney cell line, rabbit kidney cell line, canine kidney cell line, chicken liver cell line, bovine kidney cell line, pig kidney cell line and insect cell line.
[0456] 90. The cell of technical solution 88 or 89, wherein the cell is a cell line selected from the following list: DF-1 (Douglas Foster), EB66 (duck embryo stem cell line), PBS-12, PBS-12SF (serum-free PBS-12), BHK21 (baby hamster kidney), HEK 293T (human embryonic kidney), Vero (Verda Reno), MA104, RK13 (rabbit kidney), LMH (leghorn male liver cancer), MDCK (Martin Darby dog kidney), MDBK (Martin Darby bovine kidney), PK15 (pig kidney), PK2A (pig kidney), SF9, SF21 and SF+ (Spodoptera frugiperda).
[0457] 91. The cell of any one of technical solutions 88 to 89, wherein the cell is a cell line selected from the following list: DF-1, EB66, PBS-12, PBS-12SF, BHK, HEK 293T, Vero, MA104 and RK13.
[0458] 92. The cell of technical solution 89, wherein the primary chicken embryo cells are fibroblasts or cells derived from liver or lung tissue.
[0459] 93. An immunogenic composition comprising:
[0460] -The spike protein of any one of technical solutions 1 to 61, or
[0461] -The virus particle of technical solution 65, or
[0462] -The avian coronavirus or IBV of any one of technical solutions 66 to 87.
[0463] 94. A vaccine comprising:
[0464] -The spike protein of any one of technical solutions 1 to 61, or
[0465] -The virus particle of technical solution 65, or
[0466] -The coronavirus or IBV of any one of technical solutions 66 to 87.
[0467] 95. An improved live vaccine with extended cell tropism or tissue tropism, comprising:
[0468] -The spike protein of any one of technical solutions 1 to 61, or
[0469] -The virus particle of technical solution 65, or
[0470] -The coronavirus or IBV of any one of technical solutions 66 to 87.
[0471] 96. The immunogenic composition or vaccine of any one of technical solutions 93 to 95, wherein the immunogenic composition or vaccine comprises a pharmaceutically acceptable carrier.
[0472] 97. The immunogenic composition or vaccine of technical solution 96, wherein the pharmaceutically acceptable carrier is phosphate-buffered saline.
[0473] 98. The immunogenic composition or vaccine of any one of technical solutions 93 to 97, wherein the immunogenic composition or vaccine is effective in treating and / or preventing clinical signs caused by IBV in a subject in need thereof.
[0474] 99. The immunogenic composition or vaccine of any one of technical solutions 93 to 98, wherein the immunogenic composition or vaccine comprises 1 to 10 log 10 EID 50 of IBV.
[0475] 100. The immunogenic composition or vaccine of any one of technical solutions 93 to 99, wherein the immunogenic composition or vaccine comprises 2 to 5 log 10 EID 50 of IBV.
[0476] 101. The immunogenic composition or vaccine of any one of technical solutions 93 to 100, wherein the immunogenic composition or vaccine comprises 2 to 4 log 10 EID 50 of IBV.
[0477] 102. A method for changing the cell tropism or tissue tropism of an avian coronavirus, comprising using the avian coronavirus spike protein or a fragment thereof according to any one of technical solutions 1 to 61.
[0478] 103. A method for expanding the cell tropism or tissue tropism of an avian coronavirus, comprising using the avian coronavirus spike protein or a fragment thereof according to any one of technical solutions 1 to 61.
[0479] 104. A method for producing or manufacturing an avian coronavirus with extended cell tropism or tissue tropism, comprising using the avian coronavirus spike protein or a fragment thereof of any one of technical solutions 1 to 61.
[0480] 105. A method for culturing avian coronavirus in cell culture or tissue culture, comprising using the avian coronavirus spike protein or a fragment thereof of any one of technical solutions 1 to 61.
[0481] 106. A method for modifying an avian coronavirus comprising modifying amino acid position 267 in the spike protein of the avian coronavirus.
[0482] 107. A method for mutating amino acid position 267 in an avian coronavirus spike protein, comprising:
[0483] a) provide the avian coronavirus spike nucleotide or protein sequence,
[0484] b) identifying position 267 in the spike protein by alignment with the reference sequence,
[0485] c) mutating position 267 of the spike protein of step b) into cysteine,
[0486] d) Obtaining the mutated spike protein of step c).
[0487] 108. The method of any one of technical solutions 102 to 106, wherein the spike protein or a fragment thereof has a cysteine at amino acid position 267.
[0488] 109. The method of any one of technical solutions 106 to 108, wherein the cysteine at amino acid position 267 is introduced by mutation.
[0489] 110. The method of technical solution 109, wherein the mutation is an amino acid substitution, deletion or insertion.
[0490] 111. The method of any one of technical solutions 106 to 111, wherein the phenylalanine or leucine at amino acid position 267 is modified or mutated to cysteine.
[0491] 112. The method of any one of technical solutions 102 to 111, wherein the avian coronavirus is the IBV of any one of technical solutions 67 to 87.
[0492] 113. The method of any one of technical solutions 102 to 112, wherein the coronavirus spike protein is the IBV (infectious bronchitis virus) spike protein of any one of technical solutions 3 to 61.
[0493] 114. The method of any one of technical solutions 102 to 113, wherein the cysteine at amino acid position 267 or the mutation to cysteine at amino acid position 267 results in extended cell tropism or tissue tropism.
[0494] 115. The method of any one of technical solutions 102 to 114, wherein the avian coronavirus or IBV infects and / or replicates in at least one cell line or cell of any one of technical solutions 9 to 11.
[0495] 116. The method of any one of technical solutions 106 to 115, wherein the numbering of amino acid position 267 is completed according to any one of technical solutions 12 to 18.
[0496] Kit technical solution
[0497] 117. A kit comprising the viral particles, avian coronavirus, IBV, immunogenic composition or vaccine of any one of technical solutions 65 to 88 and 93 to 101.
[0498] 118. The kit of technical solution 117, wherein the kit further comprises instructions for treating and / or preventing poultry diseases, or instructions for treating and / or preventing poultry diseases, or instructions for treating and / or preventing IB.
[0499] 119. The kit of technical solution 117 or 118, wherein the kit further comprises a dispenser capable of administering the vaccine to the animal.
[0500] Treatment method and technical plan
[0501] 120. A method for immunizing a subject, comprising administering to such subject the immunogenic composition or vaccine of any one of technical solutions 93 to 101.
[0502] 121. A method for treating or preventing clinical signs caused by IBV in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the immunogenic composition or vaccine of any one of technical solutions 93 to 101.
[0503] 122. A method for reducing ciliary arrest in a subject in need thereof, compared to a non-immunized control group of subjects of the same species, the method comprising administering to the subject a therapeutically effective amount of the immunogenic composition or vaccine of any one of technical solutions 93 to 101.
[0504] 123. The immunogenic composition or vaccine of any one of technical solutions 93 to 101, which is used in a method for immunizing a subject, the method comprising administering a therapeutically effective amount of the immunogenic composition or vaccine to the subject.
[0505] 124. The immunogenic composition or vaccine of any one of technical solutions 93 to 101, which is used in a method for treating or preventing clinical signs caused by IBV in a subject in need thereof, the method comprising administering a therapeutically effective amount of the immunogenic composition or vaccine to the subject.
[0506] 125. The immunogenic composition or vaccine of any one of technical solutions 93 to 101, which is used in a method for reducing ciliary arrest in a subject in need thereof compared to a non-immunized control group of subjects of the same species, the method comprising administering to the subject a therapeutically effective amount of the immunogenic composition or vaccine.
[0507] 126. The method or use of any one of technical solutions 120 to 125, wherein the subject is poultry.
[0508] 127. The method or use of any one of technical solutions 120 to 126, wherein the subject is poultry.
[0509] 128. The method or use of any one of technical solutions 120 to 127, wherein the subject is selected from chicken, turkey, quail or pheasant.
[0510] 129. The method or use of any one of technical solutions 120 to 128, wherein the subject is a chicken.
[0511] 130. The method or use of any one of technical solutions 120 to 129, wherein the immunogenic composition or vaccine is administered once.
[0512] 131. The method or use of any one of technical solutions 120 to 129, wherein the immunogenic composition or vaccine is administered in two or more doses.
[0513] 132. The method or use of any one of technical solutions 120 to 131, wherein the immunogenic composition or vaccine is administered subcutaneously, intramuscularly, orally, in ovo, via spray, via drinking water or by eye drops.
[0514] 133. The method or use of any one of technical solutions 120 to 132, wherein the immunogenic composition or vaccine is administered via eye drops.
[0515] 134. The method or use of any one of technical solutions 120 to 133, wherein the immunogenic composition or vaccine comprises 1 to 10 log 10 EID 50 / dose of IBV.
[0516] 135. The method or use of any one of technical solutions 120 to 134, wherein the immunogenic composition or vaccine comprises 2 to 5 log 10 EID 50 / dose of IBV.
[0517] 136. The method or use of any one of technical solutions 120 to 135, wherein the immunogenic composition or vaccine comprises 2 to 4 log 10 EID 50 / dose of IBV.
[0518] 137. The method or use of any one of technical solutions 120 to 136, wherein the immunogenic composition or vaccine is administered to a subject within the first week of age, within the first three days of age, within the first two days of age, or within the first day of age.
[0519] 138. The method or use of any one of technical solutions 120 to 137, wherein the immunogenic composition or vaccine is administered to a subject within the previous day of age.
[0520] 139. The method or use of any one of technical solutions 120 to 138, wherein the method results in an improvement in an efficacy parameter selected from the following: prevention or reduction of ciliary arrest, prevention or reduction of rales, prevention or reduction of decreased egg production, prevention or reduction of renal damage, prevention or reduction of watery diarrhea, prevention or reduction of weight loss, lower viral load, reduced viral shedding, or a combination thereof, compared to subjects in an untreated control group of the same species.
[0521] 140. The method or use of any one of technical solutions 120 to 139, wherein the treatment or prevention results in prevention or reduction of ciliary arrest compared to an untreated control group of subjects of the same species.
[0522] 141. The method or use of any one of technical solutions 120 to 140, wherein the treatment or prevention results in prevention or reduction of kidney damage compared to subjects in an untreated control group of the same species.
[0523] 142. The method or use of any one of technical solutions 120 to 141, wherein the treatment or prevention results in prevention or reduction of decreased egg production compared to an untreated control group of subjects of the same species.
[0524] 143. The viral particle, avian coronavirus, IBV, immunogenic composition or vaccine of any one of technical solutions 65 to 87 and 93 to 101, for therapeutic use.
[0525] 144. The viral particle, avian coronavirus, IBV, immunogenic composition or vaccine of any one of technical solutions 65 to 87 and 93 to 101, which is used as an immunogen or vaccine.
[0526] 145. The viral particle, avian coronavirus, IBV, immunogenic composition or vaccine of any one of technical solutions 65 to 87 and 93 to 101, for use as a medicine.
[0527] 146. Use of the viral particles, avian coronavirus, IBV, immunogenic composition or vaccine of any one of technical solutions 65 to 87 and 93 to 101 for the manufacture of a medicament.
[0528] 147. Use of the viral particle, avian coronavirus, IBV, immunogenic composition or vaccine of any one of technical solutions 65 to 87 and 93 to 101 for treating and / or preventing IBV infection in a subject. BRIEF DESCRIPTION OF THE DRAWINGS
[0529] Figure 1 In ovo kinetics of H52 rIBV S F267C compared to H52 rIBV wild-type virus, as assessed by viral load detection via RT-qPCR. Data points represent the mean of 5 samples per time point. Error bars indicate standard deviation.
[0530] Figure 2 .H52 rIBV S F267C RT-qPCR CT values were determined at the infection time (t=0) and harvest time (t=72) of each passage. P1 to P5 were generated by infecting with a 1 / 10 dilution of the previous passage's viral stock. P6 and P7 were generated by inoculating with a 1 / 1000 dilution of the previous passage. The experiment was repeated at an MOI of 0.001 for the first passage, and similar results were obtained.
[0531] Figure 3 .H52 rIBV S F267C Replication dynamics in cells. Based on the third The TCID50 titer of the passaged cells was propagated and infected with rIBV at an MOI of 0.001. Nucleic acids were isolated at 0, 8, 24, 48, and 72 hpi and analyzed via IBV-specific RT-qPCR. Each data point represents the average ct value of three independent experiments. Error bars indicate the standard error of the mean (SEM).
[0532] Figure 4 .H52 rIBV S F267C Replication kinetics in cells. Samples at time points 0, 8, 24, 48, and 72 hpi were analyzed by TCID50 titration. Results from one experiment are shown.
[0533] Figure 5 Summary of ciliary arrest scores for protection against M41 challenge by H52 rIBV S F267C. The sum of 10 individual scores for 10 rings per animal was calculated and represented by a single point in the graph. Maximum ciliary arrest corresponds to a score of 40, while no ciliary arrest is represented by a score of 0. Means and significance were calculated using GraphPad Prism and a standard one-way ANOVA test (p < 0,0001).
[0534] Figure 6 Summary of RT-qPCR results of kidney tissue 7 days post-challenge for the efficacy study of H52 rIBV S F267C. Each individual bird is indicated by a dot.
[0535] Figure 7 Replication of H52 rIBV S F267C in PBS-12SF cells was determined by immunofluorescence analysis. One of three independent experiments is shown.
[0536] Figure 8 : Replication of H52 rIBV S F267C in PBS-12SF cells was determined via nucleic acid extraction from the supernatant and subsequent RT-qPCR analysis. One of two independent experiments is shown.
[0537] Figure 9 Replication of H52 rIBV S F267C in HEK 293T cells was determined by immunofluorescence analysis. One of three independent experiments is shown.
[0538] Figure 10 In ovo kinetics of CR88 rIBV S L269C compared to CR88 rIBV wild-type virus, as assessed by viral load detection via RT-qPCR. Data points represent the mean of 5 samples per time point. Error bars indicate standard deviation.
[0539] Figure 11 .CR88 rIBV S L269C Passage in cells. RT-qPCR CT values were determined at the infection time point (t=0) and harvest time point (t=72) of each passage. CR88 rIBV wild type was included as a negative control. For CR88 rIBV S L269C, data for P2, P5, and P8 are shown. The CR88 rIBV included in the same passage experiment had one passage missing in the initial passage (P1) and the final passage (P7). Each passage was generated by infecting with a 1 / 100 dilution of the previous passage.
[0540] Figure 12 .CR88 rIBV S L269C Replication dynamics in cells. Based on the third The TCID50 titer of the passaged cells was propagated and infected with rIBV at an MOI of 0.001. Nucleic acids were isolated at 0, 8, 24, 48, and 72 hpi and analyzed via IBV-specific RT-qPCR. Each data point represents the average ct value of three independent experiments. Error bars indicate the standard error of the mean (SEM).
[0541] Figure 13 .CR88 rIBV S L269C Replication kinetics in cells. Samples at time points 0, 8, 24, 48, and 72 hpi were analyzed by TCID50 titration. Results from one experiment are shown.
[0542] Figure 14 Summary of ciliary arrest scores for protection against 793B challenge by CR88 rIBV S L269C. The sum of 10 individual scores for 10 rings per animal was calculated and represented by one point in the graph. Maximum ciliary arrest corresponds to a score of 40, while no ciliary arrest is represented by a score of 0. Means and significance were calculated using GraphPad Prism and a standard one-way ANOVA test (*p<0.02, **p<0.007).
[0543] Figure 15 Summary of RT-qPCR results of kidney tissue 7 days post-challenge for the efficacy study of CR88 rIBV S L269C. Each individual bird is indicated by a dot.
[0544] Figure 16In ovo kinetics of H52 rIBV QX S L270C and CR88 rIBV QX S L270C compared to IBV QX, H52 rIBV, and CR88 rIBV, as assessed by viral load detection via RT-qPCR. Data points represent the mean of 5 samples per time point. Error bars indicate standard deviation.
[0545] Figure 17 .CR88 rIBV QX S L270C RT-qPCR CT values were determined at the infection time point (t=0) and harvest time point (t=72) of each passage.
[0546] Figure 18 .H52 rIBV QX S L270C RT-qPCR CT values were determined at the infection time point (t=0) and harvest time point (t=72) of each passage.
[0547] Figure 19 .H52 rIBV QX S L270C and CR88 rIBV QX S L270C Replication dynamics in cells. Based on the third The TCID50 titer of the propagated passages was determined and cells were infected with rIBV at an MOI of 0.001. Nucleic acids were isolated at 0, 8, 24, and 48 hpi and analyzed via IBV-specific RT-qPCR. Each data point represents the average ct value of three independent experiments performed in triplicate. Error bars indicate the standard error of the mean (SEM).
[0548] Figure 20 Summary of ciliary arrest scores for protection by CR88 rIBV QX S L270C and H52 rIBV QX SL270C against D388 QX challenge. The sum of 10 individual scores for 10 rings per animal was calculated and represented by a single point in the graph. Maximum ciliary arrest corresponds to a score of 40, while no ciliary arrest is represented by a score of 0. Means and significance were calculated using GraphPad Prism and a standard one-way ANOVA test (***p<0.001, ****p<0.0001).
[0549] Figure 21 Summary of RT-qPCR results of kidney tissue 7 days post-challenge for efficacy studies with CR88 rIBV QX S L270C and H52 rIBV QX S L270C. Each individual bird is indicated by a dot.
[0550] Sequence Overview
[0551] SEQ ID NO:1IBV H52 spike protein
[0552] SEQ ID NO: 2 IBV H52 spike protein with F267C mutation
[0553] SEQ ID NO: 3 IBV CR88 spike with L269C mutation
[0554] SEQ ID NO: 4 IBV QX spike protein with L270C mutation
[0555] SEQ ID NO: 5 IBV Q1 spike protein with L271C mutation
[0556] SEQ ID NO:6 IBV Var 2 spike protein with L270C mutation
[0557] SEQ ID NO: 7 IBV BR-1 spike protein with L274C mutation
[0558] SEQ ID NO: 8 IBV Ark spike protein with L274C mutation
[0559] SEQ ID NO:9 pUC57-s H52 rIBV donor plasmid
[0560] SEQ ID NO:10pUC57-s H52 rIBV S F267C donor plasmid
[0561] SEQ ID NO:11IBV CR88 spike sequence
[0562] SEQ ID NO:12pUC57-sCR88 mIBV donor plasmid
[0563] SEQ ID NO:13 pGEM-TIBV CR88 spike plasmid
[0564] SEQ ID NO:14 pUC57-s CR88 rIBV S L269C donor plasmid
[0565] SEQ ID NO: 15 pGEM-TIBV CR88 spike with L269C mutation
[0566] SEQ ID NO: 16 to 64 primers
[0567] SEQ ID NO:65IBV QX spike protein
[0568] SEQ ID NO:66pGEM-TIBV QX S L270C plasmid
[0569] SEQ ID NO:67pUC57-sCR88 rIBV donor plasmid
[0570] SEQ ID NO:68pUC57-s CR88 rIBV QX S L270C donor plasmid
[0571] SEQ ID NO:69pUC57-s H52 rIBV QX S L270C donor plasmid
[0572] SEQ ID NO:70 to 75 primers
[0573] SEQ ID NO:76IBV ArkDPI spike protein
[0574] SEQ ID NO: 77 IBV ArkDPI spike protein with L274C mutation
[0575] SEQ ID NO:78pUC57-s IBV ArkDPI S L274C
[0576] SEQ ID NO:79 pUC57-s H52 rIBV ArkDPI S Ecto L274C donor plasmid
[0577] SEQ ID NO:80 to 84 primers
[0578] Example
[0579] The following examples are set forth below to illustrate specific embodiments of the present invention. These examples are illustrative only and should not be construed as limiting the scope or underlying principles of the present invention.
[0580] Example 1: Generation of recombinant IBV H52 in which amino acid 267 of the spike protein is mutated to cysteine
[0581] For the generation of recombinant IBV, the method of targeted RNA recombination as described by van Beurden et al. (Virol J. 2017; 14(1): 109) was applied.
[0582] Donor plasmid construction
[0583] The pUC57-s IBV-5-1b-S-SIR-3T donor plasmid, hereinafter referred to as the pUC57-s H52 rIBV donor plasmid (SEQ ID NO: 9), was used as a template for the construction of an H52 rIBV donor plasmid with an H52 spike in which amino acid 267 of the S1 subunit of the H52 spike (SEQ ID NO: 1) was mutated from phenylalanine to cysteine (SEQ ID NO: 2), which was designated as pUC57-s H52 rIBV S F267C (SEQ ID NO: 10). Mutagenesis of the wild-type sequence was achieved using the Site-Directed Mutagenesis Kit (NEB) with primers PO1942 and PO1943 (Table 1), using an annealing temperature of 58°C and an extension time of 5 minutes and 30 seconds according to the kit protocol. Positive clones were identified by restriction digestion with EcoRV and XhoI, followed by Sanger sequencing with primers PO618 and PO633 (Table 1). The integrity of the spike and donor region sequences was then confirmed by sequencing with primers SEQ ID NO: 19 to SEQ ID NO: 40 in Table 1.
[0584] Table 1: Primers used for SDM and sequencing
[0585] SEQ ID NO: name sequence 64 M13-24F ccagggttttcccagtcacg 16 M13-24R cggataacaatttcacacagg 17 PO1942 aacactattttcacgatagac 18 PO1943 aatactacttgtacgttacacaatttc 19 PO618 taaatggtgatcttgttt 20 PO632 gcattcactgctgtacaa 21 PO633 cgctcttagtaacataaac 22 PO636 ctgaggtcaatgctttatc 23 PO706 gacagagcacaagtttgatc 24 PO709 acttcaagcatttgtacagg 25 PO710 ggtcaacaatgtaattttgct 26 PO713 gcagatgctaaaacagaaag 27 PO714 tcacctgaacaatcttcagc 28 PO715 ggtcaccagtatatttctgc 29 PO718 aaagaagcaggatgatgaag 30 PO726 aagagatgttggtaacacct 31 PO728 ctaaaccggctggttttaat 32 PO729 ccatagcttttgccactatt 33 PO731 cgcttgtaaatagaaggtct 34 PO732 acataccaaggccacttaat 35 PO733 ggtcctgttccagtatagta 36 PO734 cttgtcctgctttgttaaga 37 PO756 gtggatcgtcttataactgg 38 PO759 ctcgcattacaaaggctaag 39 PO766 ccagttataggacacccatc 40 PO767 gttggttcttctggaaatgt
[0586] Targeted RNA recombination and rescue of recombinant IBV
[0587] H52 murinized (m)IBV helper virus and recombinant IBV were generated as described by van Beurden et al. (Virol J. 2017; 14(1): 109). Briefly, for the generation of H52 rIBV S F267C, LR7 cells were infected with H52 mIBV and electroporated with in vitro transcripts generated from pUC57-s H52 S F267C donor plasmid (SEQ ID NO: 10) and subsequently injected into 8-day-old SPF embryonated chicken eggs (VALO BioMedia). After incubation for up to 8 days, the cells were incubated with MagMAX TM Core Nucleic Acid Purification Kit (ThermoFisher) and KingFisher TM DuoPrime Purification System (ThermoFisher), and by using a Platinum TM SuperScript for Taq DNAPolymerase TMFor the rescue of recombinant IBV after RNA isolation, allantoic fluid from all eggs was analyzed separately using the III One-Step RT-PCR System (ThermoFisher). Primers PO1323 and PO1324 (Table 2) that bind to the H52 IBV 1ab and H52 IBV S spike were used to distinguish recombinant IBV from mIBV. TM SuperScript for Taq DNAPolymerase TM Positive samples were further analyzed using the QIAquick One-Step RT-PCR System together with primers PO618 and PO633 (Table 2), followed by QIAquick PCR purification and Sanger sequencing with the same primers to confirm the presence of the expected spike F267C mutation. Positive allantoic fluid from eggs inoculated with the highest dilution of LR7 cells was used for endpoint dilution in 8-day-old SPF eggs. Nucleic acid isolation and sample analysis were performed as described above. The same procedure was applied to the second endpoint dilution. Thereafter, one allantoic fluid that tested positive was used for breeding in 10-day-old SPF embryonated chicken eggs. The allantoic fluid was diluted 1:1000 in 1xPBS and 100 μl / egg was injected, which was then incubated at 37.5°C and 60% humidity. The allantoic fluid was harvested 48 hours after inoculation, combined, cleared of debris and stored at -80°C.
[0588] Table 2. PCR and sequencing primers used to identify rescued H52 rIBV and confirm the targeted SF267C mutation.
[0589] SEQ ID NO: name sequence 41 PO1323 tcagcatggacgtgtggtta 42 PO1324 ccccatgtaaatgccaacca 19 PO618 taaatggtgatcttgttt 21 PO633 cgctcttagtaacataaac
[0590] In vitro and in ovo characterization of recombinant IBV
[0591] Determination of embryo infectious dose 50% (EID50)
[0592] Aliquots of the virus stock were thawed and diluted 10-fold in 1x PBS to determine the 50% embryonic infectious dose (EID) by inoculating 100 μl into the allantoic cavity of five 8-day-old embryonated chicken eggs per dilution. 50 ). Eggs were incubated at 36.5°C and 60% humidity until 7 days after inoculation. Eggs with dead embryos after 24 hours were excluded from the experiment. All other eggs with dead embryos 7 days after inoculation were considered positive. 7 days after inoculation, all eggs with live embryos were candeled from the bottom to identify dwarfs, which were considered positive. EID 50 / ml was calculated using the formula of Reed and Muench (Am J Epidemiol, 1938; 27(3): 493–497).
[0593] Tissue culture infectious dose 50% (TCID 50 )
[0594] Cell viability was analyzed using BioRad TC20 and trypan blue, with a gate set at 6-13 μm. EBx TM 2 x 10 cells were seeded per 96-well plate in GRO-I Serum-Free Media + 2.5 mM L-glutamine. 6 Personal life cells / ml and incubated at 37°C and 7.5% CO2. Serial 10-fold dilutions of the virus were made in cell culture medium, and after removing the medium, 100 μl / dilution (at least 4 replicates per dilution) was added to Cells. If allantoic fluid is used for infection, it is passed through a filter with a pore size of 0.45 μm before dilution. Infected cells are incubated for 72 hours, followed by immunofluorescence staining to identify positive wells. Culture medium is aspirated from all wells, the wells are subsequently washed with 1xPBS, and 100 μl of ethanol / well is then added for 10-minute cell fixation and subsequent air drying of the cells at RT. The cells are incubated at room temperature for 45 minutes with 100 μl chicken anti-IBV Mass primary serum (Boehringer Ingelheim) diluted 1:250 in 1xPBS. After removing the primary antibody, each well is washed 3 times with 1xPBS. 100 μl of Alexa Fluor 488 goat anti-chicken IgG secondary antibody (ThermoFisher Scientific, 1:500 dilution in 1xPBS) is added and incubated 45 minutes in the dark at room temperature. After removing the secondary antibody, each well is washed 3 times with 1xPBS, and the last wash is left on the cells. Positive wells were identified by fluorescence microscopy and recorded to calculate TCID using the formula of Reed and Muench (Am J Epidemiol, 1938; 27(3):493–497). 50 / ml.
[0595] In ovo replication dynamics
[0596] Use 10 2 EID 508-day-old embryonated chicken eggs were inoculated with rIBV and respective controls. Eggs were candled daily after 0, 8, 24, 34, 48, and 72 hours of incubation, and embryonic mortality was recorded. Five pre-selected eggs for each sample and time point were removed and transferred to 4°C for at least 2 hours. Subsequently, the allantoic fluid was harvested and stored at -80°C. For analysis, samples were thawed and diluted 1:10 in 1xPBS without Ca and Mg, and nucleic acids were extracted using a Hamilton Starlet pipette robot with the addition of carrier RNA using the QIAamp DNA Blood Mini kit (Qiagen). The extracted nucleic acids were analyzed for relative amounts of IBV RNA by RT-qPCR using a protocol adapted from Callison et al. (J Virol Methods. 2006; 138(1-2): 60-5). Briefly, the same primers and probes were used, and the temperature profile was adapted to FastVirus 1-Step Master Mix (ThermoFisher) and ABI TM 7900HT Fast Real-Time PCR System (Thermo Fisher Scientific) was used. All nucleic acid samples were analyzed in triplicate using a 10-fold dilution series of IBV H52 as a reference.
[0597] Similar in ovo replication kinetics were observed for H52 rIBV wild type and H52 rIBV S F267C ( Figure 1 This suggests that there is no disadvantage for the in ovo replication efficiency of the mutant rIBV compared to wild-type rIBV by mutation of phenylalanine to cysteine at position 267 of the spike.
[0598] rIBV Passaging in cells
[0599] Cells in EBx TM GRO-I Serum-Free Media + 2.5mM L-glutamine, 4x10 5The cells were inoculated into a T25 flask with a total volume of 5 ml at a density of 10 cells / ml and infected with rIBV and controls. The cultures were incubated at 37°C and 7.5% CO2 and shaken at 100 rpm for 72 hours. The cultures were harvested and stored at -80°C. For passages 1, 2, 5, 6 and 7, viral replication was evaluated via RT-qPCR. For this purpose, 250 μl of the suspension was taken out directly after inoculation (time point 0 hours) and after harvest (time point 72 hours) for nucleic acid isolation. MagMAX was used. TM CoreNucleic Acid Purification Kit (ThermoFisher) and KingFisher TM Nucleic acids were isolated using the Duo Prime Purification System (ThermoFisher). RT-qPCR was performed as described above.
[0600] To analyze whether H52 rIBV S F267C can replicate in cells, a 1 / 10 dilution of the allantoic fluid stock was used to inoculate cells. In the first and subsequent passages, viral propagation was detected after 72 hours by a decrease in the ct value. Due to the dilution of the virus used for the next passage, the ct value increased compared to the ct value measured at the time of inoculum harvest and then decreased again during the 72-hour culture period due to viral replication. Replication became even more pronounced in the higher passages 6 and 7, for which the inoculation was performed with a 1 / 1000 dilution of the previous passage ( Figure 2 The results clearly showed that H52rIBV F267C Thus, it is clear that the modification of position 267 to cysteine is genetically stable, as IBV still has extended cell culture / tissue tropism after 7 passages.
[0601] In addition, the allantoic fluid (10 6.33 TCID 50 / ml, 10 7.22 EID 50 / ml), and Passage P1(10 4.67 TCID 50 / ml)、P5(10 5.33 TCID 50 / ml) and P7(10 6 TCID 50 / ml, 10 5.84 EID 50 They confirmed that H52 rIBV S F267C Efficient replication during passage and persistent infectivity in SPF eggs. Thus, the F267C mutation enables replication in cell lines without disrupting the ability to replicate in eggs.
[0602] Cell replication dynamics
[0603] from Cells were harvested at passage 3 for use in Replication dynamics in cells. Cells were seeded and incubated as described for passaging and expressed based on TCID 50 Titer infection was performed at an MOI of 0.001. Samples were obtained directly after inoculation and at 8, 24, 48, and 72 hpi (hours post infection). The samples were analyzed for viral RNA content ( Figure 3 ). In addition, TCID 50 Determination of infectivity of the analyzed samples ( Figure 4 ). Efficient replication was detected using both methods, and a plateau of replication was reached as early as 48 hours after infection. The replication cycle in the cells is as efficient as in embryonated chicken eggs.
[0604] Determination of vaccine efficacy
[0605] Fertilized SPF eggs were incubated in an egg setter at 99.7°F and 50% humidity for 18 days with 1 rotation per hour. On the 18th day of incubation, the eggs were candled and the fertilized eggs were transferred to an incubator and incubated at 99°F and 70% humidity until hatched. Chicks without clinical signs or deformation were randomly assigned to the respective treatment groups and transferred to separate isolators. Three chicks served as a strict negative control (SNC) group, five chicks were selected for the challenge control (CC) group, and at least 10 chicks were selected for the adaptation group. The animals were kept under conditions that complied with local and national animal welfare recommendations. The lighting regimen was adjusted to 16 hours of light per day. Feed and water were provided ad libitum. After transfer to the isolator, the chicks (1 day old) were treated with 10 3 EID 50 21 days after vaccination, chickens in CC and vaccinated groups were treated with 10 3 to 10 4 EID 50 / chicken were challenged with a homologous challenge strain of IBV. Seven days after challenge, all chickens were euthanized, the kidneys removed and stored in RNAlater Stabilization Solution (ThermoFisher) at 4°C for IBV-specific RT-qPCR analysis. In addition, the trachea was removed and transferred to a 50 ml tube with warm cell culture medium. Thereafter, the trachea was cleared of connective tissue and rinsed with cell culture medium. The trachea was cut into tracheal rings using a McIlwain tissue slicer set to 0.6-0.8 mm slice thickness. The upper three rings, middle four rings and lower three rings of each trachea were analyzed for ciliary beating by light microscopy and scored for ciliary arrest (see Table 3). If more than 50% of the inner rings showed vigorous ciliary movement (score 2 and lower), the ring was recorded as normal. If less than 50% of the cilia were beating (scores 3 and 4), the ring was recorded as positive for ciliary arrest. Animals were considered protected if no fewer than 9 of the 10 rings showed normal ciliary activity.
[0606] For IBV-specific RT-qPCR analysis, kidney tissue pieces were warmed to room temperature and transferred to separate 2 ml Precellys tubes filled with culture medium and PBS, respectively. Homogenize 1 x 20 seconds at 6800 rpm using a tissue homogenizer (Bertin Instruments). Choanal wabs were eluted in 2 ml of 1 x PBS. TM Core Nucleic Acid Purification Kit (ThermoFisher) and KingFisher TM Duo Prime Purification System (ThermoFisher), nucleic acids were isolated from 200 μl of eluate and tissue homogenate, respectively. RT-qPCR was performed as described above for in ovo kinetics, except that a StepOnePlus TM Real-Time PCR System (ThermoFisher).
[0607] Table 3: Ciliary arrest scores in tracheal rings
[0608] Cilia activity [%] Ciliary arrest score 100 0 75-99 1 50-74 2 25-49 3 0-25 4
[0609] The purpose of this study is to confirm that The cell culture-adapted H52 rIBV S F267C, which had been passaged 8 times in cells, was able to confer protection against challenge with the virulent M41 strain. All chickens were observed daily for clinical signs, and no clinical signs were recorded after vaccination or challenge. Back titration of vaccination with H52 rIBV and H52 rIBV S F267C at 1 day of age determined 10 3.2 EID 50 / animals and 10 2.87 EID 50 / Animal(Target 10 3 EID 50 / animal), and for challenge with IBV M41 21 days after vaccination, 10 3 EID 50 / Animal(Target 10 3 EID 50 Ciliary arrest was scored as described in Table 3 and the results are presented in Table 3. Figure 5 Describe in.
[0610] The mean ciliary arrest values and protection rates for the sum of the 10 individual scores for each animal are summarized in Table 4. All animals in the strict negative control showed normal ciliary motility (100% protection), while all animals in the challenge control group were positive for ciliary arrest (0% protection). In contrast, 93% of animals vaccinated with H52 rIBV were protected, and 10% of animals vaccinated with H52 rIBV were protected. Animals vaccinated with passaged H52rIBV S F267C were also well protected.
[0611] Table 4: Summary of ciliary arrest scores for protection 28 days after vaccination and 7 days after challenge. The mean ciliary arrest score per group was calculated by adding the total scores of the individual birds in each group and dividing the group total by the number of animals (highest possible score 40, lowest possible score 0). For unaffected animals, at least 9 out of 10 tracheal explants showed normal ciliary activity.
[0612]
[0613]
[0614] In addition, viral loads in the kidneys of animals vaccinated with H52 rIBV S F267C were reduced as effectively as H52 rIBV compared to M41 challenged controls ( Figure 6 ). In short, H52 rIBV S F267C propagated in cells protected against challenge with the virulent M41 virus as effectively as wild-type H52 rIBV. Furthermore, modification of the cysteine at position 267 is genetically stable.
[0615] Infection of PBS-12SF cells with rIBV
[0616] The ability of H52 rIBV S F267C and H52 rIBV as negative controls to infect PBS-12SF cells was analyzed. PBS-12SF cells were seeded into 12-well plates in OptiPRO SFM (ThermoFisher Scientific) + 10% GlutaMAX (ThermoFisher Scientific) medium to reach 80% to 90% confluency on the second day. The cells were incubated at 37°C and 5% CO2. Prior to infection, the allantoic fluid virus stock was passed through a 0.45 μm pore size filter. PBS-12SF cells were treated with 10 5.74 EID 50 Each virus / well was infected at 37°C and 5% CO2 for 4 hours, then the supernatant was removed and fresh culture medium was added for further incubation. After 72 hours, the supernatant was removed, and the cells were washed with 1xPBS, and 50 μl TrypLE Select (ThermoFisher Scientific) was added to dissociate the cells. The cells were resuspended in the supernatant and transferred to a T25 flask with 80-90% confluent PBS-12SF cells (P2) and incubated for 72 hours. Again, supernatant and cells were collected and transferred to a T75 flask with 80-90% confluent PBS-12SF cells and incubated for 72 hours (P3). Supernatant was harvested. The cells were dissociated by trypsin treatment and seeded into fresh culture medium in a 12-well plate at a ratio of 1 / 3, and incubated until the next day. The culture medium was aspirated, the cells were washed with 1xPBS, fixed with ice-cold 100% ethanol and air-dried. Subsequently, the cells were rehydrated with 1xPBS, and chicken anti-IBV Mass primary serum (Boehringer Ingelheim) was added at a dilution of 1:200, and incubated at room temperature for 45 minutes. After removing the antibody, the cells were washed, and Alexa Fluor 488 goat anti-chicken IgG secondary antibody (ThermoFisher Scientific, 1:500 dilution in 1xPBS) was added for a total of 45 minutes in the dark at room temperature. Finally, the cells were washed 3 times with 1xPBS and analyzed by fluorescence microscopy ( Figure 7). Infected cells were detected for H52 rIBV S F267C, while cells infected with H52 rIBV wild type and uninfected negative controls remained negative as expected. In addition, after each of passages 1, 2, and 3, 250 μl of supernatant was stored for nucleic acid extraction and RT-qPCR as described above. During the passage process, a continuous decrease in the ct value was observed for H52 rIBV S F267C (corresponding to viral replication and propagation), while the ct value for H52 rIBV wild type increased as expected ( Figure 8 ).
[0617] Together, these data confirm that a single mutation from phenylalanine to cysteine at position 267 of the H52 spike renders the virus capable of replicating in PBS12-SF cells, whereas the H52 wild-type virus lacks this ability.
[0618] Infection of HEK-293T cells with rIBV
[0619] The ability of H52 rIBV S F267C and H52 rIBV as negative controls to infect HEK 293T cells was analyzed. 293T cells were seeded into 12-well plates in DMEM (Lonza) + 10% FCS (SAFC) + L-glutamine (Lonza) + 1% P / S (Gibco) medium to reach 80% to 90% confluency on the second day. The cells were incubated at 37°C and 5% CO2. Prior to infection, the allantoic fluid virus stock was passed through a 0.45 μm pore size filter. HEK293T cells were inoculated with approximately 10 6 EID 50Each virus / well is infected. After 72 hours, the supernatant is taken out, and the cells are washed with 1xPBS, and 50 μl TrypLE Select (ThermoFisher Scientific) is added to dissociate the cells. The cells are resuspended in the supernatant and transferred to a T25 flask with HEK 293T cells and 5ml fresh culture medium (P2) confluent at 80-90%, and the PBS-12SF cells are incubated for 72 hours. Again, supernatant and cells are collected, and transferred to a T75 flask with HEK 293T cells and 10ml fresh culture medium confluent at 80-90%, and the PBS-12SF cells are incubated for 72 hours (P3). The supernatant is harvested. The cells are dissociated by trypsin treatment and are seeded into the fresh culture medium in a 12-well plate at a ratio of 1 / 3, and incubated until the next day. The culture medium is aspirated, the cells are washed with 1xPBS, fixed with ice-cold 100% ethanol and air-dried. Subsequently, the cells were rehydrated with 1xPBS, followed by addition of chicken anti-IBV Mass primary serum (Boehringer Ingelheim) at a dilution of 1:200, and incubated at room temperature for 45 minutes. After removal of the antibody, the cells were washed and incubated with Alexa Fluor 488 goat anti-chicken IgG secondary antibody (ThermoFisher Scientific, 1:500 dilution in 1xPBS) for 45 minutes in the dark at room temperature. Finally, the cells were washed 3 times with 1xPBS and analyzed by fluorescence microscopy ( Figure 9 Infected cells were detected for the positive control as well as H52rIBV S F267C, whereas cells infected with H52rIBV wild type and the uninfected negative control remained negative as expected.
[0620] Together, these data confirm that a single mutation from phenylalanine to cysteine at position 267 of the H52 spike renders the virus capable of replicating in HEK 293T cells, whereas the H52 wild-type virus lacks this ability.
[0621] Conclusions of Example 1: The data show that a mutation to cysteine at position 267 of the spike sequence in IBV (reference sequence for numbering is SEQ ID NO: 1) results in extended cell culture and tissue tropism. H52 recombinant IBV with the F267C mutation in the spike protein can be effectively cultured in different cell lines, such as EB66, PBS-12SF, and HEK 293T cells. It is believed that the IBV can also be cultured in other cell lines. Furthermore, the mutation has no effect on the in ovo replication of the virus, and the replication kinetics in ovo and in vitro are similar. Finally, the vaccine efficacy is sustained even after passage in cell lines, laying the foundation for the development of successful IBV vaccines that do not require in ovo culture but instead use cell lines.
[0622] Example 2: Generation of recombinant IBV CR88 in which amino acid 269 of the spike protein is mutated to cysteine
[0623] To determine whether the change to cysteine at position 267 in the IBV spike could also be applied to other genotypes or serotypes, the spike amino acid sequence of the CR88 IBV strain (SEQ ID NO: 11) was compared with the H52 spike amino acid sequence (SEQ ID NO: 1) to determine the position for the IBV CR88 spike that is equivalent to amino acid position 267 of the H52 spike, which was determined to be leucine at position 269 of the CR88 spike.
[0624] Construction of murinized donor plasmid for IBV CR88
[0625] To generate the CR88 murinized (m)IBV donor plasmid, the donor sequence was synthesized by a commercial supplier: 497 bases of the 5'UTR of the CR88 genome were fused to the 3' portion of the 1ab region (752 bases) and the first 72 bases encoding the CR88 IBV spike, followed by 3753 bases of the MHV spike ectodomain, followed by the terminal 210 bases of the CR88 IBV spike and subsequent sequences to the 3' end of the genome. In addition, a SacI restriction site and a T7 promoter sequence were added to the 5' end of the donor region, as well as a 100x poly A sequence, followed by a NotI restriction site for linearization at the 3' end. A silent A to C mutation was introduced at position 5634 of the assembled sequence to generate an XhoI restriction site. The synthesized sequence was inserted into pUC57-simple to generate the pUC57-sCR88 mIBV donor plasmid (SEQ ID NO: 12).
[0626] Rescue of CR88 mIBV
[0627] CR88 mIBV was rescued similarly to H52 mIBV (van Beurden et al. Virol J. 2017; 14(1): 109) with some changes: the viral allantoic fluid stock was concentrated via ultracentrifugation and viral RNA was isolated for electroporation. 18 ml of viral allantoic fluid was centrifuged at 50,000 x g for 2 hours through a 2 ml 20% sucrose cushion in TNE (Tris, NaCl, EDTA) buffer. The supernatant was discarded and the pellet was resuspended in 150 μl TNE buffer, followed by RNA isolation using the QIAamp viral RNA mini kit (Qiagen). Furthermore, chicken embryo fibroblasts (CEFs) were used instead of BHK cells for electroporation (2 pulses 250 V / 300 μF with a 10 second break), and 1.25% DMSO was added to the electroporation mixture.
[0628] Donor plasmid construction
[0629] The CR88 spike nucleic acid sequence with flanking sequences was synthesized by a commercial supplier and cloned into pGEM-T (SEQ ID NO: 13). It was used as a template for site-directed mutagenesis to change the leucine at amino acid position 269 of the IBV CR88 spike (SEQ ID NO: 11) to cysteine (SEQ ID NO: 3). To this end, the QuikChange Multi Site-Directed Mutagenesis Kit (Agilent Technologies) according to the manufacturer's protocol and primers PO1886 (Table 5) designed using the corresponding online tool were used. Positive clones were identified by restriction digestion and analyzed for the presence of the desired mutation by Sanger sequencing using primers PO618 and PO1410 (Table 5). For the generation of the pUC57-s CR88 rIBV SL269C donor plasmid (SEQ ID NO: 14), the pGEM-T CR88 S L269C plasmid containing the mutated CR88 spike sequence (SEQ ID NO: 15) was digested with PacI, XhoI, and PvuI. The band corresponding to the spike was excised from the gel and purified using a QIAquick Gel Extraction Kit (Qiagen). Further, the CR88 mIBV donor plasmid (SEQ ID NO: 12) was digested with PacI, XhoI, and KpnI to obtain the donor plasmid backbone. The band with the highest molecular weight was excised from the gel and purified using a QIAquick Gel Extraction Kit (Qiagen). The purified spike insert and the CR88 donor plasmid backbone were ligated overnight at 16°C using T4 DNA ligase (ThermoFisher Scientific). The ligation mixture was transformed into NEB 5-alpha competent E. coli (NEB) by heat shock. Positive clones were identified by restriction digestion following the GeneJET Plasmid Miniprep Kit (ThermoFisher Scientific) and the targeted mutations were characterized by Sanger sequencing using primers PO618, PO1014 (Table 5).
[0630] Targeted RNA recombination and rescue of recombinant IBV
[0631] For rescue of CR88 rIBV S L269C, LR7 cells were infected with CR88 mIBV and electroporated with in vitro transcripts generated from NotI-linearized pUC57-s CR88 S L269C donor plasmid and subsequently injected into 8-day-old SPF embryonated chicken eggs (VALO BioMedia). After incubation for up to 8 days, the cells were cloned using MagMAX TMCore NucleicAcid Purification Kit (ThermoFisher) and KingFisher TM Duo Prime Purification System (ThermoFisher), and by using a Platinum TM SuperScript for Taq DNA Polymerase TM IIIOne-Step RT-PCR System (ThermoFisher), for the rescue of recombinant IBV after RNA isolation, the allantoic fluid of all eggs was analyzed separately. Primers PO1728 and PO1729 (Table 5) bound in CR88 IBV 1ab and CR88 IBV S spike were used to distinguish recombinant IBV from mIBV. The positive allantoic fluid of eggs inoculated with LR7 cells at the highest dilution was used for endpoint dilution in 8-day-old SPF embryonated eggs. Nucleic acid isolation was performed as described above. Samples were analyzed via RT-qPCR according to a protocol adapted from Callison et al. (J Virol Methods. 2006; 138(1-2): 60-5). In brief, the same primers and probes were used, and the temperature profile was adapted to Fast Virus 1-Step Master Mix (ThermoFisher) and StepOnePlus or ABI7900 HT Fast Real-Time PCR Systems (ThermoFisher Scientific) were used. Subsequently, a highly diluted allantoic fluid that tested positive was used for propagation in 8-day-old SPF embryonated chicken eggs. The allantoic fluid was diluted 1:100 in 1xPBS and 100 μl was injected per egg, which was then incubated at 37.5°C and 60% humidity. The allantoic fluid was harvested 48 hours after inoculation, cleared of debris, and stored at -80°C.
[0632] Table 5. SDM primers for obtaining the CR88 S L269C mutation, and sequencing primers used to confirm the targeted mutation and confirm CR88 rIBV rescue.
[0633] SEQ ID NO: name sequence 43 PO1886 gtatatcgagaaagtagcactaacactacttgtaagttaactaatttcagttttaactaatg 19 PO618 taaatggtgatcttgttt 44 PO1410 tttgtatacgagagccatca 45 PO1728 tcagcgtggacatgtggtta 46 PO1729 ccccatataggtgccaacct
[0634] In vitro and in ovo characterization of recombinant IBV
[0635] The embryo infectious dose 50% (EID) for CR88 rIBV S L269C was determined as described for H52 rIBV S F267C. 50 ) and tissue culture infectious dose 50% (TCID50 ). Further, in ovo and in vitro replication kinetics and passaging were performed as described for H52 rIBV S F267C.
[0636] Similar in ovo replication kinetics were observed for CR88 rIBV wild type and CR88 rIBV S L269C ( Figure 10 This suggests that the cysteine mutation in the spike of CR88 rIBV S L269C has no disadvantage for the efficiency of in ovo replication of the mutant rIBV compared to wild-type rIBV CR88, as shown for H52 rIBV S F267C and H52 rIBV wild-type.
[0637] To analyze whether CR88 rIBV S L269C could replicate in cells, a 1 / 100 dilution of the allantoic fluid stock was used to inoculate Cells. In the first passage and subsequent passages, viral propagation was detected after 72 hours by a reduced ct value. Due to the dilution of the virus used for the next passage, the ct value increased compared to the ct value measured when the inoculum was harvested, and then decreased again during the 72-hour culture period due to viral replication. By comparing the ct value of the 72-hour time point with the 0-hour time point directly after infection, the replication of CR88 rIBV S L269C was clearly visible during the passage process. In contrast, the ct value of the CR88 rIBV wild-type negative control confirmed that there was no replication of this virus in any of the passages analyzed during the passage process and in the dilution of the initial inoculum ( Figure 11 The results clearly showed that CR88 rIBVL269C The L269C mutation in the spike protein was found to be essential for extended cell or tissue tropism, as evidenced by the ability of the wild-type virus to replicate after seven passages in cells. In the replication kinetics experiment in cells, RT-qPCR ( Figure 12 ) and TCID 50 Sure( Figure 13 ) for testing.
[0638] In addition, the allantoic fluid (10 3 TCID 50 / ml, 10 8 EID 50 / ml), and Passage P1(10 3.5 TCID 50 / ml, 10 5,84 EID 50 / ml)、P5(10 5.3 TCID 50 / ml) and P8(10 6 TCID 50 / ml, 10 6 EID 50 They confirmed that CR88 rIBV S L269C Efficient replication during passage and persistent infectivity in SPF eggs. Thus, the L269C mutation enables replication in cell lines without disrupting the ability to replicate in eggs.
[0639] Determination of vaccine efficacy
[0640] Efficacy testing of CR88 rIBV S L269C against challenge with IBV793B was performed as described above for H52 rIBV S F269C. The cell culture-adapted CR88 rIBV S L269C, passaged once in cells, was able to confer protection against challenge with the virulent 793B strain. All birds were observed daily for clinical signs. No clinical signs were recorded after vaccination or challenge. Back titration of vaccination with CR88 rIBV S L269C at 1 day of age determined 10 3.6 EID 50 / Animal(Target 10 3 EID 50 / animal), and for challenge with IBV 793B 21 days after vaccination, 10 4.1 EID 50 / Animal(Target 10 4 EID 50 Ciliary arrest was scored as described in Table 3 and the results are presented in Table 3. Figure 14 The results are depicted in Table 6 and summarized in Table 6. All animals in the strict negative control group showed normal ciliary motility, while 4 of 5 animals in the challenge control group tested positive for ciliary arrest. In contrast, 80% of animals vaccinated with CR88 rIBV S L269C were protected.
[0641] Table 6 summarizes the ciliary arrest scores for protection 28 days after vaccination and 7 days after challenge. The mean ciliary arrest score per group was calculated by adding the total scores of the individual birds in each group and dividing the group total by the number of animals (highest possible score 40, lowest possible score 0). For unaffected animals, at least 9 of the 10 tracheal explants showed normal ciliary activity.
[0642]
[0643] In addition, viral RNA loads were significantly reduced in the kidneys of animals vaccinated with CR88 rIBV S L269C compared to challenge controls ( Figure 15 ). In short, CR88 rIBV S L269C, propagated in cells, effectively protected against challenge with the virulent 793B virus. The spike mutation L269C adapts the virus to propagate in cells, while maintaining its efficacy in vivo.
[0644] Conclusions of Example 2: The data demonstrate that a mutation to cysteine at spike position 267 (SEQ ID NO: 1), corresponding to position 269 in the CR88 spike, also results in expanded cell or tissue tropism in recombinant IBV CR88. Furthermore, the mutation has no effect on viral replication in ovo. Finally, vaccine efficacy persists even after propagation in cell lines, laying the foundation for successful IBV vaccine development using cell lines without the need for in ovo culture.
[0645] Example 3: Generation of chimeric recombinant IBV CR88 or H52, in which the CR88 or H52 spike gene is replaced with the QX spike gene, in which amino acid 270 of the spike protein is mutated to cysteine
[0646] To further elaborate on whether the change to cysteine at position 267 of the spike to achieve cell culture tropism is transferable to other IBV genotypes, the QX spike amino acid sequence (SEQ ID NO:65) was aligned with the H52 spike amino acid sequence (SEQ ID NO:1) to determine the position for the IBV QX spike that is equivalent to amino acid position 267 of the H52 spike, which was determined to be leucine at position 270 of the QX spike.
[0647] To analyze the potential of QX spikes with a mutation to cysteine at amino acid position 270 to infect cells, recombinant IBV CR88 and recombinant IBV H52 were generated, in which the sequence encoding the CR88 spike or H52 spike, respectively, was replaced with a sequence encoding the QX spike with cysteine at position 270 of the spike protein (SEQ ID NO: 4). To this end, the steps for constructing and rescuing H52 mIBV and CR88 mIBV were performed as described in Examples 1 and 2.
[0648] Cloning and mutation of the QX spike gene
[0649] The QX spike sequence was identified by one-step RT-PCR ( IIIOne-Step RT-PCR, The plasmid pGEM-T IBV QX S L270C (SEQ ID NO: 66) was generated by amplifying the IBV QX viral RNA using the pGEM-T vector system (Promega) using PCR amplification (EGFP-Taq). The plasmid was then amplified using primers PO2163 and PO2164 (Table 7) designed by NEBaseChanger. To identify clones harboring plasmids harboring the desired mutations, Sanger sequencing using primers PO1398 and PO633 (Table 7) located in the region flanking the mutation was performed after positive restriction digestion.
[0650] Table 7: Primers used for cloning and site-directed mutagenesis of the QX spike sequence
[0651] SEQ ID NO name sequence 47 PO1367 cgcggatccgccaccatgttggtgaagtcactg 48 PO1347 gcggcggccgcttaaacagactttttaggtctg 49 PO2163 taatactacttgtgcgttaactaattttacttttagtaatg 50 PO2164 acactactttcacgatag 51 PO1398 aatttaacagttagcgtatc 21 PO633 cgctcttagtaacataaac
[0652] Donor plasmid construction
[0653] use The pUC57-s H52 rIBV QX S L270C donor plasmid (SEQ ID NO: 69) was constructed using the HiFi DNA Assembly Cloning Kit (NEB) and online tools for primer design. To this end, the pUC57-s H52 rIBV donor plasmid (SEQ ID NO: 9) was digested with the restriction sites EcoRV, PmlI, and BlpI close to the H52 spike coding sequence to linearize the plasmid and remove the H52 spike and flanking sequences. The QIAquick Gel Extraction Kit (Qiagen) was used to purify the band corresponding to the pUC57-s IBV H52 backbone without the H52 spike coding sequence. The QX SL270C nucleic acid coding sequence and the flanking 5' and 3' IBV H52 sequences were cleaved using The amplification was performed in three separate PCR reactions using High-Fidelity DNA Polymerase (NEB; see Table 8 for primers). The PCR products were purified by QIAquick gel extraction (Qiagen) and used for the PCR reaction according to the kit protocol. Gibson assembly was performed using the HiFi DNA Assembly Cloning Kit (NEB) to generate the pUC57-s H52 rIBV QX S L270C (SEQ ID NO: 69) donor plasmid.
[0654] use HiFi DNA Assembly Cloning Kit (NEB) and online tools for primer design were used to construct the pUC57-s CR88 rIBV QX S L270C donor plasmid (SEQ ID NO: 68). Two PCR fragments were generated: one for the CR88 backbone using pUC57-s CR88 rIBV (SEQ ID NO: 67) as a template, and one for the mutated QX spike L270 using pGEM-TIBV CR88 S L270C (SEQ ID NO: 66) as a template for Q5 PCR, using the primers in Table 8. PCR products were gel purified using the QIAquick Gel Extraction Kit (Qiagen) and then used for Gibson assembly according to the kit protocol to generate the pUC57-s CR88 rIBV QX S L270C donor plasmid (SEQ ID NO: 68).
[0655] Table 8: Primers designed using the NEBuilder online tool for Gibson assembly of pUC57-s CR88 rIBV QX L270C donor plasmid (PCRs 1, 2) and pUC57-s H52 rIBV QX L270C (PCRs 3, 4, 5).
[0656]
[0657] The successful assemblies of pUC57-s CR88 rIBV QX S L270C and pUC57-s H52 rIBV QX S L270C were confirmed by restriction digestion of the plasmids with NheI and NotI or EcoRV, BlpI and PmlI, respectively, and characterized by sequencing with the primers in Table 9.
[0658] Table 9: Primers used for sequencing of UC57-s CR88 rIBV QX S L270C and pUC57-s H52 rIBV QX S L270C donor plasmids.
[0659] SEQ ID NO Primer name sequence 56 PO1565 caggattgtgcatggtggac 51 PO1398 aatttaacagttagcgtatc 57 PO2090 gaagtgaayacaagatcaccattt 58 PO1420 tgactgattctgctgctaaa 44 PO1410 tttgtatacgagagccatca 59 PO1421 tcttgaaacccccaagtag 60 PO1425 tatattcagcatcagttggc 61 PO1422 ggattttgtggtagtggaag 62 PO1575 ccactattgcagtaacattaaca 63 PO1567 ctagactgtaagttactattg
[0660] Targeted RNA recombination and rescue of recombinant IBV
[0661] For rescue of CR88 rIBV QX S L270C and H52 rIBV QX S L270C, LR7 cells were infected with CR88 mIBV or H52 mIBV, respectively, and electroporated with in vitro transcripts generated by pUC57-s CR88 rIBV QX SL270C or pUC57-s H52 rIBV QX S L270C donor plasmids linearized with NotI or MssI, respectively, and subsequently injected into 8-day-old SPF embryonated chicken eggs (VALO BioMedia). After incubation for up to 8 days, the cells were cloned using MagMAX TM CoreNucleic Acid Purification Kit (ThermoFisher) and KingFisher TM Duo Prime Purification System (ThermoFisher), and by using a Platinum TM SuperScript for Taq DNA Polymerase TM IIIOne-Step RT-PCR System (ThermoFisher), for the rescue of recombinant IBV after RNA isolation, the allantoic fluid of some eggs was analyzed separately. Primers PO1398 and PO633 (Table 7) combined in the QX spike sequence were used to identify the rescue of the recombinant virus. The positive (defined by embryonic death or positive RT-PCR results) allantoic fluid of eggs inoculated with LR7 cells at the highest dilution was used for endpoint dilution in 8-day-old SPF embryo-containing eggs. Nucleic acid isolation was performed as described above. The samples were analyzed by RT-qPCR according to a protocol adapted from Callison et al. (J Virol Methods. 2006; 138 (1-2): 60-5). In brief, the same primers and probes were used, and the temperature curve was adapted to Fast Virus 1-Step Master Mix (ThermoFisher) and StepOnePlus or ABI7900 HT Fast Real-Time PCR Systems (ThermoFisher Scientific) were used. Subsequently, a preferably highly diluted allantoic fluid that tested positive was used for propagation in 8-day-old SPF embryonated chicken eggs. The allantoic fluid was diluted 1:100 in 1xPBS and 100 μl was injected per egg, which was then incubated at 37.5°C and 60% humidity. The allantoic fluid was harvested 48 hours after inoculation, cleared of debris, and stored at -80°C.
[0662] In vitro and in ovo characterization of recombinant IBV
[0663] The embryo infectious dose 50% (EID) for CR88 rIBV QX S L270C and H52 rIBV QX S L270C was determined as described for H52 rIBV S F267C. 50 ) and tissue culture infectious dose 50% (TCID 50 ). Further, in ovo and in vitro replication kinetics and passaging were performed as described for H52 rIBV S F267C.
[0664] Similar peak ct values were observed after 48 h for CR88 rIBV QX S L270C and H52 rIBV QX S L270C, with slight differences in the kinetics of in ovo replication ( Figure 16 While replication of CR88 rIBV QC L270C was very similar to that of CR88 rIBV and IBV QX wild-type, replication of H52 rIBV QX S L270C was more similar to that of H52 rIBV. This suggests that the cysteine mutations in the spike of CR88 rIBV QXS L270C and H52 rIBV QX S L270C are not detrimental to the efficiency of in ovo replication of the mutant rIBVs compared to other rIBVs or wild-type IBV.
[0665] To analyze whether CR88 rIBV QX S L270C and H52 rIBV QX S L270C can replicate in cells, 1 / 100 dilution of the allantoic fluid stock solution was used to inoculate Cells. Viral propagation was analyzed by isolation of viral RNA and subsequent RT-qPCR analysis. The replication of CR88 rIBV QX S L270C and H52 rIBV QX S L270C during passage was clearly visible by the reduced mean ct values at the 72-hour time point compared to the 0-hour time point directly after infection ( Figure 17 and 18 The ct value increased compared to the ct value measured at the time of inoculum harvest due to the dilution of the virus used for the next passage, and then decreased again during the 72-hour culture period due to virus replication. In the replication kinetics experiment in cells, RT-qPCR ( Figure 19 Both viruses showed similar replication patterns, with peak CT values after 48 hours.
[0666] In addition, the allantoic fluid of CR88 rIBV QX S L270C (10 8 EID 50 / ml), and Passage P2(10 6 TCID 50 / ml, 10 8.17 EID 50 / ml)、P6(10 6 TCID 50 / ml, 10 7.83 EID 50 / ml) and P9(10 6 TCID 50 / ml, 10 8.5 EID 50 Furthermore, the infection titer of the allantoic fluid stock solution (10 8 EID 50 / ml), and Passage P3(10 4.5 TCID 50 / ml, 10 8.13 EID 50 / ml) and P6(10 5.5 TCID 50 / ml, 10 8.13 EID 50 They confirmed that CR88 rIBV QX S L270C Efficient replication during passage and persistent infectivity in SPF eggs. Thus, the L270C mutation enables replication in cell lines without disrupting the ability to replicate in eggs.
[0667] Determination of vaccine efficacy
[0668] Efficacy testing of CR88 rIBV QX S L270C and H52 rIBV QX S L270C against challenge with IBV D388 QX was performed as described above for H52 rIBV S F269C. The cell culture-adapted CR88 rIBV QX S L270C and H52 rIBV QX SL270C, which had been passaged six times in cells, were able to confer protection against challenge with the virulent D388 QX strain. All birds were observed daily for clinical signs. No clinical signs were recorded after vaccination or challenge. Back titration of vaccination with CR88 rIBV QX SL270C and H52 rIBV QX SL270C at one day of age determined 10 4.2 EID 50 / Animal(Target 10 3 EID 50 / animal) and 10 3.3 EID 50 / Animal(Target 10 3 EID 50 / animal), and for challenge with IBV D388 QX 21 days after vaccination, 10 3.5 EID 50 / Animal(Target 10 3 EID 50 Ciliary arrest was scored as described in Table 3 and the results are presented in Table 3. Figure 20 The results are depicted in Table 10 and summarized in Table 10. All animals in the strict negative control group showed normal ciliary motility, while all animals in the challenge control group tested positive for ciliary arrest. In contrast, 78% and 91% of animals vaccinated with CR88 rIBV QX S L270C or H52 rIBV QX SL270C were protected.
[0669] Table 10: Summary of ciliary arrest scores for protection 28 days after vaccination and 7 days after challenge. The mean ciliary arrest score per group was calculated by summing the total scores of the individual birds in each group and dividing the group sum by the number of animals (highest possible score 40, lowest possible score 0). For unaffected animals, at least 9 of 10 tracheal explants showed normal ciliary activity. *One animal in the strict negative control died; the death was not related to IBV clinical signs or lesions.
[0670]
[0671] In addition, viral RNA loads were significantly reduced in the kidneys of animals vaccinated with CR88 rIBV QX S L270C or H52 rIBV QX L270C compared to challenged control animals ( Figure 21 ). In short, Cell-propagated CR88 rIBV QX S L270C and H52 rIBV QX S L270C effectively protected against challenge with the virulent D388QX. The spike mutation L270C adapts the virus to propagate in cells, while maintaining its efficacy in vivo.
[0672] Conclusions of Example 3: The data show that mutation to cysteine at spike position 267 (SEQ ID NO: 1, reference sequence for numbering), corresponding to position 270 in the IBV QX spike, also results in extended cell or tissue tropism. Furthermore, the tissue culture tropism of the spike with the cysteine mutation is not limited to a homologous genetic background, as the QXL270C spike inserts into the CR88 and H52 genetic backbones, and both the CR88 rIBV QX S L270C and the H52 rIBV QX SL270C replicate efficiently in cells and effectively protect against challenge with the virulent IBV D388 QX.
[0673] Example 4: Generation of chimeric recombinant IBV H52, wherein the H52 spike ectodomain coding sequence is replaced by ARKDPI spike extracellular domain coding sequence, in which amino acid 274 of the spike protein is mutated to cysteine
[0674] To further elaborate on whether the change to cysteine at position 267 of the spike to achieve cell culture tropism is transferable to other IBV genotypes, the ArkDPI spike amino acid sequence (SEQ ID NO:76) was aligned with the H52 spike amino acid sequence (SEQ ID NO:1) to determine the position for the IBV ArkDPI spike that is equivalent to amino acid position 267 of the H52 spike, which was determined to be leucine at position 274 of the ArkDPI spike.
[0675] To analyze the potential of an ArkDPI spike with a mutation to cysteine at amino acid position 274 to infect cells, a recombinant IBV H52 was generated in which the sequence encoding the H52 spike was replaced with a sequence encoding an ArkDPI spike with cysteine at position 274 of the ArkDPI spike protein (SEQ ID NO: 77). To this end, the steps for constructing and rescuing the H52 mIBV were performed as described in Example 1.
[0676] Donor plasmid construction
[0677] pUC57-s ArkDPI spike L274C plasmid (SEQ ID NO: 78) was synthesized by a commercial supplier. The pUC57-s H52 rIBV ArkDPI S Ecto L274C donor plasmid (SEQ ID NO: 79) was constructed using the HiFi DNA Assembly Cloning Kit (NEB) and online tools for primer design. To this end, the pUC57-s H52 rIBV donor plasmid (SEQ ID NO: 9) was digested with restriction sites EcoRV, PmlI, and BlpI close to the H52 spike coding sequence to linearize the plasmid and remove the H52 spike and flanking sequences. The QIAquick Gel Extraction Kit (Qiagen) was used to purify the band corresponding to the pUC57-s IBV H52 backbone without the H52 spike coding sequence. The ArkDPI S EctoL274C nucleic acid coding sequence and the flanking 5' and 3' IBV H52 sequences were cleaved using The amplification was performed in three separate PCR reactions using High-Fidelity DNA Polymerase (NEB; see Table 11 for primers). The PCR products were purified by QIAquick gel extraction (Qiagen) and used for the PCR reaction according to the kit protocol. Gibson assembly was performed using the HiFi DNA Assembly Cloning Kit (NEB) to generate the pUC57-s H52 rIBV ArkDPI S EctoL274C (SEQ ID NO: 79) donor plasmid.
[0678] Table 11: Primers designed using the NEBuilder online tool for Gibson assembly of pUC57-s H52 rIBV ArkDPI SEcto L274C.
[0679]
[0680] The successful assembly of pUC57-sH52 rIBV ArkDPISEctoL274C was confirmed by restriction digestion of the plasmid with BlpI and XhoI.
[0681] Targeted RNA recombination and rescue of recombinant IBV
[0682] For the rescue of H52 rIBV ArkDPI S Ecto L274C, LR7 cells were infected with H52 mIBV and electroporated with in vitro transcripts generated from MssI-linearized pUC57-s H52 rIBV ArkDPI S Ecto L274C donor plasmid and subsequently injected into 8-day-old SPF embryonated chicken eggs (VALO BioMedia). After incubation for up to 8 days, the cells were cloned using MagMAX TM Core Nucleic Acid Purification Kit (ThermoFisher) and KingFisher TM Duo Prime Purification System (ThermoFisher), and by using a Platinum TM SuperScript for Taq DNA Polymerase TM IIIOne-Step RT-PCR System (ThermoFisher), for the rescue of recombinant IBV after RNA isolation, the allantoic fluid of some eggs was analyzed separately. Primers PO1317 and PO633 (Table 12) bound in the ArkDPI spike sequence were used to identify the rescue of the recombinant virus. The positive (defined by embryonic death or positive RT-PCR results) allantoic fluid of eggs inoculated with LR7 cells at the highest dilution was used for endpoint dilution in 8-day-old SPF embryo-containing eggs. Nucleic acid isolation was performed as described above. The samples were analyzed by RT-qPCR according to a protocol adapted from Callison et al. (J VirolMethods.2006; 138(1-2): 60-5). In brief, the same primers and probes were used, and the temperature curve was adapted to Fast Virus 1-Step Master Mix (ThermoFisher) and StepOnePlus or ABI7900 HT Fast Real-Time PCR Systems (ThermoFisher Scientific) were used. Subsequently, a preferably highly diluted allantoic fluid that tested positive was used for propagation in 8-day-old SPF embryonated chicken eggs. The allantoic fluid was diluted 1:100 in 1xPBS and 100 μl was injected per egg, which was then incubated at 37.5°C and 60% humidity. The allantoic fluid was harvested 48 hours after inoculation, cleared of debris, and stored at -80°C.
[0683] Table 12: Primers used to detect H52 rIBV ArkDPI S Ecto L274C.
[0684] SEQ ID NO Primer name sequence 84 PO1317 taatactggyaatttttcaga 21 PO633 cgctcttagtaacataaac
[0685] In vitro characterization of recombinant IBV
[0686] The embryo infectious dose 50% (EID) for H52 rIBV ArkDPI S Ecto L274C was determined as described for H52 rIBV S F267C. 50 ) and tissue culture infectious dose 50% (TCID 50 ). Further, in vitro replication kinetics and passaging were performed as described for H52rIBV SF267C.
[0687] To analyze whether H52 rIBV ArkDPI S Ecto L274C was able to replicate in cells, a 1 / 10 dilution of the allantoic fluid stock was used for the first passage, and a 1 / 10 or 1 / 100 dilution was used for subsequent passages. The cells were isolated and analyzed for viral RNA propagation by RT-qPCR. The replication of H52rIBV ArkDPI S EctoL274C was clearly visible after three passages by the reduced mean ct value at the 72-hour time point (11.59) compared to the 0-hour time point (21.09) immediately after infection.
[0688] Conclusions of Example 4: The data show that mutation to cysteine at spike position 267 (SEQ ID NO: 1, reference sequence for numbering), corresponding to position 274 in the IBV ArkDPI spike, also results in extended cell or tissue tropism. In addition, the tissue culture tropism of the spike with the cysteine mutation is not limited to the homologous genetic background, as the ArkDPI L274C spike extracellular domain was inserted into the H52 genetic backbone and the H52 rIBV ArkDPI S Ecto L274C replicated efficiently in cells.
Claims
1. An infectious bronchitis virus spike protein having a cysteine at amino acid position 270, wherein at least a portion of the S1 subunit of the spike protein is from an infectious bronchitis virus with limited cell tropism or tissue tropism, wherein the amino acid sequence of SEQ ID NO:65 is used to determine the position numbering in the spike protein, wherein the spike protein is not from the infectious bronchitis virus Beaudette strain, and wherein the spike protein is from infectious bronchitis virus QX, wherein the cysteine at amino acid position 270, or the mutation to cysteine at amino acid position 270, results in expanded cell tropism or tissue tropism of the infectious bronchitis virus.
2. An infectious bronchitis virus spike protein consisting of the amino acid sequence shown in SEQ ID NO:
4.
3. An infectious bronchitis virus spike protein, wherein at least a portion of the S1 subunit of the spike protein is from an infectious bronchitis virus with limited cell tropism or tissue tropism, and wherein at amino acid position 267 is a cysteine, wherein the amino acid sequence of SEQ ID NO: 1 is used to determine the position number in the spike protein, wherein the spike protein is not from the IBV Beaudette strain, and wherein the spike protein is from an infectious bronchitis virus selected from the following genotypes or serotypes or strains: Massachusetts, Arkansas, Brazil, California, Connecticut, Delaware, Dutch, Florida, Georgia, Gray, Holte, Iowa, Italy-02, JMK, LDT3, Maine, H52, H120, M41, Pennsylvania, PL84084, Qu, QX, Q1, SE 17. Variants 2 and 4 / 91, wherein the cysteine at amino acid position 267 or the mutation to cysteine at amino acid position 267 results in extended cell tropism or tissue tropism of the infectious bronchitis virus.
4. The infectious bronchitis virus spike protein of claim 3, wherein the spike protein is from an infectious bronchitis virus having a genotype or serotype or strain selected from the following list: Massachusetts, 4 / 91, QX, Q1, Italy02, Arkansas, Conneticut, Georgia, LDT3, PL84084, variant 2 and Brazil.
5. The infectious bronchitis virus spike protein of any one of claims 3 to 4, wherein the infectious bronchitis virus spike protein consists of or comprises the amino acid sequence as shown in SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 77, or a sequence having at least 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.95%, 99.98% or 99.99% sequence identity thereto.
6. The infectious bronchitis virus spike protein of any one of claims 1 to 5, wherein the infectious bronchitis virus infects and / or replicates in at least one cell line selected from the following list: PBS-12SF, BHK21, and HEK 293T.
7. The infectious bronchitis virus spike protein of any one of claims 1 to 5, wherein the infectious bronchitis virus with limited cell tropism or tissue tropism is limited to infection and / or replication in embryonated chicken eggs and / or primary chicken kidney cells.
8. A nucleotide sequence encoding the spike protein of any one of claims 1 to 7.
9. A plasmid comprising the nucleotide sequence of claim 8.
10. A cell comprising the plasmid of claim 9.
11. A viral particle comprising the spike protein of any one of claims 1 to 5.
12. An infectious bronchitis virus comprising the spike protein of any one of claims 1 to 5.
13. The infectious bronchitis virus of claim 12, wherein the infectious bronchitis virus is attenuated.
14. A cell comprising: The virus particle of claim 11, or The infectious bronchitis virus of claim 12 or 13.
15. An immunogenic composition comprising: The spike protein of any one of claims 1 to 5, or The virus particle of claim 11, or The infectious bronchitis virus of claim 12 or 13.
16. A method for producing or manufacturing an infectious bronchitis virus with extended cell tropism or tissue tropism, comprising using the spike protein of any one of claims 1 to 5.
17. A method for culturing infectious bronchitis virus in cell culture or tissue culture, comprising using the spike protein of any one of claims 1 to 5.
18. Use of the infectious bronchitis virus spike protein of any one of claims 1 to 5 in the preparation of an immunogenic composition, wherein the immunogenic composition prevents clinical signs caused by infectious bronchitis virus in a subject in need thereof.
19. Use of the immunogenic composition of claim 15 in the preparation of a kit for preventing clinical signs caused by infectious bronchitis virus in a subject in need thereof.
Citation Information
Patent Citations
PROCESS FOR PREPARING SURFACE COVERINGS
FR2572335B1
SE149406C1
Acrylic acid polymer laxative compositions
US2909462A
In ovo protection against infectious bronchitis
WO2001064244A2
Chimaeric protein
WO2011004146A1