Grape transcription factor VvERF101 and application thereof in plant heat-resistant genetic improvement
By overexpressing the transcription factor VvERF101 isolated from sunshine rose grapes in plants, the problem of inhibition of grape growth and development at high temperatures is solved, and the heat tolerance and antioxidant ability of the plants are improved.
Patent Information
- Application Number
- CN202510621260.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-14
- Publication Date
- 2025-08-15
AI Technical Summary
In the prior art, grape growth and development are inhibited under high temperature stress, resulting in reduced photosynthesis, cell damage and yield reduction, and lack of effective heat-tolerant gene resources to cope with extreme high temperatures caused by climate warming.
Transcription factor VvERF101 was isolated and cloned from Sunshine Rose grapes, and the gene was overexpressed in plants, enhancing its heat tolerance.
By overexpressing VvERF101, the plants' heat tolerance is significantly improved, cell damage and ROS accumulation are reduced, and resistance to high temperatures is enhanced.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of plant genetic engineering, and specifically relates to a grape transcription factor VvERF101 and its application in genetically improving plant heat tolerance. The applicant isolated and cloned a transcriptional regulatory factor VvERF101 from Vitis labruscana Baily × Vitis vinifera L., overexpressed the gene in tobacco, and the resulting transgenic plants had significantly improved heat tolerance. Background Art
[0002] High temperature stress can affect various physiological processes involved in plant growth and development, such as photosynthesis, respiration, transpiration, membrane thermostability, and osmoregulation (Zhao et al., 2021a, Khan et al., 2022). Studies have shown that high temperature stress can disrupt chloroplast thylakoid structure, affect the activity of enzymes involved in photochemical reactions, reduce photosynthetic efficiency, and severely impact plant growth and development (Hu et al., 2020). When terrestrial plants are exposed to high temperature stress, the lipid composition of the thylakoid membrane changes, increasing the content of saturated and monounsaturated phospholipids and, through eukaryotic pathways, increasing the content of 18:2 phospholipids such as galactolipids. This also actively reduces the synthesis of unsaturated fatty acids and reduces plasma membrane fluidity (Higashi et al., 2015). When plants are exposed to high temperatures for extended periods, chemical bonds in the cell membrane break, leading to membrane damage, increased membrane permeability, cytoplasmic outflow, and ultimately cell necrosis (Chen et al., 2022). High temperature can also cause hydrogen peroxide H2O2, superoxide anion O2 ·- The accumulation of reactive oxygen species (ROS) such as hydroxyproline and hydroxyproline can lead to an imbalance in the antioxidant enzyme system and a sharp increase in cellular lipid levels, resulting in decreased cell viability and toxic death (Zhao et al., 2021b). Furthermore, high temperatures can cause changes in plant water content. Although plants can respond to sudden high temperatures by regulating their respiration and transpiration rates, the content of soluble protein and soluble sugars, and cellular osmotic pressure to balance water loss and heat dissipation, if high temperatures persist for too long, they can cause physiological disturbances and metabolic imbalances in seedlings, leading to water loss and death (Wang et al., 2020).
[0003] Transcription factors are key players in the complex regulatory networks that plants generate in response to environmental stimuli. High-temperature signals can be amplified by transcription factors in plants, activating the expression of target genes to respond to stress. Transcription factors from the NAC, WRKY, BZR1, and ERF families also participate in the regulation of high-temperature stress. For example, TaNAC2L can enhance heat tolerance in wheat by increasing the expression of heat-shock-responsive genes (AtHSF3 and AtDREB2A) (Guo et al., 2015). Wang et al. (2018) found that high temperature induces the expression of ZmWRKY106, which regulates stress-related genes through the ABA signaling pathway, increasing the activity of superoxide dismutase (SOD) and phosphate (POD) in plants, reducing ROS levels, and improving heat tolerance in transgenic plants. The regulatory role of plant-specific transcription factors in high-temperature stress has become a research hotspot in recent years, providing a new reference for plant genetic improvement and innovative breeding (Zhu 2016). Therefore, discovering and utilizing transcription factors is a more effective approach to improving plant stress tolerance.
[0004] ERF transcription factors are involved in plant growth, development, and cellular processes such as transcriptional regulation, RNA binding, stress response, and apoptosis (Sakuma et al. 2002). The AP2 / ERF family is generally divided into three independent subfamilies: ERF, AP2, and RAV. These subfamilies are typically characterized by the presence of one or two AP2 domains with DNA binding functions (Licausi et al. 2013). AP2 / ERFs can regulate gene expression and control plant stress tolerance by specifically binding to GCC-box core elements or DRE / C-repeat sequences in target gene promoters. Regarding high temperatures, DREB2C enhances plant heat tolerance by activating the transcription of heat shock-related genes. In lily, the gene LlERF012 can interact with LlHSFA1 to co-regulate the expression of LlHSFs, thereby enhancing heat tolerance (Li et al. 2024). High temperatures induce the expression of DlERF6 in longan. Overexpression of DlERF6 can enhance IAA biosynthesis and ROS scavenging, enhancing heat tolerance in transgenic plants (Zhang et al., 2025). These studies suggest that ERF transcription factors play an important role in plant resistance to heat stress. However, ERF genes involved in heat response have not yet been identified in grapes.
[0005] Grapes are one of the most widely cultivated fruit trees in the world, primarily used for fresh consumption, winemaking, dried fruit, and juice production, and possess significant economic value. In recent years, global warming and frequent extreme high temperatures have severely impacted the yield and quality of grapes, including fruit trees. High temperatures often inhibit physiological activities such as photosynthesis in grapes, affecting their growth and development, leading to reduced berry quality and yield (Lippmann et al., 2019, Ding et al., 2020). Research on the mechanisms of heat tolerance in grapes and the breeding of new heat-resistant varieties has important economic significance for the development of my country's agricultural industry. 'Sunshine Rose' grapes have excellent fresh quality, characterized by resistance to berry cracking, threshing, high yield, and strong stress resistance. These excellent traits make them a valuable resource for grape genetic improvement. Therefore, isolating and identifying genes associated with heat tolerance in Sunshine Rose grapes is crucial and fundamental for enriching the grape gene library for stress tolerance and uncovering the mechanisms underlying their heat resistance. Summary of the Invention
[0006] The present invention aims to provide a grape heat-resistant gene, which is a transcription factor isolated and cloned from Sunshine Rose grapes. The applicant named it VvERF101, its nucleotide sequence is shown in SEQ ID NO.1, and the encoded protein is shown in SEQ ID NO.2.
[0007] Another object of the present invention is to provide a use of a grape heat-resistant gene VvERF101 in controlling the high temperature resistance of plants. By overexpressing the gene in plants, plants with enhanced heat resistance can be obtained.
[0008] In order to achieve the above object, the present invention adopts the following technical measures:
[0009] The applicant isolated and cloned a transcription factor from Sunshine Rose grapes based on plant gene cloning technology, and named it VvERF101. Its sequence is shown in SEQ ID NO.1, and its corresponding amino acid sequence is shown in SEQ ID NO.2. Open reading frame (ORF) prediction found that the gene contains one ORF, is 849bp in length, and encodes a protein of 282 amino acids with a molecular weight of 30.31kDa and an isoelectric point of 7.28.
[0010] The protection scope of the present invention includes:
[0011] A transcription factor VvERF101 isolated from Sunshine Rose grape, wherein the protein encoded by the transcription factor is shown in SEQ ID NO.2.
[0012] The gene encoding the protein described in SEQ ID NO.2.
[0013] An expression cassette, recombinant vector, recombinant microorganism or in vitro recombinant cell having the above-mentioned coding gene.
[0014] Use of the grape transcription factor VvERF101, the gene encoding the protein described in SEQ ID NO. 2, or an expression cassette, recombinant vector, recombinant microorganism, or in vitro recombinant cell having the above-mentioned encoding gene in enhancing the heat tolerance of plants;
[0015] Use of the grapevine transcription factor VvERF101, the gene encoding the protein described in SEQ ID NO. 2, or an expression cassette, recombinant vector, recombinant microorganism, or in vitro recombinant cell containing the gene encoding the protein in creating heat-resistant transgenic plants;
[0016] The applications described above are specifically:
[0017] Increase the expression of the grape transcription factor VvERF101 to enhance the plant's heat tolerance;
[0018] In the above application, preferably, the plant is tobacco;
[0019] In the above application, preferably, the polynucleotide of the grape transcription factor VvERF101 is shown as SEQ ID NO.1.
[0020] Compared with the prior art, the present invention has the following advantages:
[0021] The discovery and identification of this gene provides new genetic resources for the design and breeding of plant stress-resistant molecules, and provides new genetic resources for the implementation of green agriculture and water-saving agriculture. The development and utilization of this genetic resource is conducive to reducing agricultural production costs and achieving environmental friendliness. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1 It is a technical flow chart of the present invention.
[0023] Figure 2 Schematic diagram of the expression pattern of VvERF101 in response to high temperature stress treatment.
[0024] Figure 3 is the subcellular localization analysis of VvERF101;
[0025] Among them: A is a schematic diagram of the construction of the VvERF101 gene subcellular localization vector; B is the subcellular localization result of the VvERF101 protein.
[0026] Figure 4 This is a schematic diagram of the identification and relative expression analysis of the VvERF101 gene in transgenic tobacco;
[0027] Wherein: A is the positive tobacco identified by the VvERF101 gene-specific primers of the present invention; B is the relative expression level of VvERF101 in the positive tobacco.
[0028] Figure 5 Schematic diagram of the measurement of phenotypic and physiological indicators of VvERF101 transgenic tobacco subjected to high temperature treatment;
[0029] Among them: A is the phenotype of transgenic tobacco (#3, #4) and wild-type tobacco before and after high temperature treatment; B is the relative conductivity of tobacco before and after treatment; C is the MDA content of tobacco before and after high temperature treatment; D is the H2O2 content of tobacco after treatment. DETAILED DESCRIPTION
[0030] The present invention is described in detail below with reference to specific embodiments. Based on the following description and examples, those skilled in the art can ascertain the essential features of the present invention and, without departing from the spirit and scope of the present invention, can make various changes and modifications to the present invention to adapt it to various uses and conditions.
[0031] Example 1: Cloning of the full-length cDNA of the grape VvERF101 gene
[0032] Using Vitis labruscana Baily × Vitis vinifera L. cDNA as a template, amplification was performed using a high-fidelity enzyme. The amplification system is shown in Table 1, the amplification program is shown in Table 2, and the amplification primer sequences are:
[0033] VvERF101-F: 5'-ATGATGAGCGGAGATCAGTTGCA-3'
[0034] VvERF101-R: 5'-TCAAAATGACTTGTTCGAGAAC-3'.
[0035] The amplified product was purified and recovered using the AxyPrep-96 DNA Gel Recovery Kit. Using seamless DNA cloning technology, the purified product was ligated into the pEASY-Blunt vector. The ligation system is shown in Table 3. The ligation product was then transformed into DH5α competent cells (Weidi, China), plated, and shaken. Positive identification was performed (GenStar, China). The positive identification system is shown in Table 4. Positive clones were sequenced at Wuhan Tianyi Huayu Gene Technology Co., Ltd., and the full-length sequence of the VvERF101 gene was obtained based on the sequencing results.
[0036] The sequencing results showed that the CDS sequence of the VvERF101 gene was 849 bp long, encoding 282 amino acids. The molecular weight of the protein was 30.31 kD, the isoelectric point was 7.28, the polynucleotide sequence was shown in SEQ ID NO.1, and the amino acid sequence was shown in SEQ ID NO.2.
[0037] Table 1 Gene amplification system
[0038]
[0039] Table 2 Gene amplification PCR program
[0040]
[0041]
[0042] Table 3 pEASY-Blunt vector ligation system
[0043]
[0044] Table 4 Positive identification reaction system
[0045]
[0046] Example 2: Analysis of VvERF101 gene expression under high temperature conditions
[0047] Three-month-old "Sunshine Rose" grape cuttings were placed in a plant incubator at 42°C (16h light / 8h dark, 70% humidity, 12000lx light), and the 3rd to 4th leaves from the top to the base were sampled at 0, 6, 12 and 24h. The collected samples were immediately frozen in liquid nitrogen and stored at -80°C for subsequent quantitative experiments. The high-temperature expression pattern of the VvERF101 gene was analyzed by real-time fluorescence quantitative PCR (qRT-PCR). The real-time fluorescence quantitative PCR used AceQ qPCR SYBR Green Master Mix reagent, and the method was referred to the instruction manual. QuantStudio TM The reaction was performed using a 7FlexReal-Time PCR fluorescence quantitative analyzer. The reaction system and reaction procedure were as shown in Table 5 and Table 6, respectively. Actin in grape was used as the internal reference gene. -ΔΔCt The algorithm was used to calculate gene expression. The primers used were as follows:
[0048] Actin-F: 5'-CTTGCATCCCTCAGCACCTT-3'
[0049] Actin-R: 5'-TCCTGTGGACAATGGATGGA-3'
[0050] VvERF101-qPCR-F: 5'-GAGCCCGATCCAGTCCGAGTGAC-3'
[0051] VvERF101-qPCR-R: 5'-GCGAACCAATAGCTGTGGGC-3'
[0052] Table 5 qRT-PCR reaction system
[0053]
[0054] Table 6 qPCR reaction procedure
[0055]
[0056] The results of this experiment showed that the expression of VvERF101 gene was continuously induced by high temperature, with the highest expression at 12h, which increased by about 227 times compared with that before treatment, and then slowly decreased ( Figure 2 ). This indicates that the VvERF101 gene can be induced by high temperature stress and may play an important role in plant tolerance to high temperature stress.
[0057] Example 3: Subcellular localization of VvERF101 gene
[0058] Using Vitis labruscana Baily × Vitis vinifera L. cDNA as a template, the ORF region of VvERF101 (excluding the stop codon) was amplified. The amplification primers were designed as follows:
[0059] VvERF101-YFP-F:5'-GGATCTACTAGTGAATTC ATGTGTGATTACAGT -3'
[0060] VvERF101-YFP-R: 5'-GGTACCGTCGACGGATCCGCGAACCAATAGCTGTGG-3'
[0061] The insert fragment with homologous sequence was amplified using this primer pair and inserted into the vector p101LYFP using the One Step Cloning Kit (Novozymes, China). The ligation system is shown in Table 7. The YFP protein is located at the 3' end of the gene and its expression is driven by the CaMV35S promoter. The control 35S:YFP+mCherry and 35S:VvERF101-YFP+mCherry were then transiently transformed into the epidermal cells of Nicotiana benthamiana leaves. Laser confocal microscopy revealed that the fluorescence of the control filled the entire epidermal cell, including the cytoplasm and nucleus, while the fluorescence of the transformed 35S:VvERF101-YFP was only concentrated in the nucleus and overlapped with the red fluorescence of the nuclear localization marker mCherry, indicating that VvERF101 is localized in the nucleus (see Figure 3 ).
[0062] Table 7 One-step ligase reaction system
[0063]
[0064] Example 4: Plant transformation vector construction
[0065] 1. Plant transformation vector construction
[0066] Using the cDNA of Vitis labruscana Baily × Vitis vinifera L. as a template, primers were designed to amplify the full length of the VvERF101 gene. The primer sequences are as follows:
[0067] pDONR221-VvERF101-F:
[0068] 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTA ATGATGAGCGGAGATCAGTTGCA -3'
[0069] pDONR221-VvERF101-R:
[0070] 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTTGCGAACCAATAGCTGTGGGC-3'
[0071] After amplification and recovery, BP reaction was performed with pDONR211 vector. For the method of use, refer to BPClonase TM Ⅱ kit instructions, the specific reaction system is shown in Table 8, the positive clones that have been sequenced correctly were shaken. Then the plasmid was extracted using the AxyPrep plasmid DNA miniprep reagent (Axygen, USA) and LR reaction was performed with the target vector pGWB405. The method is as follows LR Clonase TM II (Invitrogen) kit instructions, the LR reaction system is shown in Table 9, and then E. coli competent transformation can be carried out. After positive identification, the bacteria are shaken and the plasmid is extracted to obtain the final overexpression vector pGWB405-VvERF101. The methods for the steps of amplified fragment recovery, positive clone detection, and sample sequencing are referred to Example 1. Finally, the vector is transformed into Agrobacterium competent GV3101 for use.
[0072] Table 8 BP reaction system
[0073]
[0074] Table 9LR reaction system
[0075]
[0076] Example 5: Genetic transformation and positive identification of tobacco
[0077] 1) Strain preparation: Take out the Agrobacterium transformed with the pGWB405-VvERF101 vector stored at -80°C, pick up a small amount of Agrobacterium liquid with a sterile inoculation loop, streak it on LB solid medium (containing 50 mg / L spectinomycin and 50 mg / L rifampicin), and culture it at 28°C for 2-3 days; pick a single clone, streak it again on a new LB solid medium (containing 50 mg / L spectinomycin and 50 mg / L rifampicin), and culture it for 2-3 days. Scrape the bacteria with a sterile surgical blade and place it in MS liquid medium without antibiotics. Culture it at 28°C and 200 rpm for 30 minutes, shake the bacteria thoroughly, and adjust the OD with MS liquid medium. 600 The value reaches 0.6-0.8 for infection;
[0078] 2) Explant preparation: Select sterile tobacco leaves that are growing well, take the largest 2-3 leaves, remove the main veins and leaf edges, and cut into 0.5 cm 2 Place the cubes of about the same size into a sterile Erlenmeyer flask with a small amount of MS liquid medium for infection;
[0079] 3) Infection and Co-cultivation: Pour the bacterial suspension from the first step into the flask containing the explants and incubate at 28°C, 200 rpm for 10 minutes. After infection, blot the explants dry with sterile filter paper. Place the leaf, dorsal surface facing down, on a sterile filter paper-lined tobacco co-cultivation medium (MS + 2.25 mg / L 6-BA + 0.3 mg / L NAA) and incubate in the dark for 3 days.
[0080] 4) Screening Culture: After 3 days of co-culture, all explants were transferred to sterile Erlenmeyer flasks and washed 2-3 times with sterile water containing 400 mg / L Cef, then washed 2-3 more times with sterile water. Finally, the water on the surface of the explants was blotted dry with sterile filter paper and cultured on tobacco screening medium (MS + 400 mg / L Cef + 100 mg / L Km + 2.25 mg / L 6-BA + 0.3 mg / L NAA).
[0081] 5) Rooting culture: Cut off the resistant buds that have grown to 1-2 cm in length and place them in a medium containing MS + 400 mg / L Cef for rooting culture.
[0082] The above culture media all contain 3.0% sucrose and 0.8% agar, and the pH value is adjusted to 5.9-6.0. After the culture media are sterilized by high temperature and high pressure, when they are cooled to below 60°C, filter-sterilized antibiotics are added and aliquoted for use.
[0083] When the resistant buds take root and grow 2-3 leaves, take a small amount of leaves for DNA extraction. The DNA extraction steps are as follows:
[0084] 1) Place a small amount of leaves in a 1.5 mL centrifuge tube, grind with liquid nitrogen until powdery, and add 600 μL of CATB extract;
[0085] 2) After thorough mixing, place in a 65°C water bath for 90 minutes, inverting and mixing every 30 minutes;
[0086] 3) After the water bath is complete, add 700 μL of a 24:1 (chloroform:isoamyl alcohol, v / v) mixed extract and mix vigorously for 10 min. Centrifuge at 12,000 rpm for 15 min at room temperature. Transfer the supernatant (approximately 500 μL) to a new 1.5 mL centrifuge tube.
[0087] 4) Add an equal volume of pre-chilled isopropanol to the supernatant, mix thoroughly by inverting, and place in a -20°C refrigerator to precipitate (precipitation time can be extended);
[0088] 5) After precipitation is complete, remove the pellet and centrifuge at 12,000 rpm for 10 minutes. Discard the supernatant and add 1 mL of pre-chilled 75% ethanol. Rinse 2-3 times, discard the alcohol, and air-dry in a fume hood.
[0089] 6) Add 20-30 μL ddH2O to each tube to dissolve the DNA. Store the dissolved DNA in a -20°C refrigerator.
[0090] For concentration detection, 1 μL of each sample was taken and measured on a NanoDrop2000 ultra-micro spectrophotometer (Thermo, USA). 260 / OD 280When the ratio is within the range of 1.8-2.0, the DNA purity is high. It is also tested by gel electrophoresis.
[0091] Using the identification primers, several positive plants were obtained by PCR identification (see Figure 4 A), the sequences of the positive primers for identifying plants were 35S-F: 5'-CCCACTATCCTTCGCAAGACC-3' and Gene-R: 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTTGCGAACCAATAGCTGTGGGC-3'; the relative expression level of the VvERF101 gene in positive tobacco plants was analyzed by real-time fluorescence quantitative analysis, and the results showed that the expression level of VvERF101 was significantly increased compared with WT ( Figure 4 (B) Based on the positive seedling identification results, T2 generation seeds of overexpressing plants #3 and #4 were selected for subsequent analysis.
[0092] Example 8: Analysis of heat tolerance of transgenic tobacco
[0093] One-month-old potted transgenic tobacco and wild-type tobacco (WT) prepared in Example 7 were used for high temperature resistance identification.
[0094] The tobacco was placed in a plant incubator (12 hours of light and 12 hours of high temperature treatment at 47°C, 70% humidity, and 12000 lx of light). After the high temperature treatment, the tobacco was restored at 25°C for three days, and samples were collected for index testing.
[0095] The results showed that before high temperature treatment, there was no obvious phenotypic difference between the wild type and transgenic lines (#3, #4). However, after high temperature treatment, most leaves of wild type tobacco wilted and died, while only some leaves of transgenic lines wilted ( Figure 5 Middle A). After high temperature treatment, the conductivity of tobacco #3 and #4 were 32.7% and 39.5% respectively, while that of wild type tobacco was 68.6%. The conductivity of tobacco overexpressing VvERF101 was lower than that of wild type ( Figure 5 (B), indicating that the cell membrane of wild-type tobacco was severely damaged. The results of the MDA assay showed that after high temperature treatment, the MDA contents of wild-type, #3, and #4 tobacco were 74.7, 47.4, and 48.4 nmol / g, respectively, indicating that the transgenic plants accumulated less MDA ( Figure 5 In addition, after high temperature treatment, the H2O2 content of tobacco overexpressing VvERF101 was lower than that of wild type. The H2O2 content of wild type, #3 and #4 tobacco were 6.7, 5.1 and 5.3 μmol / g, respectively. Figure 5(D) This indicates that the transgenic plants accumulate less ROS and have better ROS scavenging ability. In summary, phenotypic observations and physiological data measurements indicate that overexpressing the VvERF101 gene enhances tobacco's tolerance to high temperatures to a certain extent.
Claims
1. A transcription factor isolated from Sunshine Rose grape VvERF101 The protein encoded by the transcription factor is shown as SEQ ID NO.
2.
2. The gene encoding the protein described in SEQ ID NO.
2.
3. An expression cassette, recombinant vector, recombinant microorganism or in vitro recombinant cell containing the coding gene according to claim 2.
4. The grape transcription factor according to claim 1 VvERF101 , use of the encoding gene according to claim 2 or the expression cassette, recombinant vector, recombinant microorganism or in vitro recombinant cell according to claim 3 in enhancing the heat tolerance of plants.
5. The grape transcription factor according to claim 1 VvERF101 , use of the coding gene according to claim 2 or the expression cassette, recombinant vector, recombinant microorganism or in vitro recombinant cell according to claim 3 in creating heat-resistant transgenic plants.
6. The use according to claim 4 or 5, characterized in that The application process includes increasing the grape transcription factor VvERF101 to enhance the heat tolerance of plants.
7. The use according to claim 4 or 5, wherein the plant is tobacco.
8. The use according to claim 4 or 5, wherein the grape transcription factor VvERF101 The polynucleotide is shown as SEQ ID NO.1.