Tobacco chloroplast polypeptide Ntppc and application of tobacco chloroplast polypeptide Ntppc in regulation and control of resistance of tobacco to black shank
By cloning and overexpressing the Ntppc gene of tobacco chloroplast polypeptide, the resistance of tobacco to black tibia is regulated, the loss of black tibia in tobacco production is solved, the sensitivity of tobacco to black tibia is enhanced, and a new mechanism for plant immune regulation is provided.
Patent Information
- Application Number
- CN202510645107.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-20
- Publication Date
- 2025-08-15
AI Technical Summary
The prior art has failed to effectively regulate the resistance of tobacco to black tibia, resulting in serious losses in tobacco production.
By cloning the Ntppc gene of tobacco chloroplast polypeptide, constructing an overexpression vector and transforming tobacco, experiments have shown that overexpressing Ntppc can increase the sensitivity of tobacco to black tibia and negatively regulate tobacco's resistance to black tibia.
It significantly enhances the sensitivity of tobacco to black tibia, provides a new mechanism for plant immune regulation, and has important agricultural application value.
Smart Images

Figure CN120484080A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of bioengineering, and in particular to a tobacco chloroplast polypeptide Ntppc and application thereof in regulating tobacco resistance to black shank disease. Background Art
[0002] Plant peptides are a recently discovered class of hormone-like substances. They are small, physiologically active molecules produced by the cleavage of protein precursors by the proteasome. Research on plant peptides has been a hot topic in recent years. Peptides differ from proteins solely in the number of amino acid residues, and standardized nomenclature dictates that molecules smaller than 10 kDa should be referred to as peptides. Plant-secreted peptides are typically composed of 60 to 100 amino acids, with a relatively conserved structure consisting of an N-terminal signal peptide, a C-terminal conserved region (10 to 30 amino acids), and a variable region in between. The Arabidopsis thaliana genome contains over 7,000 small open reading frames (ORFs) with no functional annotation. Of these, over 1,000 likely encode peptide precursors of 50 to 150 amino acids in length. The functions of the vast majority remain unknown. Current research on plant peptides primarily focuses on their role as novel plant hormones in regulating growth and development, including cell proliferation, pollen tube growth, and organ aging. However, the role of plant peptides in regulating plant immune responses remains relatively unknown.
[0003] Tobacco black shank is one of the most important rhizome diseases of tobacco, causing significant losses to tobacco production annually. The pathogen that causes tobacco black shank belongs to the genus Phytophthora, in the kingdom Chromista, the phylum Oomycota, the orders Peronosporales, and the order Phytophthora. Phytophthora is a major plant pathogen, encompassing over 100 species, many of which are devastating to crops, vegetables, flowers, and forests. Examples include Phytophthora infestans, which infects potatoes and causes potato late blight; Phytophthora sojae, which infects soybeans and causes soybean root rot; Phytophthora ramorum, which causes sudden oak death; and Phytophthora capsici, which infects peppers and causes pepper blight.
[0004] Therefore, it is necessary to develop a method to regulate tobacco resistance to black shank. Summary of the Invention
[0005] The present invention aims to provide a tobacco chloroplast polypeptide Ntppc and its application. Experiments have shown that overexpression of Ntppc can increase the susceptibility of tobacco to black shank disease. The polypeptide negatively regulates tobacco's resistance to black shank disease.
[0006] The present invention adopts the following technical solutions:
[0007] In a first aspect of the present invention, a tobacco chloroplast polypeptide Ntppc is provided. The amino acid sequence of the tobacco chloroplast polypeptide Ntppc is shown in SEQ ID NO: 2.
[0008] mastvmssls lkpatfsvek tavkglpsla rssssfrvqa sgvkklktdk pygingsmslrdgvdasgrk pkgkgvyqfv dkyganvdgy spiyntddws psgdvyvggt tglaiwavtl vgilaggallvfntsalaq (SEQ ID NO. 2).
[0009] In a second aspect of the present invention, a gene encoding the tobacco chloroplast polypeptide Ntppc is provided, and the nucleotide sequence of the gene is shown in SEQ ID NO: 1.
[0010] (SEQ ID NO: 1).
[0011] In the third aspect of the present invention, a recombinant expression vector is provided, wherein the recombinant expression vector is capable of expressing the tobacco chloroplast polypeptide Ntppc.
[0012] Furthermore, the recombinant expression vector includes at least one of an Escherichia coli expression vector, a yeast expression vector, a Bacillus subtilis expression vector, a lactic acid bacteria expression vector, a Streptomyces expression vector, a filamentous fungus expression vector, a plant expression vector, an insect expression vector, or a mammalian cell expression vector.
[0013] In the fourth aspect of the present invention, a recombinant bacterium or engineered cell line comprising the recombinant expression vector is provided.
[0014] Furthermore, the host cell includes one of an Escherichia coli host cell, a yeast host cell, a Bacillus subtilis host cell, a lactic acid bacteria host cell, an actinomycete host cell, a filamentous fungus host cell, and an insect cell.
[0015] In the fifth aspect of the present invention, provided is the use of the gene, the tobacco chloroplast polypeptide Ntppc, the recombinant expression vector, the recombinant bacteria or the engineered host cell line in regulating tobacco resistance to black shank disease.
[0016] In a sixth aspect of the present invention, a method for regulating tobacco resistance to black shank is provided, the method comprising:
[0017] S1. Clone and obtain the tobacco chloroplast polypeptide Ntppc gene with the nucleotide sequence shown in SEQ ID NO: 1;
[0018] S2, ligating the gene to the ClaI and SalI restriction sites of the pCamb-GR106 vector to obtain an overexpression vector containing the Ntppc gene;
[0019] S3. introducing the overexpression vector into tobacco plants through Agrobacterium-mediated transformation;
[0020] S4. Screen and obtain transgenic tobacco overexpressing Ntppc, and verify the changes in disease resistance of transgenic plants through black leg pathogen inoculation experiments.
[0021] Furthermore, the cloned tobacco chloroplast polypeptide Ntppc gene has a nucleotide sequence as shown in SEQ ID NO: 1, and the sequences of the primer pairs used are shown in SEQ ID NO: 3-SEQ ID NO: 4.
[0022] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:
[0023] 1. This invention isolated and identified a tobacco chloroplast-associated polypeptide, named Ntppc. Experiments have shown that overexpression of Ntppc can increase tobacco's susceptibility to black shank disease, and that this polypeptide negatively regulates tobacco's resistance to black shank disease.
[0024] 2. This study cloned the Ntppc gene (SEQ ID NO: 2), constructed an overexpression vector, and transformed tobacco. Experimental results indicate that overexpression of this gene significantly enhances tobacco's susceptibility to black shank disease. This study provides a novel mechanism for plant immune regulation and has important agricultural applications. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0026] Figure 1 This is the electrophoresis picture of PCR results.
[0027] Figure 2 Inoculate tobacco leaves for the fungus block inoculation method.
[0028] Figure 3 Symptoms of black shank infection in control and transgenic tobacco leaves. The left is the control, and the right is the Ntppc overexpressing transgenic tobacco leaves. DETAILED DESCRIPTION
[0029] The present invention will be described in detail below in conjunction with specific embodiments and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific embodiments and examples are for illustrating the present invention, rather than for limiting the present invention.
[0030] Throughout this specification, unless otherwise specified, the terms used herein should be understood as having the same meaning as commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In the event of any conflict, the present specification shall take precedence.
[0031] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or obtained through existing methods.
[0032] In order to solve the technical problems of the present invention, the overall concept of the present invention is as follows:
[0033] The present invention identified a tobacco chloroplast-related polypeptide with a size of 10kDa and containing 139 amino acids. The gene encoding the polypeptide was cloned into tobacco genomic DNA by gene cloning and named Ntppc (774kb). The CDS sequence of Ntppc was constructed into the pGR-106 overexpression vector using the homologous recombination method and transferred into the GV3101 Agrobacterium strain. Ntppc was then transferred into the tobacco variety TN90 by the Agrobacterium-mediated transformation method to obtain tobacco overexpressing Ntppc. Black shank disease was inoculated by in vitro inoculation and a control was set up. The results showed that Ntppc negatively regulated tobacco's resistance to black shank disease.
[0034] The tobacco chloroplast polypeptide Ntppc and its application of the present application will be described in detail below with reference to examples and experimental data.
[0035] Example 1: Tobacco chloroplast polypeptide Ntppc gene cloning and vector construction
[0036] Reagents and instruments used in the experiment:
[0037] Beijing Solaibao Company plant DNA extraction kit, 10× PCR Buffer, dNTPMix, PCR polymorase, gel excision recovery kit, loading buffer, DNA marker, pipette (0.1μl-1000μl), Eppendorf desktop centrifuge, Milli-Q ultrapure water machine, Grant SUBAquaPlus digital temperature-controlled water bath, SANYO SIM-F140AY65 ice maker and TOMY SS-325 automatic sterilizer, Applied Biosystems' Veriti TM Multiple temperature-controlled PCR instrument, BIO-RAD electrophoresis tank and voltage meter, ordinary refrigerator, etc.
[0038] Step 1: Design primers as follows:
[0039] Table 1
[0040] name Sequence (5'-3') F53-1 TGGGTTCTGGTGTCATACCC(SEQ ID NO.3) F53-2 TTTTTTCCGGGGTTCTACTC(SEQ ID NO.4)
[0041] Step 2: Extraction of tobacco genomic DNA
[0042] Tobacco DNA was extracted using a plant DNA extraction kit from Beijing Solebaugh. The specific steps are as follows:
[0043] 1. Take fresh tobacco leaves (no more than 100 mg) and grind them thoroughly in liquid nitrogen until they are fine powder. Let the liquid nitrogen evaporate naturally.
[0044] 2. Quickly transfer the ground tobacco powder into a centrifuge tube pre-filled with 400 μl of solution A, 20 μl of RNase A (10 mg / ml) and 5 μl of β-mercaptoethanol, mix thoroughly by inversion, and place at room temperature for 10 minutes.
[0045] 3. Add 140 μl of solution B, mix thoroughly by inversion, centrifuge at 12,000 rpm for 10 min, and transfer the supernatant to a new centrifuge tube (about 400-500 μl). Be careful not to inhale the precipitate.
[0046] 4. Add the same volume of solution C as the supernatant, mix thoroughly by inversion, and then add the same volume of anhydrous ethanol as solution C. If flocs appear at this time, blow them away and add them to the adsorption column together. Centrifuge at 12000rpm for 5min and discard the waste liquid. If the whole amount cannot be added in one time, add it in two times.
[0047] 5. Add 600 μl of rinsing solution to the adsorption column (please check whether anhydrous ethanol has been added first), centrifuge at 12000 rpm for 1 min, discard the waste liquid, and put the adsorption column back into the collection tube.
[0048] 6. Add 600 μl of rinse solution to the adsorption column, centrifuge at 12,000 rpm for 1 min, discard the waste liquid, put the adsorption column back into the collection tube, and centrifuge at 12,000 rpm for 2 min.
[0049] 7. Place the adsorption column at room temperature or in a 50°C incubator for a few minutes, otherwise the residual ethanol may affect subsequent experiments such as enzyme digestion and PCR.
[0050] 8. Place the adsorption column in a clean centrifuge tube, add 50-200 μl of eluent preheated in a 65°C water bath to the center of the adsorption membrane, let it stand at room temperature for 1-5 minutes, and centrifuge at 12,000 rpm for 2 minutes to obtain high-quality tobacco genomic DNA.
[0051] Step 3: PCR amplification of tobacco chloroplast-related polypeptide gene Ntppc
[0052] The Ntppc gene was amplified by PCR using the extracted tobacco genomic DNA as a template and the designed specific primers F53-1 and F53-2.
[0053] PCR reaction system:
[0054] Table 2
[0055] name Dosage 10×PCRBuffer 5.0 μl dNTPMix 0.5 μl F53-1 primer 0.5 μl F53-2 primer 0.5 μl polymorase 0.5 μl DNA template 0.5 μl <![CDATA[ddH2O]]> 42.5μl total 50.0μl
[0056] The total volume was 50 μl, and the reaction conditions were as follows: denaturation at 94°C for 5 min, 35 cycles of denaturation at 94°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 30 s, followed by extension at 72°C for 10 min, and incubation at 4°C. The resulting DNA product was subjected to gel electrophoresis to detect the target fragment.
[0057] Step 4: Recovery and purification of PCR products
[0058] Run the PCR-amplified target fragment obtained in the previous step on a 1% agarose gel. Once completed, photograph and observe the fragment under UV-visible light. Cut the target band using a UV-TV analyzer and perform gel recovery according to the instructions in the gel recovery kit. The procedure is as follows:
[0059] (1) Under long-wave UV light, use a clean blade to cut the DNA band to be recovered from the gel and place it into a clean 1.5 ml centrifuge tube that has been weighed in advance;
[0060] (2) Weigh the total mass of the centrifuge tube and gel, subtract the mass of the centrifuge tube to obtain the mass of the gel, and add 300 μl of Extraction Buffer per 100 g of gel;
[0061] (3) Melt the gel in a 55°C water bath for about 10 minutes, shaking and mixing every 2-3 minutes until the gel is completely melted;
[0062] (4) Transfer the mixture obtained in the previous step to a spin column and centrifuge at 6000 rpm / min for 60 s. Discard the waste liquid in the collection tube.
[0063] (5) Add 600 μl of Extraction Buffer to the centrifuge column and centrifuge at 12,000 rpm for 60 s. Discard the waste liquid in the collection tube.
[0064] (6) Add 750 μl of Wash Buffer to the centrifuge column and centrifuge at 12,000 rpm / min for 60 s. Discard the waste liquid in the collection tube.
[0065] (7) Spin the column at 12000 rpm for 60 s and place the column in a new 1.5 ml centrifuge tube.
[0066] (8) Add 30 μl of Elution Buffer to the middle of the centrifuge column;
[0067] (9) Place the column in a water bath at approximately 60°C for 2 minutes;
[0068] (10) Centrifuge at 12000 rpm / min for 60 s. The DNA product remains in the centrifuge tube.
[0069] (11) Store at -20℃
[0070] (12) DNA was detected by 1% agarose gel electrophoresis, and the band length was the same as that of the PCR product band.
[0071] Step 5: Preparation of competent E. coli DH5α
[0072] Preparation of competent E. coli cells follows the calcium chloride double resuspension method described in the Molecular Cloning Guide, with some minor modifications. The specific steps are as follows:
[0073] (1) Take 20 μl of the E. coli bacterial suspension and inoculate it into 10 ml of liquid LB medium. Incubate overnight at 37°C and 250 rpm in a shaking incubator until the OD600 is approximately 0.5.
[0074] (2) Add 1 ml of the overnight culture to 100 ml of fresh LB medium and shake at 225-250 rpm for 2.5-3 h until OD600 = 0.4. Divide the culture into two pre-cooled 50 ml centrifuge tubes and place in an ice-water bath for 10 min.
[0075] (3) Centrifuge at 12,000 rpm for 10 min at 4°C to collect the cells;
[0076] (4) Discard the supernatant and slowly add 8 ml of 4°C cold 0.1 mol / L CaCl2 to resuspend the cells until homogeneous;
[0077] (5) Incubate in an ice-water bath for 30 min, and then centrifuge at 12,000 rpm / min for 5 min to recover the cells;
[0078] (6) Discard the supernatant and resuspend the cells in 2 ml of 0.1 mol / L CaCl2 at 4°C until homogeneous.
[0079] (7) Ice water bath for 2 hours;
[0080] (8) Aliquot the competent cell suspension into sterilized, pre-cooled centrifuge tubes, 100 μl per tube, containing 15% glycerol, and store in a -80°C refrigerator.
[0081] Step 6: Recover the product, connect it to pMDTM 19-T Vector and transform E. coli DH5α
[0082] The recovered product was ligated to pMDTM 19-T Vector, transformed into E. coli DH5α, identified, and sequenced. The ligation system is as follows:
[0083] Table 3
[0084] name Dosage Recycled products 4.0 μl T vector 1.0 μl T4 DNA ligase 0.5 μl Ligase buffer 10xbuffer 1.0 μl <![CDATA[ddH2O]]> 3.5 μl total 10.0 μl
[0085] The mixture is gently shaken and briefly centrifuged, then placed in a 14°C dry box incubator (or in a 14°C water bath) and incubated overnight (12-16 hours). The ligated product can be used immediately to transform competent cells.
[0086] Step 7: Transformation of E. coli
[0087] (1) Take a tube of prepared competent E. coli DH5α from a -80°C refrigerator, thaw it on ice, add 5 μl of the ligation product, mix gently with a pipette tip, and place on ice for 30 minutes;
[0088] (2) Heat in a 42°C water bath for 60 seconds, then quickly place in an ice-water bath for 2 minutes;
[0089] (3) Add 900 μl of LB liquid medium, shake at 180 rpm, and recover at 37°C for 90 min. At the same time, preheat an LB plate containing Kan in a 37°C constant temperature incubator.
[0090] (4) After recovery, centrifuge at 5000 rpm / min for 5 min;
[0091] (5) Aspirate 900 μl of supernatant, resuspend the bacteria in the remaining supernatant, and spread the resuspended bacteria on an LB plate;
[0092] (6) Incubate the cells upside down in a 37°C incubator for 16 to 20 hours.
[0093] Step 8: Screening of positive clones and PCR identification of bacterial suspension
[0094] (1) Select 10 uniform, nearly round white colonies and inoculate them into 5 ml of LB liquid medium containing Kan;
[0095] (2) Incubate in a shaking incubator at 225–250 rpm and 37°C for 8–10 h;
[0096] (3) PCR detection was performed on the bacterial solution using amplification primers, and then the PCR products were subjected to gel electrophoresis and UV detection. The PCR reaction system was 30 μl, and the amplification program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 50 s, for 30 cycles; and final extension at 72°C for 10 min.
[0097] Step 9: Sequencing and identification of the positive clones
[0098] Positive clones that were consistent with the target bands detected by PCR were sent to Shanghai Panosun Biotechnology Co., Ltd. for sequencing. The sequencing results showed that they were consistent with the sequence of the chloroplast polypeptide gene (LOC107816978) in NCBI, confirming that the cloned gene was the target gene.
[0099] PCR result electrophoresis picture Figure 1 shown.
[0100] Step 10: Connect the target gene to the pCamb-GR106 vector
[0101] Specific primers with ClaI+SalI restriction sites were designed (as shown in Table 4). PCR amplification was performed using the T-vector carrying the target fragment as a template to amplify the target fragment with ClaI+SalI restriction sites. The target fragment was then ligated with pCamb-GR106, and the ligation product was transformed into Agrobacterium tumefaciens LBA4404. The pCamb-GR106 vector of the present invention was purchased from Shanghai Lianmai Biotechnology Co., Ltd. under the catalog number LM-9035. The PCR reaction system is shown in Table 5.
[0102] Table 4
[0103] name Sequence (5'-3') GR5 aaaccataagggccattgccga (SEQ ID NO: 5) GR3 ccaagattatagagttcagca(SEQ ID NO: 6)
[0104] Table 5
[0105] name Dosage 10×PCRBuffer 5.0 μl dNTPMix 0.5 μl GR5 0.5 μl GR3 0.5 μl polymorase 0.5 μl T vector with target fragment 0.5 μl <![CDATA[ddH2O]]> 42.5μl total 50.0μl
[0106] The total volume was 50 μl, and the reaction conditions were: denaturation at 94°C for 5 min, 35 cycles of denaturation at 94°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 50 s, followed by extension at 72°C for 10 min, and incubation at 4°C. The resulting DNA product was subjected to gel electrophoresis to detect the target fragment.
[0107] The target fragment was recovered by gel excision using the same method as described above. The recovered target fragment was ligated to the vector pCamb-GR106 using the following ligation system:
[0108] Table 6
[0109] name Dosage Target gene with restriction enzyme sites ClaI+SalI 4.0 μl pCamb-GR106T vector 1.0 μl T4 DNA ligase 0.5 μl Ligase buffer 10xbuffer 1.0 μl <![CDATA[ddH2O]]> 3.5 μl total 10.0 μl
[0110] The mixture is gently shaken and briefly centrifuged, then placed in a 14°C dry box incubator (or in 14°C water) and incubated overnight (12-16 hours). The ligated product can be used immediately to transform Agrobacterium.
[0111] Example 2: Construction of transgenic tobacco
[0112] 1. Vector transformation of Agrobacterium tumefaciens
[0113] The ligation product obtained in the previous step was transformed into Agrobacterium tumefaciens LBA4404, and the specific steps were as follows:
[0114] (1) Thaw a tube of LBA4404 Agrobacterium competent cells in an ice water bath, add 5 μl of the positive plasmid, and gently pipette until mixed;
[0115] (2) Place in an ice water bath and let stand for 5 minutes, then cold shock in liquid nitrogen for 8 minutes, quickly remove the centrifuge tube and place in a 37°C water bath, heat shock for 5 minutes;
[0116] (3) Add 900 μl of YEB liquid medium mixed with Str and Rif and shake at 28°C, 180 rpm, and resuscitate for 3–5 h.
[0117] (4) Centrifuge at 5000 rpm / min for 5 min and discard 900 μl of supernatant;
[0118] (5) Resuspend the bacteria and spread them on YEB plates containing three antibiotics: Kan, Str, and Rif. Incubate the plates upside down in a 28°C incubator for about 2 days until large colonies grow.
[0119] (6) Use a pipette to pick up about 10 uniform, nearly round, light yellow colonies and inoculate them into 5 ml YEB liquid culture medium with Kan, Str, and Rif added; shake the culture and then perform PCR bacterial liquid detection. After amplification, the positive clones are used for Agrobacterium transient expression.
[0120] 2. Creation of transgenic tobacco overexpressing Ntppc
[0121] (1) Take the leaves of ordinary tobacco sterile seedlings, cut off the edges and main veins with a sharp surgical blade, and cut the leaves into small pieces of 0.5 cm square (with wounds on all sides) and set aside.
[0122] (2) Take the overnight culture of Agrobacterium LBA4404 (containing the kanamycin resistance gene, Ntppc gene) and centrifuge it at 4,000 rpm at room temperature for 10 minutes. Resuspend the cells in MS saline solution (pH 7.0) and dilute it to 20-50 times the original volume with MS saline solution before use.
[0123] (3) After the prepared leaf discs were infected in the bacterial solution for 10 minutes, the leaves were taken out, the bacterial solution on the leaf surface was absorbed with sterile filter paper, and the leaves were transferred to MS culture medium covered with a layer of sterile filter paper. The leaves were cultured in the dark at 28°C for 3-7 days.
[0124] (4) After co-culture, the material was transferred to differentiation medium (selection medium) containing antibiotics (MS + NAA 0.2 mg / l + 6-BA 3 mg / l + Kan 100 μg / ml + Cb 500 μg / ml) for culture, and subcultured every 15 days.
[0125] (5) When the resistant buds grow to 2-3 cm, they are cut off and transferred to 1 / 2MS rooting medium (1 / 2MS + Kan 100 μg / ml + Cb 500 μg / ml) to induce rooting.
[0126] (6) When the transgenic tobacco plants have grown roots and 5-6 leaves, the expression of Ntppc in the transgenic plants is detected by western blot to confirm its presence and activity at the transcriptional and translational levels.
[0127] Example 3, Blackleg resistance verification
[0128] 1. Black shank pathogen infects tobacco leaves
[0129] Tobacco leaves were infected using the bacterial clump inoculation method. Using a sterilized inoculum extractor, a bacterial clump was collected from a black shank plate with active mycelial growth. Using tweezers, the clump was placed on the underside of the tobacco leaf. Pre-inoculation of the clump was done to facilitate mycelial invasion. The clump was then incubated in the dark at 28°C, maintaining moisture, and symptoms were observed after two days.
[0130] 2. Inoculation of black leg pathogen into overexpressed transgenic tobacco and control tobacco leaves
[0131] The above method was used to inoculate the leaves of transgenic tobacco overexpressing Ntppc and control tobacco. Three days later, the following symptoms were observed. The transgenic tobacco leaves showed obvious necrosis symptoms, while the control leaves had mild symptoms ( Figure 3 ), indicating that overexpression of the Ntppc gene reduced tobacco's resistance to black shank, reducing tobacco resistance. This result proves that Ntppc is a negative regulatory factor that negatively regulates tobacco's resistance to black shank.
[0132] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.
[0133] Finally, it should be noted that the terms "comprises," "includes," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that includes a list of elements includes not only those elements, but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.
[0134] Although the preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.
[0135] Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if such changes and modifications fall within the scope of the claims and their equivalents, the present invention is intended to include such changes and modifications.
Claims
1. A tobacco chloroplast polypeptide Ntppc, characterized in that The amino acid sequence of the tobacco chloroplast polypeptide Ntppc is shown in SEQ ID NO:
2.
2. A gene encoding the tobacco chloroplast polypeptide Ntppc according to claim 1, characterized in that: The nucleotide sequence of the gene is shown in SEQ ID NO:
1.
3. A recombinant expression vector, characterized in that: The recombinant expression vector is capable of expressing the tobacco chloroplast polypeptide Ntppc according to claim 1.
4. The recombinant expression vector according to claim 3, characterized in that The recombinant expression vector includes at least one of an Escherichia coli expression vector, a yeast expression vector, a Bacillus subtilis expression vector, a lactic acid bacteria expression vector, a Streptomyces expression vector, a filamentous fungus expression vector, a plant expression vector, an insect expression vector, or a mammalian cell expression vector.
5. A recombinant bacterium or engineered host cell line comprising the recombinant expression vector according to any one of claims 3-4.
6. The recombinant bacteria or engineered host cell line according to claim 5, characterized in that The host cell includes one of an Escherichia coli host cell, a yeast host cell, a Bacillus subtilis host cell, a lactic acid bacteria host cell, an actinomycete host cell, a filamentous fungus host cell, and an insect cell.
7. Use of the gene according to claim 1, the tobacco chloroplast polypeptide Ntppc according to claim 2, the recombinant expression vector according to any one of claims 3-4, and the recombinant bacteria or engineered host cell line according to any one of claims 5-6 in regulating tobacco resistance to black shank disease.
8. A method for regulating tobacco resistance to black shank disease, characterized in that: The method comprises: S1. Clone and obtain the tobacco chloroplast polypeptide Ntppc gene with the nucleotide sequence shown in SEQ ID NO: 1; S2, ligating the gene to the ClaI and SalI restriction sites of the pCamb-GR106 vector to obtain an overexpression vector containing the Ntppc gene; S3. introducing the overexpression vector into tobacco plants through Agrobacterium-mediated transformation; S4. Screen and obtain transgenic tobacco overexpressing Ntppc, and verify the changes in disease resistance of transgenic plants through black leg pathogen inoculation experiments.
9. The method according to claim 8, characterized in that The cloned nucleotide sequence of the tobacco chloroplast polypeptide Ntppc gene is shown in SEQ ID NO: 1, and the sequences of the primer pairs used are shown in SEQ ID NO: 3-SEQ ID NO: 4.