Antibacterial peptide Aquiluscidin-1, coding gene and application of antibacterial peptide Aquiluscidin-1

Abstract

The invention relates to the technical field of biology, in particular to an antibacterial peptide Aquiluscidin-1, a coding gene and application of the antibacterial peptide Aquiluscidin-1. The invention provides an antibacterial peptide Aquiluscidin-1 which has good thermal stability, acid-base stability and endogenous protease degradation resistance, can obviously inhibit the growth of escherichia coli, salmonella and staphylococcus aureus, and has good application prospects in the fields of food, hygienic products, cosmetics, biopesticide, biological feed additives or natural food preservatives and the like. Wide application prospects are realized.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to an antimicrobial peptide Aquiluscidin-1, a coding gene and applications thereof. Background Art

[0002] Antimicrobial peptides (AMPs) are a class of small polypeptides encoded by host genes with broad-spectrum bactericidal activity. They are important components of the nonspecific immunity of nearly all organisms. AMPs are diverse and can be categorized according to their biological activity, including antibacterial, antifungal, antiviral, antiparasitic, and antitumor activities. AMPs are generally positively charged and amphipathic, interacting with hydrophobic surfaces and membranes, disrupting membrane integrity and inhibiting the activity of intracellular nucleic acids, proteins, and other substances. They exert antimicrobial effects at targets within the cell wall, cell membrane, and within cells, as well as on viruses. Due to their unique bactericidal mechanisms, AMPs hold broad application prospects. In livestock and poultry farming, they can be used as environmentally friendly feed additives to increase animal weight, enhance the number of beneficial intestinal bacteria, increase immunoglobulin levels, and reduce the concentration of inflammatory factors. They play a significant role in livestock performance, intestinal flora, immunity, and disease prevention, making them a promising alternative to antibiotics in feed preparation and feed additive applications.

[0003] Aquiluscidin, a defensin derived from rattlesnakes, is an antimicrobial peptide composed of 34 amino acid residues with antimicrobial activity against Escherichia coli and Staphylococcus aureus. Currently, aquiluscidin is obtained solely through chemical synthesis. While chemical synthesis of antimicrobial peptides offers a short production cycle, minimal engineering effort, and the ability to combine amino acid residues at will, it is subject to racemization and is expensive to produce. Genetic engineering techniques, primarily through prokaryotic and eukaryotic expression pathways, offer simplicity, ease of isolation and purification, and low production costs, making it a promising candidate for large-scale, industrialized production and a research hotspot in recent years. Therefore, the use of bioengineering techniques to obtain a novel antimicrobial peptide, Aquiluscidin-1, with excellent thermal and acid-base stability and strong antimicrobial activity is of great significance. Summary of the Invention

[0004] In response to the deficiencies of the prior art, the present invention provides the antimicrobial peptide Aquiluscidin-1, its encoding gene, and its application, and demonstrates that it has inhibitory effects on Escherichia coli, Salmonella, and Staphylococcus aureus, and has good thermal stability, acid-base stability, and resistance to endogenous protease degradation.

[0005] To achieve the above object, the present invention provides an antimicrobial peptide Aquiluscidin-1, characterized in that it is a protein composed of the amino acids shown in SEQ ID NO.1;

[0006] The antimicrobial peptide Aquiluscidin-1 protein can withstand a pH value of 3-11, a high temperature environment of 95°C and degradation by endogenous proteases, and can be used in biotechnology fields such as the preparation of food, sanitary products, cosmetics, biological pesticides, biological feed additives or natural food preservatives.

[0007] In a second aspect, the present invention further provides a gene encoding an antimicrobial peptide Aquiluscidin-1, wherein the nucleotide sequence of the gene is the nucleotide sequence shown in SEQ ID NO.2;

[0008] Those skilled in the art are fully aware that since the same amino acid may be determined by multiple different codons, the nucleotide sequence encoding the above-mentioned protein is not limited to just one. It can be a nucleotide sequence encoding the mutant amino acid sequence of the present invention by mutating one or more nucleotides of the mutant nucleotide sequence shown in SEQ ID NO. 2 to form a synonymous mutation. Alternatively, a nucleotide sequence encoding the mutant amino acid sequence of the present invention can be designed based on codon optimization.

[0009] Thirdly, recombinant vectors, expression cassettes, transgenic cell lines or recombinant bacteria containing the above-mentioned genes also fall within the scope of protection of the present invention.

[0010] In a fourth aspect, a method for preparing the antimicrobial peptide Aquiluscidin-1 also falls within the scope of protection of the present invention, comprising the following steps: amplifying the coding gene fragment shown in SEQ ID NO. 2 by a fusion PCR reaction, fusing it with a SUMO fragment, constructing a recombinant expression vector for the antimicrobial peptide Aquiluscidin-1, and introducing the recombinant expression vector into a host cell to obtain recombinantly expressed antimicrobial peptide Aquiluscidin-1.

[0011] Furthermore, the primer set for amplifying the coding gene fragment shown in SEQ ID NO.2 is: the upstream primer is shown in SEQ ID NO.4, and the downstream primer is shown in SEQ ID NO.5.

[0012] Furthermore, the recombinant expression vector is selected from one or more of an Escherichia coli expression vector, a yeast expression vector, a Bacillus subtilis expression vector, a lactic acid bacteria expression vector, a Streptomyces expression vector, a phage vector, a filamentous fungus expression vector, a plant expression vector, an insect expression vector, or a mammalian cell expression vector; preferably, it is selected from pET-28a(+).

[0013] Furthermore, the recombinant bacteria or transgenic line used for recombinant expression of the antimicrobial peptide Aquiluscidin-1 is selected from one of Escherichia coli host cells, yeast host cells, Bacillus subtilis host cells, lactic acid bacteria host cells, actinomycete host cells, filamentous fungal host cells, insect cells, and mammalian cells; preferably, it is selected from BL21 (DE3).

[0014] In a fifth aspect, the present invention also provides the use of the antimicrobial peptide Aquiluscidin-1 in the preparation of foods, sanitary products, cosmetics, biological pesticides, biological feed additives or natural food preservatives.

[0015] Furthermore, the antimicrobial peptide Aquiluscidin-1 is used to inhibit the growth of one or more bacteria among Escherichia coli, Salmonella and Staphylococcus aureus.

[0016] Furthermore, the minimum inhibitory concentration of the antimicrobial peptide Aquiluscidin-1 against Escherichia coli is 13.5 μg / mL;

[0017] The minimum inhibitory concentration of the antimicrobial peptide Aquiluscidin-1 against Salmonella is 13.5 μg / mL;

[0018] The minimum inhibitory concentration of the antimicrobial peptide Aquiluscidin-1 against Staphylococcus aureus is 6.75 μg / mL.

[0019] In a sixth aspect, an antimicrobial drug comprising the antimicrobial peptide Aquiluscidin-1 also falls within the protection scope of the present invention.

[0020] Beneficial effects: The present invention provides an antimicrobial peptide Aquiluscidin-1 with good thermal stability, acid-base stability and resistance to endogenous protease degradation, which can significantly inhibit the growth of Enterobacter, Salmonella and Staphylococcus aureus. It has broad application prospects in the fields of food, sanitary products, cosmetics, biological pesticides, biological feed additives or natural food preservatives. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the electrophoresis diagram for PCR amplification verification of the antimicrobial peptide Aquiluscidin-1 in the present invention;

[0022] Figure 2 Graph showing the antibacterial activity of Aquiluscidin-1 in the present invention;

[0023] Figure 3 This is a pH stability diagram of the antimicrobial peptide Aquiluscidin-1 of the present invention;

[0024] Figure 4 This is the thermal stability diagram of the antimicrobial peptide Aquiluscidin-1 of the present invention;

[0025] Figure 5 This is a graph showing the endogenous protease stability of the antimicrobial peptide Aquiluscidin-1 of the present invention. DETAILED DESCRIPTION

[0026] In order to make those skilled in the art better understand the technical scheme of the present invention, the present invention is described in detail below in conjunction with specific embodiments. The experimental methods for which specific conditions are not specified in the following examples are usually based on conventional conditions or the conditions recommended by the manufacturer. The test materials used in the following examples, unless otherwise specified, are purchased from conventional biochemical reagent stores. Unless otherwise specified, percentages and parts are calculated by weight. Unless otherwise defined, all professional and scientific terms used in the text have the same meaning as those familiar to those skilled in the art. In addition, any method and material similar to or equivalent to the described content can be applied to the present invention. The preferred implementation methods and materials described in the text are only for demonstration purposes.

[0027] Some experimental materials and reagents used in this invention:

[0028] Strains and vectors: Escherichia coli BL21 (DE3) was purchased from Beijing Quanshijin Biotechnology Co., Ltd.; pET-28a (+) expression vector was from Wuhan Miaoling Biotechnology Co., Ltd.

[0029] Enzymes and other biochemical reagents: ClonExpress II One Step Cloning Kit was purchased from Nanjing Novozymes Biotechnology Co., Ltd.; Nickel-NTA protein purification resin was purchased from QIAGEN; Ex Taq enzyme was purchased from Takara Biotechnology Co., Ltd.; porcine pepsin, trypsin, and chymotrypsin were purchased from Shanghai Yuanye Biotechnology Co., Ltd.; all other reagents were domestically produced (all available from common biochemical reagent companies).

[0030] Culture medium: LB medium: Peptone 10g, Yeast extract 5g, NaCl 10g, add distilled water to 1000mL, pH natural (about 7.0). Solid medium: add 2.0% (w / v) agar to this solid medium.

[0031] Example 1 Obtaining the Gene Encoding Antimicrobial Peptide Aquiluscidin-1

[0032] The antimicrobial peptide Aquiluscidin (number AP03818), whose amino acid sequence is shown in SEQ ID NO.3, was downloaded from the antimicrobial peptide database (https: / / aps.unmc.edu / AP / ). The amino acid sequence was analyzed to optimize the net charge and hydrophobicity of the antimicrobial peptide Aquiluscidin. S13K, R17L, K24L, G29K, and S31K of the antimicrobial peptide Aquiluscidin were mutated to obtain the antimicrobial peptide Aquiluscidin-1 (amino acid sequence shown in SEQ ID NO.1). The amino acids of the antimicrobial peptide Aquiluscidin-1 were codon-optimized to obtain the amino acids encoding the antimicrobial peptide Aquiluscidin-1 (nucleotide sequence shown in SEQ ID NO.2). The sequence encoding Aquiluscidin-1 was synthesized and ligated into the pMD-19-T cloning vector.

[0033] Experimental Example 2 Construction and transformation of recombinant antimicrobial peptide Aquiluscidin-1 expression vector

[0034] 2.1 PCR amplification was performed using Aquiluscidin-1-pMD-19-T as a template. The amplification reaction system consisted of 3.0 μL of dNTP mixture, 5.0 μL of 10× PCR buffer, 1.0 μL of upstream and downstream primers, 1.0 μL of plasmid, 0.5 μL of Ex Taq enzyme, and double-distilled water to a total of 50.0 μL. The amplification reaction conditions were: denaturation at 95°C for 30 seconds, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 52°C for 30 seconds, and extension at 72°C for 1 minute, followed by a 10-minute incubation at 72°C. The PCR product was gel-cleaved, purified, and stored at −20°C until further use.

[0035] Upstream primer Aquiluscidin-1-F3 (sequence shown in SEQ ID NO.4):

[0036] AGATTGGCGGCGCCACATATAAGCGCTTCAAAAAATTTCTTAAG

[0037] Downstream primer Aquiluscidin-1-R4 (sequence shown in SEQ ID NO.5):

[0038] TGGTGGTGGTGGTGGTGCTCGAGTTAGAACGGAAACTTCACCTTGATG

[0039] 2.2 The SUMO family protein SMT3 (amino acid sequence shown in SEQ ID NO. 6) was downloaded from the NCBI database (https: / / www.ncbi.nlm.nih.gov / ) and its amino acid sequence was codon-optimized. The sequence of the modified coding gene was synthesized and ligated into the pMD-19-T cloning vector. The obtained target fragment was named SUMO (nucleotide sequence shown in SEQ ID NO. 7) and was 303 bp in length.

[0040] 2.3 PCR amplification was performed using SUMO-pMD-19-T as a template. The amplification reaction system consisted of 3.0 μL of dNTP mixture, 5.0 μL of 10× PCR buffer, 1.0 μL of upstream and downstream primers, 1.0 μL of plasmid, 0.5 μL of Ex Taq enzyme, and double-distilled water to a total of 50.0 μL. The amplification reaction conditions were: denaturation at 95°C for 30 seconds, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 1 min 30 seconds; followed by incubation at 72°C for 10 min. The PCR product was recovered from gel, purified, and stored at −20°C until further use.

[0041] Upstream primer SUMO-F1 (sequence shown in SEQ ID NO.8):

[0042] TGGTGCCGCGCGGCAGCCATATGATGAGTGATTCTGAAGTTAATCAA

[0043] Downstream primer SUMO-R2 (sequence shown in SEQ ID NO.9):

[0044] CTTAAAGAATTTTTTGAAGCGCTTATATGTGGCGCCGCCAATCTGTTC

[0045] 2.4 Using the target fragments recovered in 2.1 and 2.3 as templates, primers SUMO-F1 and Aquiluscidin-1-R4 were used to amplify the target fragment SUMO-Aquiluscidin-1 fusion by PCR. The amplification reaction system was as follows: 3.0 μL of dNTP mixture, 5.0 μL of 10× PCR Buffer, 1.0 μL of upstream and downstream primers, 0.5 μL each of the antimicrobial peptide Aquiluscidin-1 gene and SUMO gene, 0.5 μL of Ex Taq enzyme, and double-distilled water to make up the total system to 50.0 μL. The amplification reaction conditions were as follows: 94°C for 5 min; 94°C for 30 sec, 63°C-49°C for 30 sec, 72°C for 1 min 30 sec, for a total of 28 cycles, with the annealing temperature decreasing by 0.5°C in each cycle; 94°C for 30 sec, 49°C for 30 sec, 72°C for 1 min 30 sec, for a total of 7 cycles; finally, 72°C for 10 min; 4°C for 10 min. The PCR product was recovered on gel, purified, and stored at -20°C for later use.

[0046] 2.5 The expression vector pET-28a(+) was digested with restriction endonucleases (NdeI and XhoI). The gel-purified SUMO-Aquiluscidin-1 and the digestion products of pET-28a(+) were ligated using the ClonExpress II One Step Cloning Kit recombinase to obtain the recombinant plasmid SUMO-Aquiluscidin-1-pET-28a(+); the nucleotide sequence of the recombinant SUMO-Aquiluscidin-1 is shown in SEQ ID NO. 10.

[0047] 2.6 The recombinant plasmid SUMO-Aquiluscidin-1-pET-28a(+) was transformed into Escherichia coli BL21(DE3) by heat shock to obtain the recombinant strain BL21(DE3) / SUMO-Aquiluscidin-1 containing SUMO-Aquiluscidin-1.

[0048] Experimental Example 3 Preparation of recombinant antimicrobial peptide Aquiluscidin-1

[0049] 3.1 The recombinant strain BL21(DE3) / SUMO-Aquiluscidin-1 obtained in Example 2 was inoculated into LB (containing 50 μg / mL kanamycin) culture medium at an inoculum size of 2.0% and activated by shaking at 37°C and 200 rpm / min for 12-16 h.

[0050] 3.2 The activated bacterial solution in 3.1 was inoculated into fresh LB (containing 50 μg / mL kanamycin) culture medium at a 2.0% inoculum volume, and cultured in a shaking incubator at 37°C and 200 rpm / min for about 3-4 h (OD 600nm After the culture temperature reaches about 0.7, IPTG was added to a final concentration of 0.6 mM for induction, and the culture was continued in a shaking incubator at 16° C. and 150 rpm / min for about 20 h to induce the production of recombinant protein.

[0051] 3.3 Collect the cells by centrifugation at 8000 rpm / min for 10 min at 4°C. Resuspend the cells in an appropriate amount of pH 7.0 citric acid-phosphate buffer and disrupt them by ultrasonication in a cold water bath. Centrifuge the concentrated intracellular crude enzyme solution at 13000 rpm / min for 15 min. Remove the supernatant and affinity purify the target protein using Nickel-NTA Agarose and 0-500 mM imidazole.

[0052] The SDS-PAGE results of the purified protein are as follows Figure 1 As shown in the figure, M is a protein marker and SA-1 is a recombinant fusion antimicrobial peptide Aquiluscidin-1. The results showed that the recombinant fusion antimicrobial peptide Aquiluscidin-1 was expressed and purified, and the product was a single band.

[0053] Experimental Example 4 Investigation of the antibacterial activity of recombinant antimicrobial peptide Aquiluscidin-1

[0054] The antibacterial activity of the recombinant antimicrobial peptide Aquiluscidin-1 was determined using the inhibition zone method. The specific method is as follows: (1) Escherichia coli K88, Escherichia coli K99, Salmonella choleraesuis, Salmonella enteritidis gallinarum and Staphylococcus aureus were inoculated into 20 mL of liquid culture medium and cultured overnight at 37°C and 200 rpm / min in a shaking incubator; (2) 200 μL of the overnight cultured bacteria were inoculated into 20 mL of sterile culture medium and cultured at 37°C and 200 rpm / min for 0.5-1 h to a value of OD 600 nm At around 0.1, the bacterial cell concentration reaches about 1×10 8 CFU / mL, which is the logarithmic growth phase or the early logarithmic growth phase; (3) Dip a small amount of bacterial liquid with a sterile cotton swab and spread it on LB solid culture medium; (4) Use tweezers to pick up a sterilized Oxford cup and place it evenly on the plate with the indicator bacteria, and draw 50 μL of recombinant antimicrobial peptide Aquiluscidin-1 sample into the Oxford cup, and use sterile water as a control; (5) After loading the sample, place the plate horizontally in a 37°C incubator and culture for 12 hours to observe whether there is an inhibition zone formed.

[0055] The results showed that the recombinant antimicrobial peptide Aquiluscidin-1 had an inhibitory effect on Escherichia coli, Staphylococcus aureus and Salmonella ( Figure 2 ), while the sterile water in the control group had no inhibition zone, and the inhibition zone sizes of 40 μg / mL recombinant antimicrobial peptide Aquiluscidin-1 against Escherichia coli K88, Escherichia coli K99, Salmonella choleraesuis, Salmonella enteritidis and Staphylococcus aureus reached 11.00 mm, 13.00 mm, 14.00 mm, 12.00 mm and 16.00 mm, respectively.

[0056] Determination of the minimum inhibitory concentration (MIC) of the recombinant antimicrobial peptide Aquiluscidin-1: The specific method for determining MIC is the microdilution method: the indicator bacteria are cultured in LB liquid medium to the logarithmic growth phase, and each bacterial cell is collected and diluted to a bacterial cell concentration of 1×10 8 CFU / mL is reserved for future use. This step involves preparing a bacterial suspension. In the first column of a 96-well plate, the purified antimicrobial peptide aquiluscidin-1 solution is mixed with LB liquid culture medium in equal amounts to a starting concentration of 200 μg / mL. Serial two-fold dilutions are then performed in subsequent columns to form a concentration gradient. Equal amounts of the diluted bacterial suspension are added to each sample in the 96-well plate concentration gradient and incubated in a 37°C incubator for 16 hours. After incubation, the turbidity of each well is visually inspected. The minimum concentration that results in clear wells is the MIC of the antimicrobial peptide aquiluscidin-1 against each bacterium. The results, as shown in Table 1, show that the recombinant antimicrobial peptide aquiluscidin-1 exhibits strong inhibitory activity against all three bacteria. The inhibitory activity against Gram-positive bacteria is even stronger, with an MIC of 6.75 μg / mL against Staphylococcus aureus.

[0057] Table 1 Minimum inhibitory concentration of recombinant antimicrobial peptide Aquiluscidin-1 against different bacteria

[0058] Bacterial species MIC (μg / mL) Escherichia coli K88 13.5 Escherichia coli K99 13.5 Salmonella choleraesuis 13.5 Salmonella enterica serovar Enteritidis 13.5 Staphylococcus aureus 6.75

[0059] Example 4: Stability of recombinant antimicrobial peptide Aquiluscidin-1 at different pH values

[0060] The recombinant antimicrobial peptide Aquiluscidin-1 samples were placed in different buffer solutions with pH values of 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0 and 11.0 for 2 hours. The samples treated with different pH values were used as test samples, and the untreated samples were used as controls to determine the bactericidal rate of Staphylococcus aureus (see Figure 3The specific method for determining the bactericidal rate of Staphylococcus aureus is as follows: Staphylococcus aureus was cultured to the logarithmic growth phase, and the cells were collected by centrifugation at 10000 rpm / min for 3 minutes. The cells were resuspended in an equal amount of 0.1M PBS buffer, centrifuged, and the supernatant was removed. The above steps were repeated 3 times, and the cells were finally diluted with PBS buffer to a concentration of 1×10 8 CFU / mL bacterial suspension was prepared for later use; the antimicrobial peptide samples treated with different pH values were mixed with the diluted Staphylococcus aureus suspension and lysed at 37°C for 1 hour. The viable bacteria in the lysed bacterial solution were counted using the dilution plate method; the untreated sample was used as the control, and the bactericidal rate of Staphylococcus aureus after treatment with different pH values for 2 hours was calculated; bactericidal rate (%) = number of viable bacteria in the treatment group / total number of colonies in the control group * 100%.

[0061] like Figure 3 As shown in the results, the bactericidal rate of recombinant antimicrobial peptide Aquiluscidin-1 against Staphylococcus aureus had almost no significant change after treatment with different pH values. After 2 hours of treatment at each pH value, the bactericidal rate against Staphylococcus aureus could still reach more than 88.7%, indicating that the recombinant antimicrobial peptide Aquiluscidin-1 has good acid-base tolerance.

[0062] Example 5 Investigation of the thermal stability of the recombinant antimicrobial peptide Aquiluscidin-1

[0063] The recombinant antimicrobial peptide Aquiluscidin-1 samples were heated at 25°C, 37°C, 50°C, 70°C, 90°C and 95°C for 30 min, and the heat-treated samples were used as test samples, while the unheat-treated samples were used as controls to determine the bactericidal rate of Staphylococcus aureus (see Figure 4 ).

[0064] like Figure 4 As shown in the results, the bactericidal rate of the recombinant antimicrobial peptide Aquiluscidin-1 against Staphylococcus aureus had almost no significant change after treatment at different temperatures. After treatment at a high temperature of 95°C for 30 minutes, the bactericidal rate against Staphylococcus aureus still remained at 88.37%, indicating that the recombinant antimicrobial peptide Aquiluscidin-1 has good thermal stability and can withstand the high temperature treatment process of industrial processing.

[0065] Example 6 Investigation of the Endogenous Protease Stability of Recombinant Antimicrobial Peptide Aquiluscidin-1

[0066] The recombinant antimicrobial peptide Aquiluscidin-1 samples were placed in a buffer solution containing 737.5 U / mL porcine pepsin, 760.0 U / mL trypsin, and 95.6 U / mL chymotrypsin for 4 hours. The samples treated with proteases were used as test samples, and the untreated samples were used as controls to determine the bactericidal rate of Staphylococcus aureus (see Figure 5 ).

[0067] like Figure 5 As shown in the data, after being treated with 737.5 U / mL of porcine pepsin, 760.0 U / mL of trypsin and 95.6 U / mL of chymotrypsin for 4 hours, the bactericidal rate of the recombinant antimicrobial peptide Aquiluscidin-1 against Staphylococcus aureus was still maintained above 88.8%, indicating that endogenous proteases in the porcine gastrointestinal tract have no effect on the bactericidal rate of the recombinant antimicrobial peptide Aquiluscidin-1.

[0068] Finally, it should be noted that the above description is only a preferred embodiment of the present invention. Under the guidance of the present invention, those skilled in the art can make various similar expressions without violating the purpose and claims of the present invention. Such changes fall within the scope of protection of the present invention.

Claims

1. An antimicrobial peptide Aquiluscidin-1, characterized in that It is a protein composed of the amino acids shown in SEQ ID NO.

1.

2. The gene encoding the antimicrobial peptide Aquiluscidin-1 according to claim 1, characterized in that: The nucleotide sequence of the coding gene is shown in SEQ ID NO.

2.

3. A recombinant vector, expression cassette, transgenic line or recombinant bacterium containing the gene according to claim 2.

4. A method for preparing antimicrobial peptide Aquiluscidin-1, characterized in that: The coding gene fragment of SEQ ID NO. 2 was amplified by fusion PCR reaction and fused with SUMO fragment to construct a recombinant expression vector of antimicrobial peptide Aquiluscidin-1. The recombinant expression vector was introduced into host cells to obtain recombinantly expressed antimicrobial peptide Aquiluscidin-1.

5. The method according to claim 4, characterized in that The primer set for amplifying the gene fragment encoding the sequence as shown in SEQ ID NO.2 is: the upstream primer is shown in SEQ ID NO.4, and the downstream primer is shown in SEQ ID NO.

5.

6. The method according to claim 4, characterized in that The recombinant expression vector is selected from one or more of an Escherichia coli expression vector, a yeast expression vector, a Bacillus subtilis expression vector, a lactic acid bacteria expression vector, a Streptomyces expression vector, a phage vector, a filamentous fungus expression vector, a plant expression vector, an insect expression vector, or a mammalian cell expression vector; and / or the host cell is selected from one of an Escherichia coli host cell, a yeast host cell, a Bacillus subtilis host cell, a lactic acid bacteria host cell, an actinomycete host cell, a filamentous fungus host cell, an insect cell, and a mammalian cell.

7. The method according to claim 4 or 6, characterized in that The recombinant expression vector is selected from pET-28a(+), and / or The host cell is selected from BL21 (DE3).

8. Use of the antimicrobial peptide Aquiluscidin-1 according to claim 1 in the preparation of foods, sanitary products, cosmetics, biological pesticides, biological feed additives or natural food preservatives.

9. The use according to claim 7, characterized in that Used to inhibit the growth of one or more bacteria among Escherichia coli, Salmonella and Staphylococcus aureus; And / or, the minimum inhibitory concentration of the antimicrobial peptide Aquiluscidin-1 against Escherichia coli is 13.5 μg / mL; And / or, the minimum inhibitory concentration of the antimicrobial peptide Aquiluscidin-1 against Salmonella is 13.5 μg / mL; And / or, the minimum inhibitory concentration of the antimicrobial peptide Aquiluscidin-1 against Staphylococcus aureus is 6.75 μg / mL.

10. An antibacterial drug, characterized in that: The invention comprises the antimicrobial peptide Aquiluscidin-1 according to claim 1.

Images