Bio-control bacterium for protaetia brevitarsis and application of bio-control bacterium

By using the spore suspension mixing method of Mortierella variants JSAFC 2557, the problem of pesticide residues in chemical pesticides for controlling the white pesticides is solved, and efficient and environmentally friendly larvae control effects are achieved, and it is suitable for pollution-free vegetables and green food production.

CN120484972APending Publication Date: 2025-08-15JIANGSU POLYTECHNIC COLLEGE OF AGRI & FORESTRY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510626075.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-15
Publication Date
2025-08-15

AI Technical Summary

Technical Problem

The existing chemical pesticide prevention and control methods for white star flower beetle have pesticide residue problems, making it difficult to effectively prevent and control white star flower beetle larvae during the maturity of the fruit. It is not friendly to the environment and cannot meet the production needs of pollution-free vegetables and green foods.

Method used

The spore suspension of Mortierella variants JSAFC 2557 is used to spray it in the soil by mixing soil to inhibit the growth of the larvae of White Star Flower, and to use its high lethality and environmental protection characteristics to avoid the use of chemical pesticides.

Benefits of technology

It significantly improves the mortality rate of the larvae of the White Star Flower Tortoise, is environmentally friendly and pollution-free, and can reduce the harm of the White Star Flower Tortoise from the source. It is suitable for pollution-free vegetables and green food production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120484972A_ABST
    Figure CN120484972A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of plant insect pest biocontrol, and discloses a protaetia brevitarsis biocontrol bacterium and application thereof, the bacterial strain number of the protaetia brevitarsis biocontrol bacterium is JSAFC 2557, the protaetia brevitarsis biocontrol bacterium is preserved in China General Microbiological Culture Collection Center (CGMCC), the preservation time is December 9, 2024, the preservation number is CGMCC No.41691, and the protaetia brevitarsis biocontrol bacterium is classified and named as Mortierella varians. The spores of the protaetia brevitarsis biocontrol bacterium JSAFC 2557 have strong pathogenicity to protaetia brevitarsis larvae, are environment-friendly and pollution-free, and are not easy to generate drug resistance. Therefore, the strain can be applied to prevention and treatment of protaetia brevitarsis larvae, can relieve harm of protaetia brevitarsis adults from the source, and has good development potential and application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms and relates to a biocontrol bacterium for white-spotted flower beetles and an application thereof. Background Art

[0002] The white-spotted flower beetle (Protaetia brevitarsis) belongs to the Scarabaeidae family, Cetoninae subfamily, Coleoptera order. It has a wide distribution in my country, including North China, Northeast China, and the Huanghuaihai region. Its larvae live a saprotrophic life in manure piles and humus-rich soils, overwintering as larvae in October until pupation at the end of April, followed by partial emergence in May. The white-spotted flower beetle primarily injures its adults, with a wide host range. It is an omnivorous insect that feeds on fruit trees, vegetables, flowers, crops, forest trees, weeds, and Chinese medicinal herbs. It feeds on the fruits and flowers of crops such as wheat, corn, and sunflowers. It also feeds on vegetables such as tomatoes, and causes significant damage to fruits such as apples, peaches, grapes, and plums. It also feeds on the tender shoots of willows, elms, and poplars, sucking the sap from their trunks. The damage caused by this insect to grapes can not only cause direct impact by feeding, but also easily cause secondary diseases such as sour rot in the affected parts, thus seriously affecting the yield and quality of grapes.

[0003] Currently, methods for controlling the white-spotted flower beetle include manual capture, centralized trapping, manure pile treatment, adult repellent, and chemical control using organophosphate and carbamate pesticides during the peak infestation period. However, the white-spotted flower beetle primarily infests during fruit ripening, and chemical control easily produces pesticide residues. With increasing environmental awareness, especially with the current push to develop pollution-free vegetables and green food production, stricter regulations on pesticide use are being implemented. White-spotted flower beetle larvae and pupae live in the soil. Taking advantage of this characteristic and controlling the beetle at the larval stage could mitigate the damage caused by the beetle at its source and avoid many of the drawbacks of chemical control. Screening for biocontrol fungi against the white-spotted flower beetle provides a theoretical basis for developing microbial insecticides for the white-spotted flower beetle and offers a technical approach for its control. Summary of the Invention

[0004] The invention aims to provide a biocontrol bacterium for white-spotted flower beetle and application thereof in inhibiting the growth of white-spotted flower beetle.

[0005] Technical solution: The strain number of the white-spotted flower beetle biocontrol bacteria described in the present invention is JSAFC 2557, which is deposited in the General Microbiology Center of the China Culture Collection Administration, the preservation time is December 9, 2024, the preservation number is CGMCC No.41691, and the classification name is Mortierella varians.

[0006] Furthermore, the nucleotide sequence of the ITS gene of the white-spotted flower beetle biocontrol bacteria is shown in SEQ ID NO.1.

[0007] The active ingredient of the biocontrol agent for white-spotted flower beetles of the present invention is the above-mentioned biocontrol bacteria for white-spotted flower beetles or a spore suspension thereof.

[0008] The present invention also provides the use of the biocontrol bacteria and biocontrol agent of white-spotted flower beetle in inhibiting the growth of white-spotted flower beetle.

[0009] Furthermore, the application is specifically by spraying the spore suspension of the biocontrol bacteria Mortierella varians JSAFC 2557 on the larvae of the white-spotted flower beetle.

[0010] Furthermore, the spore suspension is prepared by: (1) inoculating Mortierellavarians JSAFC 2557, a biocontrol bacterium of white-spotted flower beetles, on a PDA culture medium to prepare a culture; (2) placing the culture prepared in step (1) in a Tween-80 solution, filtering out the spores, and preparing a biocontrol agent for white-spotted flower beetles.

[0011] Furthermore, the culture condition in step (1) is culture at 25° C. in the dark for 5-7 days.

[0012] Furthermore, the spore concentration of the white star flower beetle biocontrol agent is 10 7 pieces / mL.

[0013] Furthermore, the concentration of the Tween-80 solution in step (2) is 0.1%.

[0014] Furthermore, the amount of the spore suspension of the biocontrol bacteria of the white-spotted flower beetle added to the soil is 2 mL / 20 g soil.

[0015] Beneficial Effects: Compared with existing technologies, the present invention has the following significant advantages: A biocontrol strain, Mortierella varians, was isolated and purified from soil in Shangri-La, Yunnan. This strain, which can be used as a biocontrol strain against Mortierella varians, exhibits a high mortality rate against Mortierella varians, is environmentally friendly and non-toxic, and can significantly inhibit the survival of Mortierella varians larvae. This has significant implications for the future development of biocontrol agents for Mortierella varians. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 : Colony morphology of the white star flower beetle biocontrol bacterium Mortierella varians JSAFC 2557 of the present invention;

[0017] Figure 2 :Phylogenetic tree of the biocontrol fungus Mortierella varians JSAFC 2557 against white flower beetles;

[0018] Figure 3 : The effect of the biocontrol bacteria Mortierella varians JSAFC 2557 of the present invention on the growth of white-spotted flower beetle larvae. DETAILED DESCRIPTION

[0019] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0020] As described in the present invention, the term "biocontrol bacteria" refers to beneficial microorganisms that can control plant pests, mainly bacteria, fungi, and actinomycetes.

[0021] Example 1: Isolation and Identification of Mortierella varians JSAFC 2557

[0022] 1. Isolation of Mortierella varians JSAFC 2557, a biocontrol bacterium against white flower beetles

[0023] JSAFC 2557 was isolated from soil in Shangri-La, Yunnan. The bacterial colony characteristics are as follows: when cultured on PDA plate medium, the colony grows rapidly and grows close to the substrate. Its surface color is light brown and its bottom color is orange-red ( Figure 1 ).

[0024] 2. Molecular Biological Identification of Mortierella varians JSAFC 2557, a Biocontrol Bacteria against White Flower Beetles

[0025] (1) The genomic DNA of strain JSAFC 2557 was extracted using a kit from TIANGEN.

[0026] (2) Amplification of the ITS gene from genomic DNA. DNA amplification was performed in a 30 μL reaction volume, containing 15 μL 2× EasyTaq PCR SuperMix (+ dye), 1 μL each of the primer pairs ITS1 (SEQ ID NO. 2: 5'-CTTGGTCATTTAGAGGAAGTAA-3') and ITS4 (SEQ ID NO. 3: 5'-TCCTCCGCTTATTGATATGC-3') (10 μM), 2 μL template DNA, and 11 μL ddH2O. The PCR amplification program conditions were as follows: 94°C denaturation for 5 min; 35 cycles of denaturation at 94°C for 30 s, annealing at 54°C for 45 s, and extension at 72°C for 60 s; and a final extension at 72°C for 10 min.

[0027] (3) The amplified PCR products were subjected to 1% agarose gel electrophoresis and observed under ultraviolet light. The PCR products with target bands were sent to Nanjing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were as follows: the ITS gene sequence of strain JSAFC 2557 was SEQ ID NO. 1 (TCCACCTTGTGTGCAATGTCAGCCGTTTTCTTTA TGAAAGCGGCCAAACATCAACTTATTTTTTAACTGTCAGTCTGAAAACTATTATGAATAAACAATTCAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCTCTTTGGTATTCCGAAGAGCATGCTTGTTTGAGTATCAGTAAACACCTCAAAGCCTTCAAT TCAGTTTGGAAGTTTTGGACTTGAGCAATCCCAACACCAGTCTTGCGACTGGCGGAGGGCTGCTTGAAATGCAGGTGCAGCTGGACATTCCTGAGCTATAAGCATATTTATTTAGTCCCGTCAAACGGATTATTACTTTTGCTGCAGCTAACATAAAGGGAGTCTGACCGTATTGGCTGACTGATGCAGGATTTCACAAGAGCTGGCAACAGCTTCTTGTAAAACTCGATCTCAAATCAAGTAAGAC).

[0028] (4) Compare the SEQ ID NO.1 sequence on the NCBI database website and build a phylogenetic tree. Figure 2 The comparison results are shown in Table 1. According to the results in Table 1, it can be inferred that the biocontrol bacteria JSAFC 2557 of the present invention is Mortierella varians, and the strain was deposited in the General Microbiology Center of China Culture Collection of Microorganisms on December 9, 2024, with the deposit number CGMCC No.41691, and the classification name is Mortierella varians JSAFC 2557. The deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Beichen 1st Courtyard, Chaoyang District, Beijing.

[0029] Table 1 Sequence alignment results of SEQ ID NO.1

[0030]

[0031] Example 2: Inhibitory effect of Mortierella varians JSAFC 2557 on the growth of Mortierella varians

[0032] 1. Preparation of spore suspension

[0033] (1) JSAFC 2557 was inoculated on PDA medium to prepare a culture. The culture conditions were: 25°C in the dark for 5-7 days;

[0034] (2) Use an inoculation needle to pick up the bacterial mass in the culture and place it in a Tween-80 solution (0.1%) and shake it thoroughly. After shaking, filter out the spores and adjust the concentration to prepare a biocontrol agent for white star flower beetles. The spore concentration of the biocontrol agent for white star flower beetles is 10 7 pieces / mL.

[0035] 2. Inoculation of insects

[0036] Use soil mixing method to mix 2mL of 10 7 20 g of soil containing a spore suspension of JSAFC 2557 containing 10 spores / mL was transferred to a small culture cup, and then healthy mature larvae of the white-spotted flower beetle were transferred to the culture cup (height and width: 4 cm×4.5 cm).

[0037] Three replicates, each with 15 test insects, were used as a control. All test insects were cultured in an incubator at 25°C, with an L / D ratio of 16 h / 8 h and a relative humidity of 80%. After treatment, the larvae were observed for color changes, mortality, and infection, and the data were recorded every 24 hours.

[0038] The insect stages of the white-spotted flower beetle that died from infection with JSAFC 2557, such as Figure 3The statistical results of the infection mortality of white-spotted flower beetles are shown in Table 2. As shown in Table 2, under the culture condition of 25°C, after the white-spotted flower beetle larvae were inoculated by the soil mixing method, the cumulative mortality of the larvae was significantly higher than that of the control group; the cumulative mortality from 13 to 19 days showed a rapid upward trend, until on the 25th day, the cumulative mortality of JSAFC 2557 against white-spotted flower beetle larvae reached 100%, and the toxicity regression equation was y = 0.174x - 2.566 (R 2 =0.934), LT 50 The value is 14.76 days, and the 95% confidence interval is 14.23 to 15.31 days.

[0039] Table 2 Pathogenicity of JSAFC 2557 to the larvae of white-spotted flower beetle (%)

[0040]

[0041] In summary, the JSAFC 2557 provided by the present invention is a biocontrol fungus that can be used to control white-spotted flower beetles. It has the characteristics of strong pathogenicity to white-spotted flower beetle larvae, is environmentally friendly and pollution-free, and is not prone to drug resistance. It can be widely used for the control of white-spotted flower beetle larvae before they emerge from the ground.

Claims

1. A biocontrol bacterium for white-spotted flower beetles, characterized in that: The strain number of the white-star flower beetle biocontrol bacteria is JSAFC 2557, which is deposited in the General Microbiology Center of the China Culture Collection Administration Committee on December 9, 2024, with a deposit number of CGMCC No.41691 and a classification name of Mortierella varians.

2. The biocontrol bacteria for white-spotted flower beetles according to claim 1, characterized in that The nucleotide sequence of the ITS gene of the white-spotted flower beetle biocontrol bacterium is shown in SEQ ID NO.

1.

3. A biocontrol agent for white-spotted flower beetles, characterized in that: The active ingredient of the biocontrol agent for white-spotted flower beetles is the biocontrol bacteria for white-spotted flower beetles or a spore suspension thereof according to any one of claims 1 to 2.

4. Use of the biocontrol bacterium of white-spotted flower beetle according to any one of claims 1 to 2 or the biocontrol agent of white-spotted flower beetle according to claim 3 in inhibiting the growth of white-spotted flower beetle.

5. The use according to claim 4, characterized in that The application is specifically to spray the spore suspension of Mortierella varians JSAFC 2557 according to any one of claims 1 to 2 on the larvae of the white-starred flower beetle, or to add the spore suspension of the biocontrol bacteria of the white-starred flower beetle to the soil containing the larvae of the white-starred flower beetle.

6. The use according to claim 5, characterized in that The preparation method of the spore suspension is: (1) Mortierella varians JSAFC 2557, a biocontrol bacterium for white flower beetles, was inoculated on PDA medium to prepare a culture; (2) placing the culture obtained in step (1) in a Tween-80 solution, filtering out the spores, and preparing a biocontrol agent for the white-spotted flower beetle.

7. The use according to claim 6, characterized in that: The culture conditions described in step (1) are: culture at 25° C. in the dark for 5-7 days.

8. The use according to claim 6, characterized in that: The spore concentration of the white star flower beetle biocontrol agent in step (2) is 10 7 pieces / mL.

9. The use according to claim 6, characterized in that: The concentration of the Tween-80 solution in step (2) is 0.1%.

10. The use according to claim 5, characterized in that The amount of the spore suspension of the white-star flower beetle biocontrol bacteria added to the soil is 2 mL / 20 g soil.