Hyphantria cunea biocontrol bacterium and application thereof

Abstract

The invention belongs to the technical field of plant insect pest biocontrol, and discloses a hyphantria cunea biocontrol bacterium and application thereof, the hyphantria cunea biocontrol bacterium has a strain number of JSAFC 2084, is preserved in China General Microbiological Culture Collection Center (CGMCC), has a preservation time of September 23, 2024, has a preservation number of CGMCC No.41563, and is classified and named Saksenaea sp. The hyphantria cunea biocontrol bacterium strain provided by the invention can obviously inhibit the survival activity of hyphantria cunea, the death rate of hyphantria cunea larvae can reach 100% after 7 days of treatment, and the hyphantria cunea biocontrol bacterium strain can be used for preventing and controlling hyphantria cunea, is typical biological prevention and control, can avoid the problems of drug resistance, environmental pollution and the like caused by chemical prevention and control, and has a relatively good application prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms and relates to a biocontrol bacterium for the American white moth and an application thereof. Background Art

[0002] The gypsy moth (Hyphantria cunea) has become a global plant quarantine pest that severely damages trees. The main characteristics of the gypsy moth's damage are its omnivorous diet, large reproductive output, strong adaptability, wide transmission routes, and serious nuisance to residents. Its larvae feed on plant leaves, and in severe cases, they can consume all the leaves in a short period of time, causing huge losses to forestry and agricultural production. The gypsy moth is highly adaptable to its environment and can pupate prematurely when the environment deteriorates. Mature larvae are also extremely resistant to starvation and can continue to reproduce and cause damage normally even after 15 days without feeding. The gypsy moth also seriously disturbs residents. When the population is large, mature larvae will enter villages and homes, even crawling onto dining tables and kangs, seriously affecting people's normal lives. The damage is very prominent, and effective prevention and control measures are needed to control its spread and damage.

[0003] Therefore, finding a green control technology with effective and long-lasting efficacy against the gypsy moth is an urgent task. Biological control has become a research hotspot, and the discovery and selection of highly targeted and effective bacterial strains is a crucial step in this process. Currently, the main pathogens used in pest control include Beauveria bassiana, Metarhizium anisopliae, Verticillium fasciatum, and Paecilomyces oxysporum. However, the main applied research focuses on Beauveria bassiana and Metarhizium anisopliae, while the development and utilization of other gypsy moth biocontrol agents is relatively limited. Summary of the Invention

[0004] The invention aims to provide a biocontrol bacterium for cunea gypsy moth and its application in inhibiting the growth of cunea gypsy moth.

[0005] Technical solution: The strain number of the American white moth biocontrol bacteria of the present invention is JSAFC 2084, which is deposited in the General Microorganism Center of the China Culture Collection Administration Committee for Microorganisms. The deposit time is September 23, 2024, and the deposit number is CGMCC No.41563. The classification name is Saksenae asp.

[0006] Furthermore, the nucleotide sequence of the ITS gene of the gypsy moth biocontrol bacteria is shown in SEQ ID NO.1.

[0007] The active ingredient of the biocontrol fungus agent of the present invention is the above-mentioned gypsy moth biocontrol fungus or its spore suspension.

[0008] The invention discloses an application of the gypsy moth biocontrol bacteria and the gypsy moth biocontrol agent in inhibiting the growth of the gypsy moth.

[0009] Furthermore, the application is specifically by spraying the spore suspension of the above-mentioned gypsy moth biocontrol bacteria on the gypsy moth larvae or the plants they feed on.

[0010] Furthermore, the spore suspension is prepared by: (1) inoculating the American white moth biocontrol bacterium Saksenae asp. JSAFC 2084 on a PDA culture medium to prepare a culture; (2) placing the culture prepared in step (1) in a Tween-80 solution, filtering out the spores, and preparing the American white moth biocontrol agent.

[0011] Furthermore, the culture condition in step (1) is culture at 25° C. in the dark for 5-7 days.

[0012] Furthermore, the spore concentration of the gypsy moth biocontrol agent in step (2) is 10 7 pieces / mL.

[0013] Furthermore, the concentration of the Tween-80 solution in step (2) is 0.1%.

[0014] Furthermore, the spore suspension is applied at an amount of 7 mL / time / day for 7 days.

[0015] Beneficial Effects: Compared with existing technologies, the present invention has the following significant advantages: A Saksenaea sp. biocontrol bacterium, isolated and purified from soil in Wenzhou, Zhejiang Province, was obtained. This strain, which can be used as a biocontrol agent against the cunning moth, exhibits a high mortality rate, is environmentally friendly and non-toxic, and can significantly inhibit the survival of cunning moth larvae. This has significant implications for the future development of biocontrol agents for the control of cunning moths. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 : Colony morphology of the American white moth biocontrol bacterium Saksenaea sp. JSAFC 2084 of the present invention;

[0017] Figure 2 :Phylogenetic tree of Saksenaea sp. JSAFC 2084, a biocontrol agent against the white moth;

[0018] Figure 3 : The effect of the biocontrol bacterium Saksenaea sp. JSAFC 2084 of the present invention on the growth of larvae of the gypsy moth;

[0019] Figure 4 Shown is a graph showing the relationship between the number of days of inoculation of the biocontrol strain Saksenaea sp. JSAFC 2084 of the present invention and the survival activity of the larvae of the cuneiform moth. DETAILED DESCRIPTION

[0020] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0021] As described in the present invention, the term "biocontrol bacteria" refers to beneficial microorganisms that can control plant pests, mainly bacteria, fungi, and actinomycetes.

[0022] Example 1: Isolation and identification of the biocontrol bacterium Saksenaea sp. JSAFC 2084 against the white moth

[0023] 1. Isolation of Saksenaea sp. JSAFC 2084, a biocontrol agent for the American white moth

[0024] JSAFC 2084 was isolated from soil in Wenzhou, Zhejiang Province. The bacterial colony characteristics are as follows: when cultured on PDA plate, the colony is cotton-like, with a white surface and a light yellow bottom. Figure 1 ).

[0025] 2. Molecular biological identification of Saksenaea sp. JSAFC 2084, a biocontrol agent against the white moth

[0026] (1) The genomic DNA of strain JSAFC 2084 was extracted using a kit from TIANGEN.

[0027] (2) Amplification of the ITS gene from genomic DNA. DNA amplification was performed in a 30 μL reaction volume, containing 15 μL 2× EasyTaq PCR SuperMix (+ dye), 1 μL each of the primer pairs ITS1 (SEQ ID NO. 2: 5'-CTTGGTCATTTAGAGGAAGTAA-3') and ITS4 (SEQ ID NO. 3: 5'-TCCTCCGCTTATTGATATGC-3') (10 μM), 2 μL template DNA, and 11 μL ddH2O. The PCR amplification program conditions were as follows: 94°C denaturation for 5 min; 35 cycles of denaturation at 94°C for 30 s, annealing at 54°C for 45 s, and extension at 72°C for 60 s; and a final extension at 72°C for 10 min.

[0028] (3) The amplified PCR products were subjected to 1% agarose gel electrophoresis and observed under ultraviolet light. The PCR products with target bands were sent to Nanjing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results showed that the ITS gene sequence of strain JSAFC 2084 was SEQ ID NO. 1 (CATCCTTTACTGTGCATTGTATCCATTATCAATTATTTATACACAATTGCTTCAT TGGACTGATAAACAAAGATTGTAACATAATCGAAAGGTTATAAAACAACTTTCAGCAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCAAATTGCGATAATTAGTGTGAATTGCAGACAGTGAATCATCGAGTCTTTGAACGCATCTTGCACTCACTGGTTATACCGGTGAGT ACGCCTGTTTCAGTATCATAAAGTACACCCAACCAAAATTTTTTTTGAATTGGGGATATGAGCGTCTATTTTGCTTTTCATCTGAAGAACAAAACGCTTGAAATGAAGGGCAAAGATCATATTACTTGACTTGGCTTAATAGAATCTGGTCTAGGTTTACCAGTGAGCCTTGTTATTT).

[0029] (4) Compare the SEQ ID NO.1 sequence on the NCBI database website and build a phylogenetic tree. Figure 2 The comparison results are shown in Table 1. According to the results in Table 1, it can be inferred that the biocontrol bacteria JSAFC 2084 of the present invention is Saksenaea sp., and the strain was deposited in the General Microbiology Center of the China Culture Collection of Microorganisms on September 23, 2024, with the deposit number CGMCC No.41563, and the classification name is Saksenaea sp. JSAFC 2084. The deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Beichen 1st Courtyard, Chaoyang District, Beijing.

[0030] Table 1 Sequence alignment results of SEQ ID NO.1

[0031]

[0032] Example 2: Inhibitory Effect of Saksenaea sp. JSAFC 2084 on the Growth of the Fallen Moth 1. Preparation of Spore Suspension

[0033] (1) JSAFC 2084 was inoculated on PDA medium to prepare a culture. The culture conditions were: 25°C in the dark for 5-7 days;

[0034] (2) Use an inoculation needle to pick up the bacterial mass in the culture and place it in a Tween-80 solution (0.1%) and shake it thoroughly. After shaking, filter out the spores and adjust the concentration to prepare the American white moth biocontrol agent. The spore concentration of the American white moth biocontrol agent is 10 7 pieces / mL.

[0035] 2. Inoculation of insects

[0036] Second- and third-instar larvae of the cuneiform moth were purchased from the Institute of Forest Ecology, Environment, and Protection, Chinese Academy of Forestry. Larvae younger than third instar were reared in a climate chamber (temperature 25°C, humidity 60-70%, light-dark ratio 16:8) and provided with surface-sterilized mulberry leaves daily. Larvae reaching third instar were used in bioassays.

[0037] 3. Pathogenicity determination

[0038] (1) Immersion method: Healthy gypsy moth larvae were immersed in the gypsy moth biocontrol agent for 20 seconds. The immersed gypsy moths were transferred to sterile culture boxes (one treated gypsy moth was placed in each box) and fed with fresh mulberry leaves (the mulberry leaves were also immersed in the spore suspension for 10 seconds). In the experiment, gypsy moths and mulberry leaves treated with 0.01% Tween-80 solution were used as controls and placed in a constant temperature incubator at 25°C. The mortality of gypsy moths was observed and recorded within 7 days.

[0039] like Figure 4 As shown in the figure, the survival rate of gypsy moth larvae treated with the gypsy moth biocontrol agent for 7 days was significantly lower than that of the control group; the gypsy moth biocontrol agent of the present invention showed strong lethal activity against gypsy moth larvae, and the survival activity of gypsy moths was reduced to 0% after 7 days of treatment. Figure 3 shown.

[0040] (2) Pot experiment

[0041] A pot with a diameter of 12 cm was selected, and 30 healthy and uniform-sized third-instar larvae of the American moth were placed in each pot. Two groups (control group and treatment group) were set up in the experiment, and each treatment group was set up with 3 replicates. The experimental group was: each pot was watered with 7 mL of JSAFC 2084 spore suspension (10 7 The control group was watered with 7 mL of 0.1% Tween-80 per pot. The pots were sealed with air holes and placed in an artificial climate chamber (temperature 25°C, humidity 60-70%, light-dark ratio 16:8).

[0042] The pots were watered every day, and the mortality rate of the gypsy moth was calculated after 7 days.

[0043] After 7 days, all the gypsy moth larvae in the experimental group died, while the mortality rate of the gypsy moth larvae in the control group was only 13.33%.

[0044] In summary, the strain JSAFC 2084 provided by the present invention is a biocontrol fungus that can be used to control the cuneiform moth. It has the characteristics of strong pathogenicity to the cuneiform moth larvae, is environmentally friendly and pollution-free, and is not prone to drug resistance. It can be widely used for the control of cuneiform moth larvae before they emerge from the ground.

[0045] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent transformation made to the above embodiment based on the technical essence of the present invention still fall within the scope of protection of the technical solution of the present invention.

Claims

1. A biocontrol bacterium for the American white moth, characterized in that: The strain number of the American white moth biocontrol bacteria is JSAFC 2084, which is deposited in the General Microbiology Center of the China Culture Collection Administration Committee on September 23, 2024, with a deposit number of CGMCC No.41563 and a classification name of Saksenaea sp.

2. The biocontrol bacteria for the gypsy moth according to claim 1, characterized in that The nucleotide sequence of the ITS gene of the gypsy moth biocontrol bacteria is shown in SEQ ID NO.

1.

3. A biocontrol agent for the gypsy moth, characterized in that: The active ingredient of the gypsy moth biocontrol agent is the gypsy moth biocontrol agent or its spore suspension according to any one of claims 1 to 2.

4. Use of the gypsy moth biocontrol bacterium according to any one of claims 1 to 2 or the gypsy moth biocontrol agent according to claim 3 in inhibiting the growth of the gypsy moth.

5. The use according to claim 4, characterized in that The application is specifically to spray the spore suspension of the gypsy moth biocontrol bacteria according to any one of claims 1 to 2 on the gypsy moth larvae or the plants they feed on.

6. The use according to claim 5, characterized in that The preparation method of the spore suspension is: (1) Inoculating the American white moth biocontrol bacterium Saksenaea sp. JSAFC 2084 on PDA medium to prepare a culture; (2) placing the culture obtained in step (1) in a Tween-80 solution, filtering out the spores, and preparing a gypsy moth biocontrol agent.

7. The method for preparing the biocontrol agent for Fallen moth according to claim 6, wherein: The culture conditions described in step (1) are: culture at 25° C. in the dark for 5-7 days.

8. The method for preparing the gypsy moth biocontrol agent according to claim 6, wherein: The spore concentration of the gypsy moth biocontrol agent in step (2) is 10 7 pieces / mL.

9. The method for preparing the biocontrol agent for gypsy moth according to claim 6, wherein: The concentration of the Tween-80 solution in step (2) is 0.1%.

10. The use according to claim 5, characterized in that The spore suspension was applied in an amount of 7 mL / time / day for 7 days.

Images