Polyethylene efficient degrading bacterium aspergillus sydowii and application thereof

By screening and isolating the Aspergillus sydowii W144, which can grow under the condition that polyethylene is the only carbon source, the problem of difficult degradation of polyethylene plastics is solved, and environmentally friendly degradation effect and resource recycling are achieved.

CN120484979APending Publication Date: 2025-08-15BEIJING UNION UNIVERSITY
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202510695770.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-28
Publication Date
2025-08-15

AI Technical Summary

Technical Problem

The existing technology is difficult to efficiently degrade polyethylene plastics, resulting in environmental pollution and waste of resources. Traditional treatment methods have problems such as soil pollution, harmful gas emissions and high costs.

Method used

A polyaspergillus sydowii W144 was screened and isolated, aspergillus sydowii W144, which was able to grow under the conditions of polyethylene as the sole carbon source and degrade polyethylene plastics through solid or liquid medium.

Benefits of technology

It realizes effective biodegradation of polyethylene plastics, reduces the risk of environmental pollution, provides a low-cost resource recycling approach, and has good degradation characteristics.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120484979A_ABST
    Figure CN120484979A_ABST
Patent Text Reader

Abstract

The invention relates to the field of microorganisms. The invention provides screening and application of a polyethylene efficient degrading bacterium aspergillus sydowii. The Latin name of the aspergillus sydowii is Aspergillus sydowii W144, the preservation name of the aspergillus sydowii W144 is Aspergillus sydowii W144, the preservation place is China General Microbiological Culture Collection Center (CGMCC), the preservation date is April 10, 2025, and the preservation number is CGMCC NO.41913. The invention further provides a preparation method of the polyethylene efficient degrading bacterium aspergillus sydowii. The aspergillus sydowii disclosed by the invention can grow in an environment taking polyethylene (PE) as a unique carbon source, and can be applied to innocent treatment, cyclic utilization and environmental restoration of plastic resources as a biodegradable bacterium.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of microorganisms and more specifically relates to a strain of Aspergillus polysaccharide capable of efficiently degrading polyethylene plastics and its application. Background Art

[0002] As the fifth most important basic material after wood, stone, metal, and ceramics, plastic has become an indispensable substance in modern industry and life due to its advantages such as light weight, durability, and low cost. Among them, polyethylene (PE), with its high molecular weight, strong hydrophobicity, and chemical inertness, accounts for nearly one-third of the global annual plastic production market share and is widely used in agricultural mulch, food packaging, daily necessities manufacturing, and other fields. PE mulch can increase crop yields by 20%-50% by retaining moisture and increasing temperature, but long-term environmental effects lead to the generation of plastic fragments, which have a degradation rate of less than 0.5% after 10 years of landfill and require up to 300 years to fully mineralize. In daily life, PE is processed in large quantities into disposable, short-life products such as food packaging bags and express bags, accounting for 58% of the total urban plastic waste, with an average usage time of less than 72 hours. About 12 million tons of PE waste enters the environmental system every year worldwide, and is converted into microplastics (<5mm) through photooxidation and mechanical wear. The enrichment concentration in the soil can reach 23 times that of the aquatic environment. It not only destroys the soil microbial community structure and nitrogen cycle (efficiency reduced by more than 30%), but also transmits along the food chain through bioaccumulation, ultimately inducing pathological changes such as oxidative stress, DNA damage and even cancer in human organs.

[0003] Polyethylene (PE), one of the most widely used plastics worldwide, faces significant challenges in waste management. Traditional landfill and incineration methods can easily lead to environmental problems such as soil pollution and hazardous gas emissions. Mechanical recycling degrades material properties and reduces its value. Chemical recycling is limited by process complexity and high costs. In contrast, biodegradation, which converts PE into carbon dioxide and water through microbial action, demonstrates potential for environmentally friendly treatment. However, its practical application is limited by the scarcity of efficient biodegradation strains. Summary of the Invention

[0004] In order to solve the above problems, the present invention aims to provide a polyethylene plastic degrading bacterium Aspergillus polymorpha and its screening and degradation application.

[0005] Therefore, the present invention provides a kind of polysaccharide capable of degrading polyethylene ( Aspergillus sydowii ), its accession number is CGMCC No. 41913.

[0006] In one embodiment, the Aspergillus polydurans can grow under conditions where polyethylene is the sole carbon source.

[0007] In one embodiment, the polyethylene is in the form of a polyethylene film.

[0008] In one embodiment, the Aspergillus polymorpha is grown in solid or liquid culture medium.

[0009] Another aspect of the present invention also provides the use of the Aspergillus polydurol according to the present invention in degrading polyethylene plastic. In a specific embodiment, the polyethylene plastic is a polyethylene film.

[0010] Another aspect of the present invention provides a method for degrading polyethylene plastic, comprising culturing the Aspergillus polydodecene according to the present invention on the polyethylene plastic. In one embodiment, the polyethylene plastic is a polyethylene film. In one embodiment, the culturing is a solid culture or a liquid culture.

[0011] Another aspect of the present invention also provides the use of the Aspergillus polydurea according to the present invention in preparing a biodegradation agent for degrading polyethylene plastic. In a specific embodiment, the polyethylene plastic is a polyethylene film.

[0012] The Aspergillus polydodecene of the present invention can grow in an environment with polyethylene (PE) as the sole carbon source, and can be used as a biodegradable bacterium in the harmless treatment, recycling and environmental restoration of plastic resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] The above features and advantages of the present invention will become more apparent from the following detailed description taken in conjunction with the accompanying drawings, in which: Figure 1 This is the colony morphology of the polyethylene-degrading bacteria provided by the present invention.

[0014] Figure 2 This is a growth curve of the polyethylene-degrading bacteria provided by the present invention in PDB (potato dextrose broth).

[0015] Figure 3 This is a phylogenetic tree of the polyethylene-degrading bacteria provided by the present invention.

[0016] Figure 4 The morphological characteristics of the PE film under a scanning electron microscope after 30 days of degradation by the polyethylene-degrading bacteria provided by the present invention are shown in FIG. A: blank; B: bacteria enriched on the PE film; C: liquid culture medium; and D: solid culture medium.

[0017] Figure 5 This is a diagram showing the functional group changes of the PE film before and after degradation by the polyethylene-degrading bacteria provided by the present invention. DETAILED DESCRIPTION

[0018] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0019] Unless otherwise specified, the experimental methods used in the examples are conventional methods.

[0020] Unless otherwise specified, the materials, reagents, instruments and methods used in the examples of the present invention are conventional materials, reagents, instruments and methods in the art and can be obtained or implemented through commercial channels.

[0021] The terms “include” or “comprising” described in the present invention are open-ended descriptions, encompassing all the specified components or steps described, as well as other specified components or steps that will not substantially affect the description. When used to describe a protein or nucleic acid sequence, the protein or nucleic acid may be composed of the sequence, or may have additional amino acids or nucleotides at one or both ends of the protein or nucleic acid, while still having the activity described in the present invention.

[0022] The term "and / or" as used herein includes all combinations of the items connected by the term, and each combination should be deemed to have been listed separately herein. For example, "A and / or B" includes "A," "A and B," and "B." For another example, "A, B, and / or C" includes "A," "B," "C," "A and B," "A and C," "B and C," and "A and B and C."

[0023] The present invention provides a polyethylene efficient degradation strain, namely, a polyethylene plastic efficient degradation strain Aspergillus polydurum ( Aspergillus sydowii )W144, which was deposited on April 10, 2025 in the General Microbiology Center of China Culture Collection Committee (CGMCC, Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, China, Postal Code: 100101), and its corresponding deposit number is CGMCC No. 41913.

[0024] The present invention also provides a method for isolating and screening a strain capable of efficiently degrading polyethylene plastics, the method comprising: diluting the sample to be separated by gradient, transferring the sample to a culture medium with polyethylene as the sole carbon source, enriching, screening and separating the sample, and then obtaining a strain of Aspergillus polydodecene that can utilize polyethylene as a carbon source and energy source. Aspergillus sydowii )W144.

[0025] The sample to be separated is soil landfill plastic waste.

[0026] The culture medium with polyethylene as the sole carbon source comprises the following components: 0.5 g yeast extract, 0.3 g K2HPO4, 0.5 g NaCl, 1 g MgSO4·7H2O, 0.01 g FeSO4·7H2O, 0.1 g CaCO3, 0.02 g MnCl2·4H2O, and 0.07 g ZnSO4. The above reagents are dissolved in 1 L deionized water, and the pH is adjusted to 7.2 with 1 mol / L NaOH to obtain a liquid culture medium; adding 2% agar to obtain a solid culture medium.

[0027] The present invention also provides a performance identification of a polyethylene-efficient degrading strain, wherein the polyethylene-degrading strain Aspergillus sydowii Application of W144 in biodegradable polyethylene.

[0028] The present invention also provides the polyethylene degradation strain Aspergillus sydowii W144 is used for the degradation of polyethylene films in water / liquids and solids.

[0029] The present invention also relates to a method for screening polyethylene plastic-degrading bacteria from plastic waste in the environment. By applying gradient dilution to a culture medium with polyethylene as the sole carbon source for enrichment screening and multiple streaking separations, a degrading bacterium capable of utilizing polyethylene as a carbon and energy source was isolated. The bacterial colony morphology of the bacterium is described as follows: the mycelium is white in the early stages of colony growth, becomes turquoise after maturity, and has a white circular edge. The ITS gene sequence of the strain was amplified and sequenced, and the resulting sequence was subjected to BLAST analysis with existing sequences in the NCBI database. The results showed that the W144 strain was similar to the W144 strain. Aspergillus sydowii The similarity is 99%, and the evolutionary distance is relatively close. Combined with the physiological and biochemical characteristics of the strain, W144 was preliminarily identified as Aspergillus sydowii (Aspergillus polymorpha).

[0030] The polyethylene plastic degrading bacteria provided by this application Aspergillus sydowii (Aspergillus polymorpha), the strain is named Aspergillus sydowii W144, isolated from the surface of plastic waste landfilled in the soil, was deposited in the General Microbiology Center of the China Culture Collection Administration, with the deposit number CGMCC No. 41913 and the deposit date April 10, 2025. It was detected as a viable strain and deposited.

[0031] The present invention also provides the Aspergillus sydowii Application of W144 in the degradation of polyethylene plastics in solid and liquid culture media.

[0032] The advantages of the present invention are: The isolation and screening method of plastic-degrading bacteria of the present invention is used to obtain bacterial resources capable of degrading polyethylene. The method has low cost and is easy to operate. The obtained strains have good degradation characteristics, providing new resources and ideas for the bioremediation of polyethylene waste in the environment, and has broad application prospects.

[0033] All patents and publications mentioned in this application are incorporated herein by reference in their entirety. Those skilled in the art will recognize that certain modifications may be made to the present invention without departing from the spirit or scope of the present invention. The following examples further illustrate the present invention and are not to be construed as limiting the scope of the present invention or the specific methods described herein. Example Example 1

[0034] Isolation and Screening of Polyethylene-Degrading Bacteria

[0035] (1) Separation and screening of soil attached to landfilled plastic waste Weigh 1g of the collected soil sample and add it to a centrifuge tube containing 9ml of sterile water. Vortex thoroughly and obtain 10 -4 , 10 -5 , 10 -6 The samples of different dilutions were inoculated on inorganic salt culture medium plates with polyethylene as the sole carbon source, with 3 replicates for each dilution. After being evenly spread with a spreading rod, they were placed in an inverted culture at a constant temperature of 30°C and 37°C. The strains with fast growth and good growth were separated by streaking, purified and re-screened, and the screened strains were placed in glycerol tubes and stored at -80°C for future use.

[0036] The isolated and screened culture medium was a basal medium consisting of 0.5 g yeast extract, 0.3 g K₂HPO₄, 0.5 g NaCl, 1 g MgSO₄·7H₂O, 0.01 g FeSO₄·7H₂O, 0.1 g CaCO₃, 0.02 g MnCl₂·4H₂O, and 0.07 g ZnSO₄. These reagents were dissolved in 1 L of deionized water and the pH was adjusted to 7.2 with 1 mol / L NaOH. The solid medium was supplemented with 2% agar and polyethylene as the sole carbon source.

[0037] Through the above separation and screening operations, multiple separation and purification were performed to obtain a column of rapidly growing polyethylene degrading bacteria. Aspergillus sydowii W144. The initial mycelium of this fungus on PDA (potato dextrose agar) plates is white, the spore-forming structures are green, the colony has a velvety texture, the reverse side is colorless, no exudate is produced, and the middle part is convex. Figure 1 .

[0038] (2) Molecular biological identification of strains The DNA of the single strain isolated above was extracted using a kit, and PCR amplification was performed using bacterial universal primers ITS1 and ITS4 as amplification primers.

[0039] Fungal ITS sequence primers ITS1:5´-TCCGTAGGTGAACCTGCGG-3´ (SEQ ID NO: 1) ITS4:5´-TCCTCCGCTTATTGATATGC-3´ (SEQ ID NO: 2) PCR amplification system (50uL) Template DNA 2.5 uL, 10× Taq Buffer 5 uL, dNTPs 5 uL, upstream primer ITS1 5 uL, downstream primer ITS4 5 uL, Taq DNA polymerase 0.5 uL, ddH2O 27 uL.

[0040] The amplification procedure was as follows: 95°C pre-denaturation for 5 min, 95°C denaturation for 30 s, 58°C annealing for 30 s, and 72°C extension for 1 min 30 s, for 30 cycles, followed by a final extension at 72°C for 7 min, and storage at 4°C. The amplified product was analyzed by electrophoresis and sequenced by Qingke Biotechnology (Beijing). The sequencing result is shown in SEQ ID NO: 3.

[0041] > Aspergillus sydowii W144 GAAGGATCATTACTGAGTGCGGGCTGCCTCCGGGCGCCCAACCTCCCACCCGTGAATACCTAACACTGTTGCTTCGGCGGGGAACCCCCTCGGGGGCGAGCCGCCGGGGACTACTGAACTTCATGCCTGAGA GTGATGCAGTCTGAGTCTGAATATAAAATCAGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAACTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGT CTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCCCGGCTTGTGTTGGGTCGTCGTCCCCCCCGGGGGACGGGCCCGAAAGGCAGCGGCGG CACCGTGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCGACTAGGGCCGGCCGGGCCGCCAGCCGACGTCTCCAACCATTTTTCTTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA (SEQ ID NO: 3) The obtained sequences were compared with the existing sequences in the NCBI database by BLAST analysis, and strains with similar homology were selected to construct a phylogenetic tree using MEGA 12.0 software (see Figure 3 ).

[0042] Aspergillus sydowii The growth curve of W144 in PDB medium is as follows Figure 2 As shown, Aspergillus sydowii W144 grew rapidly in PDA medium and entered the logarithmic growth phase after 2 days. Aspergillus sydowii The similarity is 99%. And the evolutionary distance is relatively close ( Figure 3 ), combined with the bacterial colony growth characteristics, W144 was preliminarily identified as Aspergillus polymorpha ( Aspergillus sydowii ).

[0043] This strain Aspergillus sydowiiW144 was deposited on April 10, 2025, at the General Microbiology Center of the China Culture Collection Administration (CGMCC, Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing 100101, China), and its corresponding deposit number is CGMCC No. 41913. Example 2 Degradation experiment of polyethylene film by polyethylene-degrading bacteria The degradation experiment of polyethylene film by polyethylene degrading bacteria was carried out according to the following steps:

[0044] To evaluate the polyethylene degrading bacteria Aspergillus sydowii In order to investigate the application potential of W144 in different environments, liquid culture medium and solid culture medium were selected to carry out degradation experiments on pure polyethylene film.

[0045] Degradation in liquid environment: The spore suspension of W144 was inoculated into PDA medium at a 10% inoculum size and cultured until the logarithmic growth phase. The surface culture medium was removed by washing three times with 0.01 mol / L phosphate buffer solution. The polyethylene film was cut into 3´3 cm pieces, weighed and sterilized with 75% ethanol for 2 h. After removal, the surface ethanol was evaporated with sterile air flow in a clean bench. 90 mL of basal culture medium was added to the conical flask, and a surface-sterilized polyethylene film (1 g / L) was added. The above W144 resuspended bacterial solution was inoculated at a 10% (v / v) inoculum size. The uninoculated treatment was used as the control group, and three parallel samples were set for each treatment. The conical flask was placed in a constant temperature shaking incubator at 30 °C and 180 r / min for incubation. After 30 days, samples were taken and analyzed for changes in the morphology, functional group changes, mass loss and molecular weight of the polyethylene film surface (see Figure 4 ).

[0046] Degradation in solid environment: Cut the polyethylene film into 3´3 cm size, weigh it and sterilize it with 75% ethanol for 2 hours. After taking it out, evaporate the ethanol on the surface with sterile airflow in a clean bench. Add surface-sterilized polyethylene film (1 g / L) to the solid basal culture medium and streak inoculate the solid culture medium with the prepared spore suspension. The non-inoculated treatment was used as the control group, and 3 parallel samples were set for each treatment. The plate was placed in a constant temperature incubator at 30 °C for incubation. After 30 days, samples were taken to analyze the morphological changes, functional group changes, mass loss and molecular weight changes of the polyethylene film surface (see Figure 4 ).

[0047] The following process was used to analyze the micromorphology of the polyethylene membrane surface: excess culture medium was rinsed off with sterile water, the membrane was treated with 2% SDS for 2 hours, and then dehydrated in a gradient of 30%, 50%, 70%, 90%, and 100% ethanol, each for 15 minutes. The treated samples were dried, mounted, and sprayed with gold for observation of their micromorphology under a scanning electron microscope.

[0048] The mass change of the polyethylene membrane was processed according to the following process: the polyethylene membrane was washed with 2% SDS solution for 2 h, ultrasonicated for 30 min to remove the biofilm on the surface, and then washed with sterile water three times. The washed polyethylene membrane was placed in a desiccator and dried for 48 h before being weighed.

[0049] Mass loss rate (%) = (initial mass of polyethylene - mass after degradation) / initial mass × 100% The surface functional groups of polyethylene membranes were determined by Fourier transform infrared spectroscopy. The cleaned membranes were dried naturally and the scanning wavelength range was 500-4500 cm -1 , resolution 4 cm -1 , scan times 45 times.

[0050] Experimental results: After 30 days of degradation, the weight loss rate of PE films in the experimental group and the blank control group are shown in Table 1. The average weight loss rate of the three experimental groups is 0.9789 ± 0.0949%. Aspergillus sydowii The W144 strain can achieve a weight loss of 1.033 mg in the degradation of polyethylene plastic mulch, showing good degradation effect.

[0051]

[0052] Depend on Figure 4 It can be seen that after 30 days of cultivation, it was observed under a scanning electron microscope that the surface of the membrane treated with bacteria was rougher than that of the control group, with uneven disintegration and obvious microbial erosion holes on the surface. Figure 5 The FTIR results showed that a new characteristic peak appeared in the PE film after degradation, at 1725 cm -1 Carbonyl peaks were detected around 1725 cm -1 The appearance of about 5% PE is a basic sign of PE biodegradation, indicating that polyethylene has been biodegraded, indicating that W144 has a degradation effect on polyethylene film.

[0053] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the scope of protection of the present invention.

[0054] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any appropriate manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0055] In addition, the various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. A polysaccharide capable of degrading polyethylene ( Aspergillus sydowii ), its accession number is CGMCC No.41913.

2. The Aspergillus polydodectes according to claim 1, which can grow under conditions where polyethylene is the sole carbon source.

3. The Aspergillus polymorpha according to claim 1 or 2, wherein the polyethylene is in the form of a polyethylene film.

4. The Aspergillus polymorpha according to claim 1 or 2, wherein the Aspergillus polymorpha is grown in a solid or liquid culture medium.

5. Use of Aspergillus polydodecene according to claim 1 in degrading polyethylene plastics.

6. The use according to claim 5, wherein the polyethylene plastic is a polyethylene film.

7. A method for degrading polyethylene plastic, comprising culturing the Aspergillus polydodecene according to claim 1 on the polyethylene plastic.

8. The method of claim 7, wherein the polyethylene plastic is a polyethylene film.

9. Use of the Aspergillus polydodecene according to claim 1 in the preparation of a biodegradation agent for degrading polyethylene plastics.

10. The use according to claim 9, wherein the polyethylene plastic is a polyethylene film.

Citation Information

Patent Citations

  • Aspergillus sydowii with broad-spectrum pesticide degradation characteristics

    CN105602855A

  • Polyethylene plastic efficient degrading bacterium and separating and screening method and application thereof

    CN110257310A

  • Phthalate degrading bacterium and application thereof in restoration of environment polluted by plasticizer

    CN118028115A

  • Polyorganosiloxane biodegradation method using a microscopic fungus and screening method

    US6020184A