Pleurotus citrinopileatus strain for co-production of ergothioneine and polypeptide, preparation method and application

By improving the preparation method and fermentation process of NJ01 of the elm yam strain NJ01, protoplast preparation, ARTP mutagenesis and two-stage acid-base stress strategies were adopted, the yield of ergothionine and polypeptides was significantly improved, the problem of insufficient yield and efficiency in the existing technology was solved, and efficient coproduction was achieved.

CN120484985AActive Publication Date: 2025-08-15NANJING TECH UNIV
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202510949241.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-10
Publication Date
2025-08-15
Estimated Expiration
2045-07-10

AI Technical Summary

Technical Problem

The existing technology lacks high yield and stable elm mushroom strains with industrial potential, and lacks efficient induction, fermentation and extraction processes, making it difficult to meet the yield and efficiency needs of functional products.

Method used

A strain of elm yam mushroom NJ01 was developed, which was combined with the fermentation process of bran as a carbon source through protoplast preparation, ARTP mutagenesis treatment, regeneration and screening, and adopted a two-stage acid-base stress strategy to regulate the media pH value to increase the yield of ergothione and polypeptides.

Benefits of technology

The EGT yield of the elm yam strain NJ01 was twice, the cellulase activity was increased by 38.45%, the gypsum protein content was increased by 59.46%, the EGT yield during fermentation reached 2.8 times that of glucose, and the EGT yield after expanding culture reached 741.38 mg/L.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120484985A_ABST
    Figure CN120484985A_ABST
Patent Text Reader

Abstract

The invention provides a pleurotus citrinopileatus strain for co-production of ergothioneine and polypeptide, and a preparation method and application thereof, and belongs to the technical field of microorganisms. The strain is preserved in Guangdong Microbial Culture Collection Center on June 13, 2025, and the preservation number of the strain is GDMCC NO. 66504. After the pleurotus citrinopileatus strain is mutagenized, the EGT yield of the strain is increased by two times compared with that of an original strain, the cellulase activity is increased by about 38.45% compared with that of the original strain, and the mushroom protein content is increased by 59.46% compared with that of the original strain. In the fermentation process, the yield of EGT (epigallocatechin gallate) is 2.8 times that of glucose by taking bran as a carbon source; the yield of the EGT can reach 560 mg / L through amplification culture of a 5L fermentation tank, and the yield of the EGT can reach 741.38 mg / L by further applying a two-stage acid-base stress strategy to the fermentation tank.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention provides a Pleurotus citriodora strain for co-producing ergothioneine and polypeptide, a preparation method and application thereof, and belongs to the technical field of microorganisms. Background Art

[0002] Ergothioneine (EGT) is a natural sulfur-containing antioxidant with free radical scavenging and cytoprotective properties, and holds broad application prospects in medicine, health supplements, and functional foods. Unlike other antioxidants, ergothioneine is actively taken up by the body through the specific transporter OCTN1 and accumulated in key organs and tissues. Its enhanced chemical stability and mitochondrial targeting offer unique advantages in anti-aging and cytoprotective applications.

[0003] Bioactive peptides (BAPs) are specific protein fragments that are beneficial to the life activities of biological organisms or have physiological effects. They usually contain 2 to 20 amino acid residues and are a class of peptide compounds with a relative molecular weight of less than 6000 Da. They play an important physiological regulatory role in organisms, such as antibacterial, anticancer, antioxidant, immune regulation, lowering blood pressure, blood sugar, uric acid and other physiological functions. They are widely used in related fields such as food, health products and pharmaceuticals.

[0004] Pleurotus eryngii ( Pleurotus citrinopileatus ) is an edible and medicinal fungus widely distributed in East Asia. Due to its rich secondary metabolites, Pleurotus citrinopileatus has a wide range of biological activities and shows important medicinal value in anti-oxidation, hypoglycemic, immunomodulatory and other aspects, providing broad prospects for the development of functional foods and medicinal fungi. At the same time, Pleurotus citrinopileatus is also a green and safe potential EGT and active peptide production strain. In addition, it is rich in protein, vitamins and minerals, with a protein content of up to 22.0%, which is twice the content of egg or turtle protein. In addition, Pleurotus citrinopileatus also contains eight essential amino acids for humans, such as lysine, threonine, and phenylalanine. However, there is currently a lack of high-yield, stable Pleurotus citrinopileatus strains with industrial potential, as well as a lack of supporting efficient induction, fermentation and extraction processes, and systematic research and development is urgently needed.

[0005] Therefore, there is an urgent need to develop a Pleurotus citrinopileatus strain that can efficiently co-produce ergothioneine and active peptides, and to establish a stable and controllable fermentation and extraction process to address the shortcomings of existing technologies in terms of yield, efficiency and process control, and meet the needs of the industrialization of functional products. Summary of the Invention

[0006] In order to solve the above-mentioned defects and deficiencies in the prior art, the present invention provides a Pleurotus citriodora strain for co-producing ergothioneine and polypeptide, a preparation method and application thereof.

[0007] To solve the above technical problems: The first purpose of the present invention provides a kind of Pleurotus citriodora strain for co-producing thioneine and polypeptide, and the strain is preserved in Guangdong Provincial Microbial Culture Collection Center on June 13, 2025, and the preservation number is: GDMCC NO.66504, and the name conforms to NJ01.

[0008] Furthermore, the complete ITSrDNA sequence of the strain is shown in SEQ ID No: 1.

[0009] The second object of the present invention is to provide a method for preparing the above-mentioned Pleurotus citrinopileatus strain, comprising the following steps: Preparation of protoplasts of S1 Pleurotus citrinopileatus strain; S2: subjecting the protoplasts of the Pleurotus citrinopileatus strain obtained in step S1 to ARTP mutagenesis; The S3 induced Pleurotus citrinopileatus strain was regenerated; S4 screening was performed to obtain the target strain.

[0010] The third object of the present invention is to provide an application of the above-mentioned Pleurotus citrinopileatus strain in the production of ergothioneine and polypeptide.

[0011] The fourth object of the present invention is to provide a method for preparing thioneine and a polypeptide, wherein the above-mentioned Pleurotus citriodora strain is fermented to obtain thioneine and the polypeptide.

[0012] Furthermore, the carbon source used in the fermentation process is bran.

[0013] Furthermore, the pH value of the culture medium is adjusted to 4.0-5.0 at 96-120 hours of the fermentation treatment, or the pH value of the culture medium is adjusted to 8.0-9.0 at 72-96 hours of the fermentation treatment to perform stress treatment.

[0014] Furthermore, the pH value of the culture medium was adjusted to 7.0-9.0 at 72-96 hours of the fermentation treatment, and the pH value of the culture medium was adjusted to 4.0-5.0 at 120-144 hours of the fermentation treatment.

[0015] The present invention achieves the following beneficial technical effects: A strain of Pleurotus citrinopileatus that co-produces ergothioneine and polypeptides, as well as a preparation method and application, is provided. After mutagenesis, the strain's EGT production is doubled compared to the original strain, its cellulase activity is increased by approximately 38.45%, and its mushroom protein content is increased by 59.46%. During fermentation, using wheat bran as a carbon source, EGT production reaches 2.8 times that of glucose. After expanded cultivation in a 5L fermenter, EGT production can reach 560 mg / L. Further application of a dual-stage acid-base stress strategy to the fermenter increases EGT production to 741.38 mg / L. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is a diagram of the protoplast mutagenesis and regeneration process of the ergothioneine and active peptide co-producing Pleurotus citrinopileatus NJ01 of the present invention; A is a microscopic image of the protoplast of the original ergothioneine strain; B is the regeneration state of the mutated protoplast in a hypertonic medium; C is the regenerated ergothioneine mutant obtained Pleurotus citrinopileatus NJ01 colony morphology; Figure 2 The effects of different carbon sources on the yield of fermentation products of Pleurotus citrinopileatus NJ01 of the present invention; Figure 3 The effects of different concentrations of acid stress on the fermentation products of Pleurotus citrinopileatus NJ01 of the present invention; wherein A is a mycelial morphology diagram of Pleurotus citrinopileatus NJ01; B is a diagram of ergothioneine production under different concentrations of acid stress; C is a diagram of polypeptide production under different concentrations of acid stress; Figure 4 The effects of different concentrations of alkali stress on the fermentation products of Pleurotus citrinopileatus NJ01 of the present invention; wherein A is a mycelial morphology diagram of Pleurotus citrinopileatus NJ01; B is a diagram of ergothioneine production under different concentrations of alkali stress; C is a diagram of polypeptide production under different concentrations of alkali stress; Figure 5 The present invention shows the effects of acid stress on the fermentation products of Pleurotus citrinopileatus NJ01 at different times; wherein A is a graph of ergothioneine production under acid stress at different times; B is a graph of polypeptide production under acid stress at different times; Figure 6 The effects of alkali stress on the fermentation products of Pleurotus citrinopileatus NJ01 at different times of the present invention are shown in FIG. A is a graph showing the yield of ergothioneine under alkali stress at different times; and FIG. B is a graph showing the yield of polypeptides under alkali stress at different times. Figure 7 This is a statistical chart of EGT yield in the expanded culture of Pleurotus citrinopileatus NJ01 of the present invention; Figure 8 The figures show the statistical contents of the mushroom powder after fermentation of Pleurotus citrinopileatus NJ01 of the present invention; A represents the protein content; B represents the distribution of polypeptides of different molecular weights; and C represents the hypoglycemic activity and polypeptide freeze-drying yield.

[0017] The deposit information of the Pleurotus citrinopileatus strain in this application is as follows: A strain of Pleurotus citriodora producing ergothioneine and peptides: classification and naming Pleurotus citrinopileatus NJ01 was deposited in Guangdong Provincial Microbiological Culture Collection Center on June 13, 2025, with the accession number: GDMCCNO. 66504. DETAILED DESCRIPTION

[0018] The present invention will be further described below in conjunction with specific examples. The following examples are only used to more clearly illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention.

[0019] The present invention is further described below with reference to the accompanying drawings and examples. The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are commercially available unless otherwise specified. The experimental materials involved in the following examples are as follows: Isolation of the Pleurotus citrinopileatus strain: The Pleurotus citrinopileatus strain used in this invention was isolated from a native Pleurotus citrinopileatus strain found on rotten wood in the Changbai Mountains of Jilin Province. The specific isolation process involves the separation and purification of wild fruiting bodies using a tissue separation method. Young, tender fruiting bodies or mushroom buds in active growth are preferred as the isolation material, and tissue blocks from the junction of the cap and stipe are selected as the inoculation material.

[0020] Under sterile conditions, the tissue was inoculated onto sterilized PDB medium and cultured at 25°C. After the mycelium grew stably, it was transferred and separated until pure mycelium with uniform morphology was obtained. The resulting pure strain was further used for subsequent propagation and performance evaluation. After obtaining the mother strain of wild Pleurotus citrinopileatus, preliminary screening was first carried out based on indicators such as mycelium growth rate, colony morphology, and stress resistance to select excellent strains with vigorous growth and strong metabolic capacity. Subsequently, its species was determined through microscopic observation and ITS sequence analysis, providing a basis for subsequent artificial domestication and new variety breeding.

[0021] PDB medium: potato dextrose water 26 g / L, soy peptone 2 g / L, KH2PO4 2 g / L, MgSO4·7H2O 2 g / L.

[0022] PDB solid culture medium: potato dextrose water 26 g / L, soy peptone 2 g / L, KH2PO4 2 g / L, MgSO4·7H2O 2 g / L, agar powder 1.5-2%.

[0023] Hypertonic plate culture medium: potato dextrose water 26g / L, soy peptone 2g / L, potassium dihydrogen phosphate 2g / L, magnesium sulfate heptahydrate 2g / L, mannitol about 109.3g / L, agar 1.5%-2%.

[0024] Fermentation medium: (1) PPT medium: glucose 30 g / L, soy peptone 10 g / L, KH2PO4 2 g / L, MgSO4·7H2O 6 g / L, histidine 0.5 g / L, methionine 2.5 g / L, cysteine 1.5 g / L; (2) YMF medium: corn flour 30 g / L, soy peptone 10 g / L, KH2PO4 2 g / L, MgSO4·7H2O 6 g / L, histidine 0.5 g / L, methionine 2.5 g / L, cysteine 1.5 g / L.

[0025] (3) FP medium: bran 30 g / L, soy peptone 10 g / L, KH2PO4 2 g / L, MgSO4·7H2O 6 g / L, histidine 0.5 g / L, methionine 2.5 g / L, cysteine 1.5 g / L.

[0026] (4) MX medium: sawdust 30 g / L, soy peptone 10 g / L, KH2PO4 2 g / L, MgSO4·7H2O 6 g / L, histidine 0.5 g / L, methionine 2.5 g / L, cysteine 1.5 g / L.

[0027] (5) JG medium: straw 30 g / L, soy peptone 10 g / L, KH2PO4 2 g / L, MgSO4·7H2O 6 g / L, histidine 0.5 g / L, methionine 2.5 g / L, cysteine 1.5 g / L.

[0028] (6) DK medium: rice husk 30 g / L, soy peptone 10 g / L, KH2PO4 2 g / L, MgSO4·7H2O 6 g / L, histidine 0.5 g / L, methionine 2.5 g / L, cysteine 1.5 g / L.

[0029] (7) YMX medium: corn cob 30 g / L, soy peptone 10 g / L, KH2PO4 2 g / L, MgSO4·7H2O 6 g / L, histidine 0.5 g / L, methionine 2.5 g / L, cysteine 1.5 g / L.

[0030] The prepared culture medium solution was divided into 500 mL conical flasks (100 mL per flask) and sterilized by high-pressure steam at 121°C for 20 min (glucose solution was sterilized separately at 115°C for 30 min and then added aseptically).

[0031] Cultivation method: (1) Preparation of solid plate seeds: The strain stored in the slant tube was inoculated into a 9 cm diameter culture dish containing PDB agar medium using a sterile inoculation spatula and cultured at 25°C until the mycelium covered the surface of the plate to obtain the first generation plate. Subsequently, a sterile punch was used to punch a sample from the first generation plate and transferred to a newly prepared PDB agar plate. The plate was cultured at 25°C until the mycelium covered the entire plate. This served as the starting material for the liquid seed.

[0032] (2) Liquid seed culture: Add an appropriate amount of sterile water to the second-generation plate and crush it. The resulting mycelial liquid is inoculated into PDB liquid culture medium (e.g., 50 mL / 250 mL conical flask). Incubate in a dark shaking incubator at 25°C and 150 rpm for 5 days to obtain the first-generation seed liquid. Take another 5 mL of the first-generation seed liquid and inoculate it into 50 mL of new PDB culture medium. Incubate at 25°C and 150 rpm for 3 days to obtain the second-generation liquid seed.

[0033] (3) Shake flask fermentation broth culture process: 20 mL of the second-generation seed liquid was inoculated into a 500 mL conical flask containing 100 mL of fermentation medium. Fermentation was carried out at 25°C, 150 rpm, and in the dark. Acid-base stress was applied during the fermentation process. Fermentation was continued for 7 days to obtain the NJ01 fermentation broth for increasing ergothioneine production. Fermentation conditions were as follows: the culture temperature was 20-30°C, preferably 25°C; the shaking speed was 100-200 rpm, preferably 150 rpm; and the culture was kept in the dark to reduce EGT degradation.

[0034] (4) Fermentation in a fermenter: 600 mL of the secondary seed solution was inoculated into a 5 L fermenter containing 3 L of FP fermentation medium (plus 1 mL of defoamer). Fermentation conditions were set at a constant temperature of 25°C and a stirring speed of 300 rpm. After 7 days of continuous culture, the cells were harvested.

[0035] Shake flask fermentation stress method: (1) Acid stress at different concentrations: On the fourth day of fermentation, the EGT production of Pleurotus citrinopileatus was in a plateau period. Therefore, on the fourth day of fermentation, the pH of the culture medium was adjusted to 2, 3, 4, 5 and 6 respectively. After 168 h of fermentation, the fungi were harvested, the mycelial morphology was observed, and the EGT content and bacterial polypeptide content were determined.

[0036] (2) Alkali stress at different concentrations: On the fourth day of fermentation of Agaricus citriodora, the pH of the culture medium was adjusted to 6, 7, 8, 9, 10 and 11 respectively. The fungi were harvested after 168 h of fermentation and the indicators were measured as above.

[0037] (3) Acid stress at different times: The pH of the culture medium was adjusted to 4 on the 3rd, 4th, 5th and 6th days of fermentation. The bacteria were harvested after 168 hours of fermentation and the indicators were measured as above.

[0038] (4) Alkali stress at different times: The pH of the culture medium was adjusted to 7.1 on the 3rd, 4th, 5th and 6th days of fermentation. The bacteria were harvested after 168 hours of fermentation and the measurement indicators were the same as above.

[0039] Ergothioneine extraction: Take 5 mL of fermentation broth and centrifuge at 12,000 rpm for 10 minutes. After passing the supernatant through a PES membrane, obtain an extracellular sample for subsequent testing. Then, discard the supernatant and add ultrapure water to the precipitate for washing. After centrifugation to remove the waste liquid, add ultrapure water to the precipitate to 5 mL and use a handheld homogenizer to break it up at 5,000 rpm for 30 seconds. Then, place the broken sample in a 95°C water bath and extract it for 1 hour. After completion, centrifuge at 12,000 rpm for 10 minutes to obtain the supernatant. Pass the supernatant through a PES membrane to obtain the intracellular sample for subsequent testing.

[0040] BCA method detection: Use the BCA method to detect its protein, the trichloroacetic acid method to remove acidic proteins and then detect the polypeptide content, the phenol-sulfuric acid method and 3,5-dinitrosalicylic acid method to detect the polysaccharide content, and HPLC to detect the polypeptide molecular weight and ergothioneine content and other active substance content indicators, and then use the α-glucosidase kit to detect the in vitro hypoglycemic activity.

[0041] Mycelial pretreatment: After filtration and washing, the mycelium was freeze-dried, crushed, sieved, and ground into a fine powder. A 3g sample was weighed and dissolved in 30mL of water for physical, chemical, and enzymatic pretreatment, followed by protease hydrolysis.

[0042] Endocellulase activity assay: Pipette 0.5 mL of crude enzyme solution into a screw-capped test tube, add 1 mL of phosphate-citrate buffer (pH 4.8) containing 1% sodium carboxymethyl cellulose, and incubate at 50°C in a water bath for 30 min. Immediately add 1.5 mL of DNS solution to terminate the reaction. Place the test tube in a boiling water bath for 5 min, remove it, and quickly cool it to room temperature in ice water. Measure the absorbance at 540 nm. Use the crude enzyme solution inactivated in a boiling water bath for 5 min and treated in the same manner as above as a blank for zero adjustment.

[0043] Endocellulase activity is defined as the amount of enzyme required to decompose carboxymethyl cellulose and release 1 μg of glucose per minute.

[0044] Endocellulase activity (U / mL) A=m / (t×V)×n A: endocellulase activity, U / mL; m: glucose mass calculated by standard curve, μg; t: enzymatic reaction time, min; V: volume of crude enzyme solution in the reaction system, mL; n: dilution factor.

[0045] Determine the crude protein content of mushroom powder using an elemental analyzer: Accurately weigh (5 ± 0.25) mg of freeze-dried mushroom powder sample, wrap it in tin foil, compact it, and place it in a sample tray. Turn on the instrument, computer, and valve system, and start the measurement according to the preset program.

[0046] Sulfadiazine was used as the standard reference substance, and one control sample was prepared for every 20 samples measured. Three replicates were set for each sample, and the measured data were averaged. The relative standard deviation (RSD) was calculated to evaluate the measurement precision.

[0047] Example 1 Preparation of Pleurotus citrinopileatus strain NJ01 1. Protoplast preparation: Select the mycelium of Pleurotus citrinopileatus that has been cultured in liquid for about 5 days and is in good growth condition, and perform cell wall removal treatment in an enzymatic hydrolysis solution, which is a hypertonic solution containing 0.7%-1.5% snail enzyme. The hypertonic solution can be selected from one or more of the following: 0.6M mannitol, 0.6M sucrose, 1M sorbitol, 0.7M sodium chloride or 0.7M potassium chloride. Preferably, a combination of 1% snail enzyme + 0.6M mannitol is used, and the mixture is shaken in the dark at 30-35°C for 1-2 hours. After treatment, the unlysed mycelium is removed by filtration or centrifugation, and the protoplast concentration is determined using a hemocytometer.

[0048] 2. ARTP mutagenesis treatment: dilute the prepared protoplasts to an appropriate concentration (about 10 7 ARTP mutagenesis was performed using high-purity helium as the working gas. The power was set at 100 W, the gas flow rate was 10 L / min, and the distance between the metal slide and the nozzle was set at 2 mm.

[0049] During the mutagenesis procedure, evenly drip 10 μL of the protoplast suspension onto the surface of a metal slide. Set the induction time to 15, 30, 45, 60, 75, 90, 105, and 120 seconds, depending on the treatment requirements. After the induction period, immediately transfer the metal slide to a centrifuge tube containing 1 mL of a sterile hypertonic solution (such as 0.6 mol / L mannitol buffer) and allow it to stand in the dark to ensure protoplast survival and mutagenesis efficacy. The preferred ARTP induction treatment time is 90 seconds.

[0050] 3. Protoplast regeneration: Dilute the eluted mutagenized protoplasts to approximately 1×10 6 100 μL of bacterial solution was evenly spread on the surface of a hypertonic regeneration medium plate and incubated at 25°C to promote protoplast regeneration and mutagenic colony formation. A control medium without mannitol was also set up for calculation and evaluation of regeneration rate.

[0051] 4. Screening: Mutants of Pleurotus citrinopileatus that were successfully regenerated after ARTP mutagenesis were screened for cellulase activity using the sodium carboxymethylcellulose colorimetric method and for EGT content using hydrogen peroxide plates. The following procedures were performed: Successfully regenerated strains were inoculated onto solid plates containing sodium carboxymethylcellulose (CMC-Na) and onto PDB plates containing 6 mM hydrogen peroxide, respectively, and incubated at 28-30°C for 4-6 days. The CMC-Na plates were stained with 1 mg / mL Congo red for 45 minutes and decolorized with 1 mol / L NaCl for 45 minutes. The hydrolysis zone surrounding the colonies and the size of the colony diameter were then observed. The ratio of the hydrolysis zone diameter to the colony diameter was used as a preliminary indicator of enzyme activity. Strains with a ratio of the clearing zone diameter to the colony diameter greater than 2 were selected to identify strains with strong cellulose degradation ability. The colony diameter on the hydrogen peroxide plate was used as a preliminary screening marker for EGT content, and strains with colony diameters on the hydrogen peroxide plate ≥ the control group × 1.3 (the control group was a wild strain) were selected for further screening.

[0052] After obtaining the initial screening results, the selected excellent mutant strains were further tested for endocellulase activity, ergothioneine production and crude protein content. The test results are shown in Table 1.

[0053] Table 1 ; The mutant strain with significantly enhanced cellulase activity, significantly increased ergothioneine production, and increased protein content was selected as the target strain and named NJ01 for the production of ergothioneine and peptides. Figure 1 shown.

[0054] The above-mentioned pure bacterial colonies were transferred to PDB solid plate culture medium, and the ITS rDNA of the strain was sequenced using primers ITS rDNA universal primers (ITS1 as shown in SEQ ID NO: 2: TCCGTAGGTGAACCTGCGG; ITS4 as shown in SEQ ID NO: 3: TCCTCCGCTTATTGATATGC) to obtain the gene sequence as shown in SEQ ID NO: 1.

[0055] SEQ ID NO: 1: .

[0056] Example 2 Effects of different carbon sources on the yield of fermentation products of Pleurotus citrinopileatus NJ01 20mL of the second-generation Pleurotus citrinopileatus NJ01 seed solution was inoculated into PTT, YMF, FP, MX, JG, DK, and YMX fermentation media, respectively, and fermented in shake flasks at 25°C and 150rpm for 168h. The EGT content was detected. Figure 2 As shown, from Figure 2 It can be seen that after the fermentation, the EGT production of Pleurotus citrinopileatus NJ01 under bran carbon source was the highest, reaching 305.40 mg / L, followed by the corn flour group, reaching 290.05 mg / L, and the lowest production was in the fermentation group using sawdust as carbon source.

[0057] Wheat bran and corn flour groups were selected, and samples were taken every 24 hours during the fermentation process to detect the dry weight of the bacteria and the activity of endocellulase in the culture medium. In terms of dry weight, as shown in Table 2, the OD of the bran group at 96h of fermentation was 260 The value was 7.04, 1.55 times that of the cornmeal group, indicating that wheat bran is more conducive to mycelial accumulation. Cellulase activity assay results, as shown in Table 3, show that both carbon sources induced the production of endocellulase in Pleurotus citrinopileatus NJ01, but with varying activity levels. At 72 hours, the cornmeal group had an activity of 0.10 U / mL, slightly higher than the bran group's 0.06 U / mL. However, at 96 hours, the bran group's activity remained at 0.06 U / mL, while that of the cornmeal group decreased to 0.04 U / mL, indicating that wheat bran is more conducive to the sustained expression of this enzyme. This enzyme cleaves β-1,4-glycosidic bonds in cellulose molecules, releasing cello-oligosaccharides, which provide substrates for further hydrolysis and metabolism, thereby synergistically improving substrate utilization and ergothioneine synthesis efficiency. These results indicate that using wheat bran as a carbon source not only significantly increases EGT production but also promotes sustained cellulase expression and enhanced bacterial biotransformation efficiency, demonstrating promising co-production potential and industrial application value.

[0058] Table 2 ; Table 3 ; Example 3 Effects of different concentrations of acid stress on the fermentation products of Pleurotus citrinopileatus NJ01 The NJ01 strain of Pleurotus citrinopileatus, screened by ARTP mutagenesis, was selected as a high-ergothioneine-producing strain. Second-generation seeds were inoculated into FP fermentation medium. On the fourth day of fermentation (a period of plateauing EGT growth), the pH of the medium was adjusted to 2, 3, 4, and 5 using dilute hydrochloric acid to induce acid stress. The fungi were harvested at 168 hours of fermentation, and mycelial morphology was observed. Total EGT and peptide content in the culture medium were measured to investigate the effects of acid stress on the fermentation process of Pleurotus citrinopileatus. A control group (CK) was used without acid stress.

[0059] The results are as follows Figure 3 Shown: From Figure 3 As can be seen from A in the figure, under weakly acidic conditions of pH 4-6, the mycelium has regular morphology and uniform branches, which is conducive to stable growth; Figure 3 As shown in Figure B, different pH values of acid stress ultimately resulted in different EGT yields. In the pH 4 treatment group, EGT yield reached 399.25 mg / L, which was approximately 32.27% higher than that of the control group (301.84 mg / L). Figure 3As shown in Figure C, peptide content varied under different pH values. In the pH 4 treatment group, the peptide content reached 5.51 g / L, a 15.76% increase compared to the control group (4.76 g / L). These results indicate that moderate acid stress can promote normal bacterial growth while synergistically increasing EGT and peptide production.

[0060] Example 4 Effects of different concentrations of alkali stress on the fermentation products of Pleurotus citrinopileatus NJ01 The NJ01 strain of Pleurotus citrinopileatus, screened by ARTP mutagenesis, was selected as a high-ergothioneine-producing strain. Second-generation seeds were inoculated into FP fermentation medium. On the fourth day of fermentation (a period of plateauing EGT growth), the medium pH was adjusted to alkaline stress levels of 6-11. The fungi were harvested at 168 hours of fermentation. Mycelial morphology was observed, and the total EGT and peptide content in the culture medium were measured to investigate the effects of alkaline stress on the fermentation process of Pleurotus citrinopileatus.

[0061] The results are as follows Figure 4 As shown in Figure 2: Under alkaline stress of pH 6-11, colony morphological characteristics similar to those under acid stress of pH 4-5 can also be observed under neutral or weak alkaline conditions of pH 6-9, such as Figure 4 As shown in A. The EGT production of the pH 7 stress treatment group reached 424.66 mg / L, an increase of 40.69% compared with the control group. Figure 3 As shown in B. The polypeptide content in the pH 7 treatment group was 5.88 g / L, which was 23.53% higher than that in the control group (4.76 g / L). Figure 4 As shown in Figure C. Therefore, moderate alkaline stress can also effectively promote the accumulation of EGT and polypeptides in P. citrinum NJ01, which has good regulatory potential.

[0062] Example 4 Effects of acid stress on fermentation products of Pleurotus citrinopileatus NJ01 at different times The NJ01 strain of Pleurotus citrinopileatus, which was screened by ARTP mutagenesis, was selected as a high-yield ergothioneine strain. In order to further explore the effect of acid-base stress on the fermentation process of Pleurotus citrinopileatus, this study designed acid stress at different times based on the results of previous experiments on acid-base stress at different concentrations. The second generation seeds were inoculated into FP fermentation medium, and the pH of the medium was adjusted to 4 at 72, 96, and 120 hours of fermentation, respectively. The fermentation culture was continued for 168 hours, and the EGT yield and polypeptide yield in the product were calculated. The results are as follows: Figure 5 shown.

[0063] from Figure 5As shown in Figure A, the best effect of acid stress on Pleurotus citriodora NJ01 was achieved at the 120th hour of fermentation, with the highest EGT yield reaching 458.36 mg / L, a 51.05% increase compared to the control group (303.44 mg / L). The highest polypeptide content was also achieved at the 120th hour of fermentation when acid stress was applied, reaching 5.84 g / L, a 26.13% increase compared to the control group (4.63 g / L). Figure 5 Therefore, the present invention not only clarifies the optimal intervention time point of acid stress, but also significantly improves the synthesis efficiency of the target product.

[0064] Example 5 Effects of alkaline stress on fermentation products of Pleurotus citrinopileatus NJ01 at different times The NJ01 strain of Pleurotus citrinopileatus, which was screened by ARTP mutagenesis, was selected as a high-yield ergothioneine strain. The second-generation seeds were inoculated into FP fermentation medium. The pH of the medium was adjusted to 7 at 72, 96, and 120 h of fermentation, and the fermentation culture was continued for 168 h. The EGT yield and polypeptide yield of the fermentation product were calculated. Figure 6 shown.

[0065] from Figure 6 As shown in A, the best effect of alkaline stress on Pleurotus citriodora NJ01 was achieved at the 72nd hour of fermentation, with the highest EGT yield reaching 395.69 mg / L, a 30.40% increase compared to the control group (303.44 mg / L). The polypeptide content was also the highest at the 72nd hour of fermentation when alkaline stress was applied, reaching 5.86 g / L, a 26.57% increase compared to the control group (4.63 g / L). Figure 6 Therefore, the present invention not only clarifies the optimal intervention time point of acid stress, but also significantly improves the synthesis efficiency of the target product.

[0066] Example 7 Expanded Culture of Pleurotus citrinopileatus NJ01 In this embodiment, a two-stage seed culture method was used to propagate Pleurotus citrinopileatus NJ01. First, the mycelium stored on a plate was broken and inoculated into 100 mL of seed culture medium (contained in a 250 mL conical flask). After culturing for 5-7 days, the culture was transferred to a fresh seed culture of the same volume and cultured for another 3 days to obtain a highly active secondary seed solution.

[0067] Subsequently, 600 mL of the secondary seed solution was inoculated into a 5-L fermenter containing 3 L of FP fermentation medium (plus 1 mL of defoamer). Fermentation conditions were set at a constant temperature of 25°C and a stirring speed of 300 rpm. After 7 days of continuous culture, the cells were harvested. A separate acid-base stress strategy was applied to a fermenter using wheat bran as a carbon source, subjecting Pleurotus citrinopileatus NJ01 to a dual-stage acid-base stress. At 72 hours of fermentation, the pH of the fermenter was adjusted to 7.1 to induce alkaline stress. Subsequently, at 120 hours of fermentation, the pH was adjusted to 4.2 to induce acid stress. Fermentation continued for 168 hours, at which point the cells were harvested for later use.

[0068] The results are as follows Figure 7 As shown in the figure, under fermentation conditions, the EGT yield of Pleurotus citrinopileatus NJ01 reached 560 mg / L. Results from dual-stage acid-base stress showed that the EGT yield of Pleurotus citrinopileatus NJ01 reached 741.38 mg / L, a 32.39% increase compared to the non-stressed fermentation group. After centrifugation and removal of the supernatant from 2.8 L of fermentation broth obtained under stress conditions, 346.38 g of wet cells were obtained. After freeze-drying, 48.36 g of mushroom powder was obtained, corresponding to a dry weight of 17.27 g / L. Calculated on a dry weight basis, the EGT yield was 42.93 g / kg.

[0069] The NJ 01 mushroom cells collected from the fermentation tank were freeze-dried and ground to obtain NJ01 mushroom powder. The mushroom powder was pretreated using ultrasound-coupled sodium bisulfite-assisted cell wall-breaking enzyme method. The specific process is as follows: The dissolved Pleurotus citriodora powder was subjected to physical ultrasonic treatment at a power of 65 W for 30 min, and then subjected to physical pretreatment by mechanical crushing at 5000 rpm and 3 min using a handheld homogenizer shear, and 0.3 g of sodium bisulfite was added at a 10% mass ratio. Subsequently, the pH was adjusted to 4 and cellulase and pectinase were added in a ratio of 1:1, with the amount of enzyme added being 0.15 g. After enzymatic hydrolysis for 4 h, the enzymes were inactivated. Next, the pH was adjusted to 9 and composite protease was added, with the amount of enzyme added being 0.3 g. After enzymatic hydrolysis for 6 h, the enzymes were inactivated, as a physical / chemical / biological pretreatment coupled extraction method. Finally, after centrifugation, the crude extract was prepared, and the protein and polypeptide contents were detected by the BCA method, the peptide molecular weight distribution was detected by HPLC, and the hypoglycemic activity was detected using an α-glucosidase activity detection kit. The results are as follows: Figure 8 shown.

[0070] from Figure 8Compared with the control group, ultrasound-coupled sodium bisulfite-assisted enzyme pretreatment increased protein and peptide contents by 2.74-fold and 3.84-fold, reaching 13.06 and 6.05 g / L, respectively. The proportion of active peptides (180 Da < MW < 500 Da) reached 69.84%, and the glucosidase inhibition rate reached 25.23%, demonstrating its in vitro hypoglycemic efficacy. The peptide freeze-drying yield significantly increased from 5.69% to 27.53%.

[0071] The present invention has been disclosed above with preferred embodiments, which are not intended to limit the present invention. Any technical solutions obtained by adopting equivalent replacement or equivalent transformation solutions fall within the protection scope of the present invention.

Claims

1. A Pleurotus citriodora strain for co-producing thioneine and polypeptide, characterized in that: The strain was deposited in Guangdong Provincial Microbiological Culture Collection Center on June 13, 2025, with the deposit number: GDMCC NO. 66504.

2. the Pleurotus citriodora strain of co-producing thioneine and polypeptide according to claim 1, is characterized in that: The complete ITSrDNA sequence of the strain is shown in SEQ ID NO:

1.

3. the application of the Pleurotus citriodora strain described in any one of claim 1-2 in producing thioneine and polypeptide.

4. prepare the method for thioneine and polypeptide, it is characterized in that: The Pleurotus citrinopileatus strain according to any one of claims 1 to 2 is fermented to obtain ergothioneine and a polypeptide.

5. The method according to claim 4, characterized in that: The carbon source used in the fermentation process is bran.

6. The method according to claim 4, characterized in that: The pH value of the culture medium was adjusted to 4.0-5.0 at 96-120 hours of fermentation treatment, or the pH value of the culture medium was adjusted to 8.0-9.0 at 72-96 hours of fermentation treatment to perform stress treatment.

7. The method according to claim 4, characterized in that: The pH value of the culture medium was adjusted to 7.0-9.0 at 72-96 hours of the fermentation treatment, and the pH value of the culture medium was adjusted to 4.0-5.0 at 120-144 hours of the fermentation treatment.

Citation Information

Patent Citations

  • Method for producing L-ergothioneine through combined fermentation of pleurotus citrinopileatus and tricholoma matsutake mycelia

    CN112195215A

  • Method for synthesizing ergothioneine and organic selenium through liquid state fermentation of pleurotus tuber-regium mycelium

    CN116574766A

  • Method for improving production efficiency of ergothioneine through two-stage regulation and control

    CN116769850A

  • High-antioxidant-activity extract in pleurotus citrinopileatus and preparation method of high-antioxidant-activity extract

    CN117737150A

  • Mushroom fermentation liquor containing ergothioneine as well as preparation method and application of mushroom fermentation liquor

    CN118086419A