Lactobacillus plantarum antagonizing clostridium perfringens and application thereof

By screening out Lactobacillus plantarum WL-81 strains with strong antibacterial and acid-producing abilities, it was applied to livestock and poultry feed, and the intestinal diseases caused by Clostridium perfringens and Salmonella were solved, and the disease resistance and production performance of livestock and poultry were improved.

CN120485019AActive Publication Date: 2025-08-15SHANDONG VLAND BIOTECH CO LTD +2
View PDF 9 Cites 0 Cited by

Patent Information

Application Number
CN202510551953.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-29
Publication Date
2025-08-15
Estimated Expiration
2045-04-29

AI Technical Summary

Technical Problem

The prior art is difficult to effectively prevent and treat necrotic enteritis in livestock and poultry caused by Clostridium perfringens and inflammatory intestinal diseases caused by Salmonella, resulting in decline in livestock and poultry production performance and economic losses.

Method used

A strain of Lactobacillus plantarum WL-81 was screened, which has significant antibacterial and acid-producing ability. It is used to prepare probiotic preparations, compound with other probiotics, and is used in livestock and poultry feed to regulate intestinal flora, inhibit pathogens, and improve intestinal health.

Benefits of technology

Significantly improve the disease resistance of livestock and poultry, improve production performance, reduce mortality and intestinal damage, maintain stability of intestinal flora, increase daily weight gain and reduce material-weight ratio.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention belongs to the technical field of functional microorganism screening and application, and particularly relates to lactobacillus plantarum antagonizing clostridium perfringens and application of the lactobacillus plantarum. The lactobacillus plantarum is screened from intestinal contents of cherry valley meat ducks and is preserved in China Center for Type Culture Collection in Wuhan University, Wuhan, China on January 16, 2025, and the preservation number is CCTCC NO: M2025167. The strain has a remarkable inhibition effect on various pathogenic bacteria, is high in metabolic acid production capacity, can effectively improve the disease resistance of livestock and poultry and improve the breeding performance of the livestock and poultry, and is wide in application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of functional microorganism screening and application, and in particular to a Lactobacillus plantarum antagonistic to Clostridium perfringens and an application thereof. Background Art

[0002] In recent years, with the advent of antibiotic restrictions and bans, maintaining intestinal health and overall animal well-being in large-scale livestock farming has become a significant challenge for the livestock industry. Diseases such as diarrhea, necrotic enterocolitis, pseudomembranous enterocolitis, and sepsis often lead to a series of economic losses. Preventing and reducing the outbreak of intestinal diseases is a key challenge that requires significant attention and effort to overcome during the farming process.

[0003] Clostridium perfringens is considered the most widespread pathogenic microorganism in nature, ubiquitously present in the animal intestines. It is known to cause necrotic enteritis in a variety of farmed animals, including livestock and poultry. Therefore, prevention and control of this bacterium is extremely important. Research has shown that C. perfringens is the most common clostridium species clinically responsible for gas gangrene. It breaks down sugars in muscle and connective tissue, producing large amounts of gas, leading to severe tissue emphysema, which in turn affects blood supply and causes extensive tissue necrosis. In fact, in the intestinal tract of livestock and poultry, infection with C. perfringens by the α- and β-toxins it produces increases the inflammatory response in the intestinal mucosa. This not only impairs nutrient absorption but also increases the body's depletion of immune defense resources, leading to severe necrotic enteritis and other diseases. This disease reduces livestock performance, increases mortality, and raises treatment costs, resulting in tens of billions of dollars in economic losses to the livestock and poultry industry annually.

[0004] Most Salmonella bacteria are pathogenic to humans and animals. They can survive for months or even years in carriers such as feces, sewage, and contaminated meat and egg products, spreading between humans and animals, and between animals. Experimental studies (Yang et al., 2017) have shown that repeated low-dose Salmonella infections can eventually cause diarrhea or chronic enteritis in livestock and poultry. This also provides evidence that pathogens can cause inflammatory bowel disease.

[0005] After decades of exploration into prevention and treatment options for various pathogenic bacterial infections, probiotics, as sustainable and green microecological preparations, have been demonstrated to alleviate conditions such as irritable bowel syndrome and necrotizing enterocolitis by regulating intestinal flora (Moayyedi et al., 2010). Lactic acid bacteria, as an important class of probiotics, have several mechanisms of action: 1) They metabolize and produce a variety of antimicrobial substances, such as organic acids and antimicrobial peptides, exhibiting a potent inhibitory effect against intestinal pathogens; 2) they inhibit the adhesion of pathogens to intestinal epithelial cells; 3) they regulate the expression of tight junction proteins, maintaining the integrity of the intestinal epithelial barrier; and 4) they modulate nonspecific immunity and control inflammatory responses.

[0006] However, not all bacteria have the ability to regulate intestinal flora and intervene in related diseases; their effects vary at the species and strain levels. Lactic acid bacteria strains that demonstrate antagonism against multiple pathogenic bacteria, such as Clostridium perfringens and Salmonella, have attracted considerable attention. Therefore, screening for probiotic strains with multiple inhibitory effects on pathogens is crucial to improving the prevention and treatment of intestinal diseases in the livestock and poultry industry and contributing to the green development of livestock and poultry farming. Summary of the Invention

[0007] To address existing technical issues, the present invention provides a Lactobacillus plantarum strain that antagonizes Clostridium perfringens and its use. The strain, screened from the intestinal contents of Cherry Valley ducks, exhibits significant inhibitory effects against various pathogens and possesses a strong metabolic acid production capacity. This strain can effectively enhance the disease resistance of livestock and poultry, improving livestock and poultry breeding performance and possessing broad application prospects.

[0008] On the one hand, the present invention provides a plant lactobacillus, which is Lactobacillus plantarum WL-81 (Lactobacillus plantarum WL-81), which has been deposited in the China Center for Type Culture Collection of Wuhan University, Wuhan, China on January 16, 2025, and its deposit number is CCTCC NO: M 2025167.

[0009] The 16SrDNA sequence of the Lactobacillus plantarum is SEQ ID NO: 1.

[0010] In one aspect, the present invention provides application of the Lactobacillus plantarum in feed production.

[0011] In one aspect, the present invention provides the use of the Lactobacillus plantarum in the preparation of a Clostridium perfringens inhibitor.

[0012] The present invention also provides a probiotic preparation comprising the above-mentioned Lactobacillus plantarum.

[0013] The probiotic preparation further comprises any one or more of Bacillus licheniformis, Bacillus subtilis, Bacillus pumilus, Bacillus amyloliquefaciens, Bacillus coagulans, Enterococcus lactis, Clostridium butyricum, Saccharomyces cerevisiae, Enterococcus faecalis, Bifidobacterium, Enterococcus faecium, Pediococcus acidilactici, and Lactobacillus acidophilus.

[0014] The amount of live bacteria of plant lactobacillus in the probiotic agent is not less than 10 8 CFU / g.

[0015] The present invention also provides application of the probiotic preparation in feed production.

[0016] The plant lactobacillus WL-81 provided by the present invention has a strong acid-producing ability, and its fermentation metabolites mainly include three organic acids, among which lactic acid has the highest content, reaching 18.40 g / L, and the contents of acetic acid and propionic acid are 5.96 g / L and 6.64 g / L, respectively.

[0017] Lactobacillus plantarum WL-81 has a very significant inhibitory effect on a variety of pathogens. Among them, the diameters of the inhibition zones of duck-derived Escherichia coli, pig-derived Escherichia coli, Salmonella pullorum, chicken Clostridium perfringens, pig-derived Clostridium perfringens, and Clostridium perfringens are all over 20mm. It has the strongest inhibitory effect on pig-derived Clostridium perfringens B3, with an inhibition zone diameter of up to 24.6mm, achieving unexpected technical results.

[0018] Lactobacillus plantarum WL-81 has a strong antioxidant capacity. Its bacteria and supernatant can significantly scavenge DPPH free radicals and hydroxyl free radicals (p<0.05), with degradation rates reaching 92.75% and 70.38%, respectively. It also has a certain scavenging effect on superoxide anion free radicals, with a degradation rate of 55.19%.

[0019] Lactobacillus plantarum WL-81 significantly reduces the impact of Clostridium perfringens on broiler chickens, improving production performance, reducing broiler mortality, and reducing intestinal damage, thereby maintaining a stable intestinal flora and overall health. Compared to the infected group, broilers fed Lactobacillus plantarum WL-81 powder increased average daily weight gain by 12.83% (p<0.05), reduced feed-to-gain ratio and mortality by 2.76% and 7.61%, respectively. Broilers also experienced fewer intestinal bleeding sites and milder intestinal damage. The abundance of Clostridium perfringens and Enterobacteriaceae decreased, while Lactobacillus bacteria significantly increased, demonstrating a highly significant effect.

[0020] The Lactobacillus plantarum WL-81 provided by the present invention can be used alone or in combination with other probiotics and widely used in livestock and poultry feed production, effectively improving the production performance of farmed animals and maintaining their health, with broad prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1This is the colony morphology of Lactobacillus plantarum WL-81;

[0022] Figure 2 is the Gram staining image of Lactobacillus plantarum WL-81;

[0023] Figure 3 This is the organic acid chromatogram of Lactobacillus plantarum WL-81;

[0024] Figure 4 A picture of Lactobacillus plantarum WL-81 adhering to Caco-2 cells. DETAILED DESCRIPTION

[0025] The present invention will be further described below with reference to specific examples. For the specific methods or materials used in the examples, those skilled in the art can make conventional replacements based on the technical ideas of the present invention and existing technologies, and are not limited to the specific description of the examples of the present invention.

[0026] The MRS medium described in the embodiment of the present invention is prepared as follows: 20.0 g of glucose, 10.0 g of peptone, 10.0 g of yeast powder, 5.0 g of sodium acetate, 1.0 ml of Tween 80, 2.0 g of dipotassium hydrogen phosphate, 2.0 g of triammonium citrate, 0.2 g of magnesium sulfate, 0.05 g of manganese sulfate, 1000 ml of distilled water, pH 6.2 ± 0.2, sterilized at 121° C. for 15 min, and 15 g of agar was added to the solid medium.

[0027] Example 1 Isolation and screening of strains

[0028] 1.1 Sample collection

[0029] The cecal contents of healthy Cherry Valley broiler ducks from Pingdu Farm in Qingdao City, Shandong Province were collected, placed in sterile sampling bags, and stored in a refrigerator.

[0030] 1.2 Separation and screening

[0031] Take 25 g of cecal contents and place them in a sterile Erlenmeyer flask. Add 225 ml of sterile saline and shake to prepare a suspension. Dilute the suspension stepwise in a 10-fold gradient to the appropriate concentration. Select the last three concentrations of dilution for plating. Use a sterile pipette tip to draw 100 μL of each concentration of dilution. Spread each concentration on two MRS medium plates containing 0.05% calcium carbonate and incubate at 37°C for 48 hours.

[0032] Utilizing the principle that lactic acid bacteria dissolve calcium salts after producing acid, smooth colonies containing transparent circles were observed to form on the plate. After initial screening and culture, 8 colonies were obtained and named R1, R2, R3... to R8, which were further picked and purified by streaking.

[0033] Evaluation of bacterial growth performance: The faster the lactic acid bacteria grow, the shorter the time it takes for metabolic acid production to lower the culture medium pH. Strains R1, R2, R3, ..., through R8 were inoculated into liquid MRS medium and incubated at 37°C. The medium pH was measured every 4 hours. Sterile liquid MRS medium served as a blank control. The experimental results are shown in Table 1.

[0034] Table 1 Growth of bacterial cells in liquid culture

[0035]

[0036]

[0037] From the results in Table 1, it can be seen that among the 8 strains screened by the present invention, strain R5 performed the best. In the liquid expansion stage, the pH of the culture medium can be reduced to 3.9 within 24 hours, indicating that strain R5 has the advantages of rapid proliferation and significant acid production.

[0038] The applicant named strain R5 WL-81 and further conducted identification and performance evaluation.

[0039] Example 2 Identification of WL-81 strain

[0040] 2.1 Colony morphology and microscopic characteristics

[0041] Streak the WL-81 strain on solid MRS medium and culture for 45-48 hours. Figure 1 As shown, the colonies are about 2-4 mm in diameter, appearing as opaque colonies, light yellow or milky yellow, with a smooth surface and no wrinkles on the edges.

[0042] The Gram staining results of strain WL-81 are as follows Figure 2 As shown, the strain was Gram-positive and had two pairs of short rods.

[0043] 2.2 Physiological and biochemical characteristics

[0044] The WL-81 strain was cultured on solid MRS medium for 45-48 hours. Single colonies were selected and assayed according to the instructions for the Biomerieux API bacterial reagent strips. After 24 hours of incubation, statistical analysis was performed, and physiological and biochemical characteristics of the strain were analyzed. The results are shown in Table 2.

[0045] Table 2 Physiological and biochemical characteristics of strain WL-81

[0046]

[0047]

[0048] Note: +: positive reaction; -: negative reaction; W: weak positive reaction.

[0049] 2.3 16S rDNA molecular identification

[0050] The genome of strain WL-81 was extracted using a kit. The 16S rDNA sequence was amplified using PCR using this genome as a template. The amplified PCR product was subjected to 1% agarose gel electrophoresis and then sent to a sequencing company for sequencing.

[0051] Experimental primer sequences: 27F: AGAGTTTGATCCTGGCTCA; 1492R: GGTTACCTT GTTA CGACTT.

[0052] The results showed that the 16S rDNA sequence of strain WL-81 was SEQ ID NO: 1, with a length of 1462 bp. The specific sequence is as follows:

[0053]

[0054] By performing BLAST comparison on SEQ ID NO: 1 in the NCBI database, it was found that the similarity between the strain WL-81 and Lactobacillus plantarum was 99.89%. Therefore, the strain WL-81 was preliminarily determined to be Lactobacillus plantarum.

[0055] 2.4 MALDI-TOF-MS protein spectrum identification

[0056] A small number of newly activated WL-81 colonies were spread onto a target plate as a thin film. 1 μL of lysis buffer from the mass spectrometry sample pretreatment kit was added, and the plate was allowed to air dry at room temperature. 1 μL of matrix solution from the mass spectrometry sample pretreatment kit was added to the sample, and the plate was allowed to air dry at room temperature. The target sample was then placed in a mass spectrometer for identification. The identification results showed that strain WL-81 was Lactobacillus plantarum.

[0057] Based on the above analysis, the applicants identified strain WL-81 using two molecular biology methods: 16S rRNA sequencing and MALDI-TOF-MS protein spectrometry. The identification results were consistent. Combined with the colony morphology and microscopic characteristics of strain WL-81, the applicants determined that the strain was Lactobacillus plantarum and named it Lactobacillus plantarum WL-81.

[0058] The applicant deposited the above-mentioned Lactobacillus plantarum WL-81 (Lactobacillus plantarum WL-81) with the China Center for Type Culture Collection of Wuhan University, Wuhan, China on January 16, 2025, and its deposit number is CCTCC NO: M2025167.

[0059] Example 3 Evaluation of the Acid Production Capacity of Lactobacillus plantarum WL-81

[0060] 3.1 Preparation of test bacterial solution

[0061] Lactobacillus plantarum WL-81 was inoculated into MRS medium, cultured at 37°C for 48 h, centrifuged at 10,000 rpm for 5 min, and the supernatant was collected and passed through a 0.22 μm filter for later use.

[0062] Comparison: Commercially available Lactobacillus plantarum samples were inoculated into MRS medium, cultured at 37°C for 48 h, centrifuged at 10,000 rpm for 5 min, and the supernatant was collected and filtered through a 0.22 μm filter for later use.

[0063] 3.2 Analysis of acid production capacity of Lactobacillus plantarum WL-81

[0064] Organic acids in the supernatant were quantitatively analyzed using high performance liquid chromatography (HPLC) with a UV detector at 210 nm and a mobile phase of 0.1% phosphoric acid in water. Blank MRS medium was filtered through a 0.22 μm filter before loading and used as a blank control. The results are shown in Tables 3 and Figure 3 .

[0065] Table 3 Analysis of acid production by fermentation of Lactobacillus plantarum WL-81

[0066]

[0067] Depend on Figure 3 As shown in Table 3, the Lactobacillus plantarum WL-81 strain provided by the present invention has a strong acid production capacity. The fermentation metabolites of this strain mainly include three organic acids, among which lactic acid accounts for the highest content, reaching 18.40 g / L, and the contents of acetic acid and propionic acid are 5.96 g / L and 6.64 g / L, respectively.

[0068] Example 4 Evaluation of the antibacterial ability of Lactobacillus plantarum WL-81

[0069] 4.1 Preparation of test bacterial solution

[0070] The Lactobacillus plantarum WL-81 colony was picked and inoculated into MRS medium, and cultured at 37°C for 48 h to obtain a bacterial solution.

[0071] 4.2 Preparation of pathogen solution

[0072] Seven strains of Escherichia coli ATCC 25922, Staphylococcus aureus ATCC 6538, duck-derived E. coli 2568, porcine E. coli 2721, Salmonella pullorum BY8384, chicken-derived Salmonella, and porcine Salmonella were inoculated into nutrient broth and cultured overnight at 37°C, 220 rpm. Clostridium perfringens BNCC 125404 from chicken, Clostridium perfringens B3 from porcine, Clostridium perfringens ATCC 13124, Clostridium perfringens CICC 25011, and Clostridium difficile CICC 22951 were inoculated into commercially available fortified Clostridial medium and cultured anaerobically at 37°C overnight. Riemerella anatipestifer R2 was inoculated into TSB medium (supplemented with 4% serum) and cultured overnight at 37°C, 220 rpm. Pasteurella multocida BNCC270568 was spread on Columbia blood agar plates, and after colonies were well grown, the plates were rinsed with sterile water and resuspended for later use.

[0073] Before the antibacterial experiment, each cultured pathogen was diluted 100 times with sterile water to serve as the pathogen working suspension.

[0074] 4.3 Evaluation of antibacterial ability

[0075] Preparation of pathogen-containing plates: Pour about 18-20 mL of sterile nutrient agar medium into each plate, spread the medium evenly, and place it on a horizontal surface to solidify. Pipette 100 μL of the pathogen working suspension and disperse it on the surface of the medium, then spread it evenly with glass beads. Use a hole punch to punch holes in the plate, pick out the excess medium, and heat it briefly over the flame of an alcohol lamp to seal the plate.

[0076] Test sample loading: 100 μL of Lactobacillus plantarum WL-81 bacterial suspension was pipetted into the sample wells. The wells were allowed to dry, then incubated at 37°C for 24 hours. The diameter of the inhibition zone was measured. Sterile MRS medium was used as a blank control. The experimental results are shown in Table 4.

[0077] Table 4 Antibacterial effect of Lactobacillus plantarum WL-81 on pathogens

[0078]

[0079]

[0080] From the results in Table 4, it can be seen that the plant lactobacillus WL-81 screened out by the present invention has a very significant inhibitory effect on a variety of pathogens. Among them, the inhibition zone diameters of duck-derived Escherichia coli, porcine-derived Escherichia coli, Salmonella pullorum, chicken Clostridium perfringens, porcine Clostridium perfringens, and Clostridium perfringens are all over 20 mm. The strongest inhibitory effect is on porcine Clostridium perfringens B3, with an inhibition zone diameter of up to 24.6 mm, achieving unexpected technical effects.

[0081] Example 5 Determination of the Antioxidant Capacity of Lactobacillus plantarum WL-81 in Vitro

[0082] 5.1 Preparation of test samples

[0083] Lactobacillus plantarum WL-81 was inoculated into MRS medium and cultured at 37°C for 48 hours. The supernatant was separated from the cells by centrifugation at 10,000 rpm for 5 minutes. The supernatant was collected as the experimental supernatant group. The cells were collected and washed twice with sterile water to prepare a bacterial suspension, which was used as the experimental cell group.

[0084] 5.2 DPPH free radical scavenging ability determination

[0085] Take 1 mL of sample and 1 mL of DPPH free radical solution (0.2 mmol / L, dissolved in anhydrous ethanol), mix thoroughly, react in the dark for 30 minutes, and measure the absorbance at 517 nm and record it as A. 样品 In the control group, 1 mL of anhydrous ethanol was used instead of DPPH free radical solution, and the absorbance value was recorded as A 对照In the blank group, 1 mL of anhydrous ethanol was used instead of the sample solution, and the absorbance value was recorded as A 空白 DPPH free radical scavenging rate % = [1-(A 样品 -A 对照 ) / A 空白 ]×100%.

[0086] 5.3 Hydroxyl radical scavenging ability determination

[0087] Take 1mL of 0.02mol / L PBS (pH=7.4) in a test tube, add 1mL of 2.5mmol / L o-phenanthroline and 1mL of deionized water in sequence, mix thoroughly, add 1mL of 2.5mmol / L FeSO4 solution, mix thoroughly (mix immediately after adding FeSO4 to each tube). Then add 1mL of sample solution and 1mL of 20mmol / L H2O2 solution, incubate in a 37℃ water bath for 1.5h, remove and immediately place in an ice bath. Measure the absorbance at 536nm and record it as A 样品 , deionized water was used to replace the sample solution, and the absorbance was measured at 536 nm, which was recorded as A 损伤 , deionized water was used to replace the sample and H2O2 solution, and the absorbance was measured at 536 nm, which was recorded as A 未损伤 .

[0088] Hydroxyl radical scavenging rate % = [(A 样品 -A 损伤 ) / (A 未损伤 -A 损伤 )]×100%.

[0089] 5.4 Determination of superoxide anion free radical scavenging ability

[0090] Take 1 mL of sample, add 0.5 mL 300 μmol / L tetrazolium blue (NBT), 0.3 mL 468 μmol / L reduced coenzyme (NADH) and 0.5 mL 60 μmol / L phenazine methyl sulfate (PMS) in sequence, mix thoroughly, place in a 25 ° C water bath for 5 minutes, and measure the absorbance at 560 nm, which is recorded as A 样品 , the blank tube was replaced with 50mmol / L Tris-HCl buffer solution (pH=8.0) instead of the sample solution, and the absorbance value was measured at 560nm, which was recorded as A 空白 All the above reagents were prepared using Tris-HCl buffer solution.

[0091] Superoxide anion free radical scavenging rate (%) = (1-A 样品 / A 空白 )×100%.

[0092] The results are shown in Table 5.

[0093] Table 5 Determination of in vitro antioxidant capacity of Lactobacillus plantarum WL-81

[0094]

[0095] As shown in Table 5, the plant lactobacillus WL-81 provided by the present invention has a strong antioxidant capacity. Its bacteria and supernatant can significantly scavenge DPPH free radicals and hydroxyl free radicals (p < 0.05), with degradation rates reaching 92.75% and 70.38%, respectively. It also has a certain scavenging effect on superoxide anion free radicals, with a degradation rate of 55.19%.

[0096] Example 6 Evaluation of the Adhesion Ability of Lactobacillus plantarum WL-81 Cells

[0097] 6.1 Preparation of test bacteria

[0098] Lactobacillus plantarum WL-81 was activated for three generations in MRS medium, centrifuged at 10,000 rpm for 5 minutes, and the cells were collected. The cells were washed twice with sterile phosphate buffered saline (PBS, pH 7.2) and then resuspended in sterile PBS.

[0099] 6.2 Caco-2 cell culture

[0100] Caco-2 cells were cultured in DMEM supplemented with 20% heat-inactivated (30 min, 56°C) fetal bovine serum and 1% penicillin-streptomycin. Caco-2 cells were cultured in a CO2 incubator at 37°C, with the medium changed every day.

[0101] 6.3 Adhesion test

[0102] Caco-2 cells were cultured in a CO2 incubator in 6-well plates until they formed a monolayer, after which adhesion assays were performed. The plates were washed twice with sterile PBS, and 1 mL of a Lactobacillus plantarum WL-81 suspension was added. The plates were then incubated at 37°C in a CO2 incubator for 2 h. The suspension was then removed and washed four times with sterile PBS to remove unadhered cells. After digestion with 500 μL of trypsin for 3 min, 1.5 mL of cell culture stop buffer was added for digestion. The plates were then agitated repeatedly, and serial dilutions were performed before plate counts.

[0103] Adhesion capacity = total number of adhered bacteria in each culture well / total number of cells in each culture well.

[0104] Table 6 Adhesion of Lactobacillus plantarum WL-81 to Caco-2 cells

[0105]

[0106] From Table 6, we can see that Lactobacillus plantarum WL-81 has a certain adhesion ability to cells. Figure 4As shown, Lactobacillus plantarum WL-81 bacteria adhere to the surface of Caco-2 cells, which helps the bacteria colonize in the intestine and exert a probiotic effect.

[0107] Example 7 Preparation of freeze-dried powder of Lactobacillus plantarum WL-81

[0108] 7.1 Preparation of freeze-dried bacterial powder

[0109] Bacterial liquid collection: The Lactobacillus plantarum WL-81 bacterial liquid cultured in Example 3 was divided into sample bottles and refrigerated at 4°C to keep the bacterial liquid fresh;

[0110] Centrifugation of bacteria: Set the centrifugation conditions to 8000 rpm for 10 min. After the bacterial solution is centrifuged, discard the supernatant and collect the Lactobacillus plantarum WL-81 bacteria for later use;

[0111] Freeze drying: In this example, peptone and glucose were selected as carriers, mixed with the collected Lactobacillus plantarum WL-81 cells in a ratio of 3:1, and placed in a vacuum freeze dryer for freeze drying. After freeze drying, Lactobacillus plantarum WL-81 powder was obtained.

[0112] Determination of bacterial count: Weigh 1 g of Lactobacillus plantarum WL-81 powder, add 9 mL of sterile water, shake and mix, dilute with sterile water in a 10-fold gradient, and count the number of bacteria using the MRS agar pouring method. The number of viable bacteria in the powder was 1.00 × 10 11 CFU / g.

[0113] 7.2 Determination of stability of freeze-dried bacterial powder

[0114] The freeze-dried Lactobacillus plantarum WL-81 powder was divided into 5 equal parts, sealed in aluminum foil bags, and stored in a medical refrigerator (4-8°C). Samples were taken regularly every 3 months to determine the bacterial count and test the stability of the powder.

[0115] The results showed that the freeze-dried bacterial powder of Lactobacillus plantarum WL-81 was prepared by vacuum freeze-drying. During the storage at 4-8°C, counting errors were eliminated, the overall amount of the freeze-dried bacterial powder remained stable, and the survival rate was still as high as 98.5% after 12 months of storage.

[0116] Example 8 Effect of Lactobacillus plantarum WL-81 on the Growth of Broiler Chickens Infected with Clostridium perfringens

[0117] 8.1 Experimental Design

[0118] The experiment involved 252 one-day-old AA broiler chicks purchased from a hatchery and randomly divided into three treatment groups, with six replicates in each group and 14 chicks in each replicate. The three treatment groups were a control group, an infection group, and a Lactobacillus plantarum group. Throughout the experiment, the control and infection groups were fed a corn-soybean meal basal diet, while the Lactobacillus plantarum group was supplemented with 1×10 9 CFU / kg Lactobacillus plantarum WL-81 powder.

[0119] The broilers in the infection group and Lactobacillus plantarum group were orally administered with Clostridium perfringens CVCC2030 solution (1×10 8 CFU / mL), with each chicken inoculated with 1 mL daily. Broiler chickens in the control group were gavaged with 1 mL of sterile broth daily. The experimental period was 21 days.

[0120] 8.2 Growth performance statistics

[0121] At 1, 14, and 21 days of age, broiler chickens were weighed, feed intake and mortality were recorded, and data from 14 to 21 days of age were calculated.

[0122] Table 7 Effects of Lactobacillus plantarum WL-81 on the growth performance of broiler chickens at 14-21 days of age

[0123]

[0124]

[0125] As shown in Table 7, compared with the control group, the growth of broiler chickens was affected to a certain extent after infection with Clostridium perfringens. Compared with the infected group, the average daily weight gain of broiler chickens fed with Lactobacillus plantarum WL-81 powder increased by 12.83% (p < 0.05), and the feed-to-weight ratio and mortality rate decreased by 2.76% and 7.61%, respectively. This shows that the Lactobacillus plantarum WL-81 provided by the present invention can significantly reduce the impact of Clostridium perfringens on broiler chickens, reduce broiler mortality, and improve production performance.

[0126] 8.3 Intestinal injury score

[0127] At 21 days of age, seven birds were randomly selected from each treatment and sacrificed by intravenous exsanguination. The abdominal cavity was opened, and the pathological changes in the jejunum and ileum were observed visually. The severity of intestinal damage was scored on a five-point scale (0-3) (Dahiya et al., 2005), namely 0 (no obvious damage); 0.5 (severe congestion of the serosal surface and mesentery of the small intestine); 1 (thinning and brittle intestinal wall with red petechiae); 2 (gas in the intestinal lumen, with pinpoint necrosis or ulceration of the intestinal wall); and 3 (gas-filled intestinal lumen, with patchy necrosis or ulceration of the intestinal wall).

[0128] Table 8 Effects of Lactobacillus plantarum WL-81 on the intestinal tract of 21-day-old broiler chickens infected with Clostridium perfringens

[0129]

[0130] As shown in the intestinal lesion scores in Table 8, the broiler chickens in the control group showed essentially no significant intestinal lesions. In the infected group, most broiler chickens showed mucosal detachment and scattered bleeding spots in the duodenum and jejunum, and some broilers experienced intestinal flatulence. However, broiler chickens fed Lactobacillus plantarum WL-81 powder showed fewer bleeding spots and milder intestinal lesions than the infected group. This indicates that Lactobacillus plantarum WL-81 can significantly reduce intestinal lesions in broiler chickens infected with Clostridium perfringens.

[0131] 8.4 Intestinal microbial analysis

[0132] The qRT-PCR method (Du et al., 2015) was used to count Clostridium perfringens, Enterobacteriaceae, and Lactobacilli in intestinal chyme. Total DNA was extracted from chyme as a template, and the primer sequences were:

[0133] Clostridium perfringens F (5'-3'):AAAGATGGCATCATCATTCAAC;

[0134] R(5'-3'):TACCGTCATTATCTTCCCCAAA;

[0135] Enterobacteriaceae group F (5′-3′):GTTAATACCTTTGCTCATTGA;

[0136] R(5'-3'):ACCAGGGTATCTAATCCTGT;

[0137] Lactobacillus group F (5'-3'): AGCAGTAGGGAATCTTCCA;

[0138] R(5'-3'):CACCGCTACACATGGAG.

[0139] The results showed that compared with the control group, broiler chickens infected with Clostridium perfringens had significantly increased numbers of Clostridium perfringens and Enterobacteriaceae in their intestines (p<0.05), while Lactobacillus counts decreased significantly. Compared with the infected group, broiler chickens fed Lactobacillus plantarum WL-81 powder had significantly decreased numbers of Clostridium perfringens and Enterobacteriaceae in their intestines, while Lactobacillus counts increased significantly. This suggests that Lactobacillus plantarum WL-81 significantly helps maintain a balanced intestinal flora in broiler chickens, safeguarding their health.

Claims

1. A Lactobacillus plantarum, characterized in that The deposit number of the Lactobacillus plantarum is CCTCC NO: M 2025167.

2. plant lactobacillus according to claim 1, characterized in that, The 16s rDNA sequence of the Lactobacillus plantarum is SEQ ID NO:

1.

3. Application of plant lactobacillus according to claim 1 in feed production.

4. Use of the plant lactobacillus according to claim 1 in preparing a Clostridium perfringens inhibitor.

5. A probiotic preparation, characterized in that The probiotic preparation comprises the Lactobacillus plantarum according to claim 1.

6. The probiotic preparation according to claim 5, wherein The probiotic preparation further comprises any one or more of Bacillus licheniformis, Bacillus subtilis, Bacillus pumilus, Bacillus amyloliquefaciens, Bacillus coagulans, Enterococcus lactis, Clostridium butyricum, Saccharomyces cerevisiae, Enterococcus faecalis, Bifidobacterium, Enterococcus faecium, Pediococcus acidilactici, and Lactobacillus acidophilus.

7. The probiotic preparation according to claim 5 or 6, characterized in that The amount of live Lactobacillus plantarum in the probiotic preparation is not less than 10 9 U / g.

8. Use of the probiotic preparation according to claim 5 or 6 in feed production.

9. Use of the probiotic preparation according to claim 5 or 6 in the preparation of a Clostridium perfringens inhibitor.

Citation Information

Patent Citations

  • Lactobacillus plantarum capable of effectively removing cholesterol and free radicals and application thereof

    CN105779343A

  • Lactobacillus plantarum inhibiting proliferation and growth of clostridium perfringens and application thereof

    CN109182220A

  • Lactobacillus plantarum and application thereof

    CN109504619A

  • Lactobacillus plantarum NFL131 and application thereof

    CN110923169A

  • Lactobacillus plantarum and application thereof

    CN112877262A