Pseudomonas putida strain resistant to phage and application of pseudomonas putida strain
By screening the anti-phage Pseudomonas putida strain QS2A, the problem of degradation of growth and degradation ability caused by phage infection is solved, stable growth and efficient pollutant degradation in the presence of phages are achieved, and the efficiency and economicality of environmental restoration and industrial production are improved.
Patent Information
- Application Number
- CN202510610287.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-13
- Publication Date
- 2025-08-15
AI Technical Summary
Pseudomonas putida is susceptible to phage contamination and lead to apoptosis during the growth and degradation of pollutants, affecting its efficiency and yield in environmental restoration and industrial production.
A spontaneously mutated anti-phage Pseudomonas putida strain QS2A was screened, which can resist the invasion of phages phage phage phQ1, phQ2, and phQ3, maintain growth stability and pollutant degradation ability.
In the presence of phages, the QS2A strain maintains normal growth and efficient degradation capabilities, improving the efficiency of environmental restoration and industrial production, and reducing production costs.
Smart Images

Figure CN120485027A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of microorganisms, and particularly relates to a phage-resistant Pseudomonas putida strain and application thereof. Background Art
[0002] Pseudomonas putida ( Pseudomonas putida ) is a Gram-negative bacterium with no capsule, no spores, and a distinctive foul odor. Under a microscope, it can be observed to have a straight or slightly curved rod-shaped flagellum. Under environmental conditions of 25-30°C and sufficient O2, the enzyme activity of various enzymes inside the Pseudomonas putida bacteria is the highest, metabolism is the most vigorous, and its doubling time is also the shortest. Pseudomonas putida has a wide distribution range in the natural environment and has very strong tolerance to extreme temperatures, humidity, pH, and stress resistance. Pseudomonas putida attached to plant roots can also promote the development of plant root systems, growing synergistically with plants and coexisting in a mutually beneficial manner.
[0003] Pseudomonas putida is one of the most valuable and highly capable strains for the biodegradation of organic pollutants. Pseudomonas putida B6-2 has a moderate ability to degrade polycyclic aromatic hydrocarbons, dioxins, and S / N / O heterocyclic compounds. It can completely degrade 175 nM of fluorene and 108 nM of anthracene within 5 days. When incubated with seven dioxin-type pollutants, it can reduce the content of the mixed pollutants to less than 50% in just 72 hours. Furthermore, Pseudomonas putida contains an organic solvent pump on its chromosome, which confers tolerance to highly toxic organic solvents, enabling it to survive in a variety of organic solvents and degrade pollutants.
[0004] Pseudomonas putida can also serve as a base cell for large-scale industrial production. By optimizing its growth and metabolic pathways through genetic and metabolic engineering, the resulting engineered strain possesses excellent stress resistance and can be used in the industrial field to mass-produce high-value-added substances such as polyhydroxyalkanoates (PHAs), carotenoids, and monogeranyl hydroxybenzoate.
[0005] When using Pseudomonas putida as a base cell for the biodegradation of pollutants in the environment, the presence of bacteriophages that specifically lyse Pseudomonas putida may cause apoptosis of the bacteria, rendering them inefficient in degrading organic pollutants. Furthermore, when using Pseudomonas putida as a base cell for the production of compounds, the presence of bacteriophages can cause large-scale mortality of the host bacteria, reducing the yield of industrial products and resulting in significant economic losses.
[0006] Bacteriophages are a general term for a class of microorganisms that specialize in infecting bacteria. They are numerous and numerous, and are widely distributed in every corner of nature. Breeding Pseudomonas putida that can resist phage infection and lysis is an urgent problem that needs to be solved. Currently, the methods for breeding phage-resistant strains mainly include natural mutation, physical and chemical mutagenesis, and other biological breeding methods. Among them, co-evolution screening of resistant mutants and secondary infection screening of resistant mutants are commonly used biological breeding methods. Obtaining phage-resistant strains by spontaneous mutation is a globally recognized simple, effective and natural method for screening phage-resistant strains. By naturally evolving and selecting chassis cells with phage resistance, Pseudomonas putida will not undergo lysis or apoptosis in the presence of phages, ensuring the normal metabolism and growth of Pseudomonas putida, enabling it to degrade environmental pollutants at a more efficient rate, and laying a good foundation for the application of Pseudomonas putida in the fields of ecological restoration and industrial production. Summary of the Invention
[0007] The present invention aims to provide a phage-resistant Pseudomonas putida strain that protects against phage infection and lysis when used as a host in laboratory research, industrial production, and environmental remediation. The present invention also aims to provide applications of the phage-resistant Pseudomonas putida strain.
[0008] The present invention takes the actual application conditions of Pseudomonas putida as the starting point. When constructing Pseudomonas putida chassis cells, taking into account the attack of bacteriophages in the environment, Pseudomonas putida and phages are co-cultured to screen out phage-resistant strains generated by spontaneous mutation of Pseudomonas putida.
[0009] The phage-resistant Pseudomonas putida strain screened out by the present invention has significant advantages in the biodegradation of organic pollutants. While enhancing the stress resistance of Pseudomonas putida, it can maintain its own stability. After adding phage according to the optimal multiplicity of infection, the phage-resistant strain can reach a certain number of viable bacteria in a relatively short period of time, and the growth state is basically no different from that of uninfected wild-type Pseudomonas putida. Based on this, the phage-resistant Pseudomonas putida strain of the present invention can be used as a powerful host for mass production of industrial products, which can greatly improve production efficiency, reduce production costs, and is a guarantee for efficient industrial production. When a mixture of polycyclic aromatic hydrocarbons, dioxins, and heterocyclic compounds is added to the phage-resistant strain and cultured for a certain period of time, it can degrade most organic pollutants and has a similar and powerful metabolic capacity to that of wild-type Pseudomonas putida. Therefore, the phage-resistant Pseudomonas putida strain of the present invention is applied to environmental remediation, which can reduce the decline in the number of viable bacteria caused by phage infection and help the efficient degradation of pollutants.
[0010] The purpose of the present invention is achieved through the following technical solutions: The present invention provides Pseudomonas putida ( Pseudomonas putida ) strain, strain number QS2A, was deposited in the China Center for Type Culture Collection on March 28, 2025, and its classification name is Pseudomonas putida ( Pseudomonas putida ) QS2A, deposit number is CCTCC NO: M 2025619. The 16S rRNA sequence of the Pseudomonas putida strain is shown in SEQ ID NO: 1.
[0011] The Pseudomonas putida strain QS2A is a phage-resistant strain of Pseudomonas putida, and the phage-resistant strain includes phages resistant to the following genera: Tepukevirus Genus.
[0012] The present invention also provides the use of the Pseudomonas putida strain QS2A in environmental restoration or treatment.
[0013] The present invention also provides the use of the Pseudomonas putida strain QS2A in pollutant degradation. The pollutants include organic pollutants and inorganic pollutants. The organic pollutants include polycyclic aromatic hydrocarbons (PAHs), dioxins, and S / N / O heterocyclic compounds. Furthermore, the organic pollutants include fluorene (FN) from the PAH class, 4-bromodiphenyl ether (4-BDE) from the dioxin class, and dibenzothiophene (DBT) from the heterocyclic class.
[0014] A pollutant degrader comprising Pseudomonas putida strain QS2A or a culture thereof.
[0015] The present invention also provides the use of the Pseudomonas putida strain QS2A as chassis cells.
[0016] The present invention also provides the application of the Pseudomonas putida strain QS2A in synthetic biology.
[0017] The present invention also provides application of the Pseudomonas putida strain QS2A in industrial fermentation.
[0018] Beneficial effects of the present invention: (1) The spontaneous mutation method for obtaining phage-resistant strains is simple and easy to obtain. This method does not involve genetic manipulation, thus avoiding potential safety hazards brought about by genetic manipulation. Its use in industrial environments is not subject to regulatory restrictions and is a globally recognized simple, effective, and natural method for screening phage-resistant strains. (2) Through natural evolution, we screened chassis cells with phage resistance, which gave Pseudomonas putida a strong anti-phage ability. In the presence of phages phQ1, phQ2, and phQ3, it did not undergo lysis and apoptosis. Its growth state was basically the same as that of wild-type Pseudomonas putida, ensuring the normal metabolism and growth of Pseudomonas putida, enabling it to degrade environmental pollutants at a more efficient rate, and laying a good foundation for the application of Pseudomonas putida in practical applications to treat organic pollutants.
[0019] (3) The phage-resistant Pseudomonas putida strain screened by the present invention has significant advantages in pollutant degradation. While enhancing the stress resistance of Pseudomonas putida, it can maintain its own stability. Compared with the wild-type strain, the phage-resistant strain can degrade most FN, DBT, and 4-BDE in a shorter time. Therefore, the phage-resistant Pseudomonas putida strain is a powerful host for efficient bioremediation and environmental protection.
[0020] (4) Phage-resistant mutants of Pseudomonas putida have great practical value in industrial production, which can improve production efficiency and reduce production costs. In the process of industrial production of value-added compounds using Pseudomonas putida as the base cell, it may be contaminated by phages, resulting in reduced yields. If the base cells are replaced with phage-resistant Pseudomonas putida strains, they have strong anti-phage ability, which enables Pseudomonas putida to still efficiently utilize substrates in the presence of phages, which is conducive to the rapid accumulation of products and ensures efficient industrial production. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Figure 1 Double-layer plates were used to verify the resistance of Pseudomonas putida QS2A to bacteriophages phQ1, phQ2, and phQ3 (Pseudomonas putida B6-2 was used as the control).
[0022] Figure 2 This shows the growth of Pseudomonas putida QS2A in the presence of bacteriophages phQ1, phQ2, and phQ3 (Pseudomonas putida B6-2 was used as the control).
[0023] Figure 3 HPLC analysis was used to detect the degradation of FN, DBT, and 4-BDE by Pseudomonas putida B6-2 and QS2A (MSM culture medium sterilized by high temperature and high pressure was used as a negative control). DETAILED DESCRIPTION
[0024] The present invention will be described in further detail below with reference to the embodiments and drawings, but the embodiments of the present invention are not limited thereto.
[0025] In the following examples, the wild-type Pseudomonas putida is B6-2 (ATCC BAA-2545), which is a strain isolated from biphenyl-contaminated soil.
[0026] In the following examples, the bacteriophages are Pseudomonas putida susceptible phages phQ1 (CCTCC PV2025029), phQ2 (CCTCC PV 2025030), and phQ3 (CCTCC PV 2025031). Phage phQ1 was isolated from a fish market water sample in Wuhan, Hubei Province, phage phQ2 was isolated from a domestic sewage sample in Wuhan, Hubei Province, and phage phQ3 was isolated from a river water sample in Nanyang, Henan Province. Genome sequencing and alignment showed that phQ1, phQ2, and phQ3 belong to Caudoviricetes Outline Tepukevirus Genus, Caudoviricetes Outline Tepukevirus Genus, Caudoviricetes A new type of bacteriophage that has not been classified into any class.
[0027] In the following examples, the primer sequences for amplifying bacterial 16S rRNA are: the sequence of primer 27F is AGAGTTTGATCCTGGCTCAG, and the sequence of primer 1492R is GGTTACCTTGTTACGACTT.
[0028] The experimental methods described in the following examples are conventional methods unless otherwise specified; the reagents and materials are commercially available unless otherwise specified.
[0029] LB liquid culture medium: 10 g / L tryptone, 10 g / L NaCl, 5 g / L yeast extract, pH 6.5-7.2.
[0030] Among them, LB semi-solid medium: tryptone 10 g / L, NaCl 10 g / L, yeast extract 5 g / L, CaCl2 0.22 g / L, top agar 0.35%, pH 6.5-7.2.
[0031] Among them, LB solid medium: tryptone 10 g / L, NaCl 10 g / L, yeast extract 5 g / L, bottom agar 1.5%, pH 6.5-7.2.
[0032] Among them, MSM culture medium: KH2PO42 g / L, Na2HPO4∙12H2O 3.28 g / L, MgSO40.1 g / L, (NH4)2SO41 g / L, FeCl30.00025 g / L.
[0033] SM buffer: NaCl 5.8 g / L, MgSO4∙7H2O 2 g / L, Tris-HCl buffer (1 M, pH=7.5) 50 mL.
[0034] Example 1 Breeding of phage-resistant Pseudomonas putida strains Pseudomonas putida B6-2 was streaked on an LB plate to obtain a single colony. A single colony was picked and cultured in a 30°C shaker overnight using LB medium. The strain was transferred to fresh LB liquid medium at a 1% inoculum volume and cultured in a 30°C shaker until OD600 = 0.5; bacteriophage phQ1 was added at the optimal MOI = 0.00001 and cultured until the culture medium became clear. At this time, most of the Pseudomonas putida had been lysed by the phage; the culture was continued at 30°C for 48 hours; the lysate was diluted with LB liquid medium to an appropriate gradient, spread on an LB plate, and cultured in an inverted manner at 30°C incubator for 24 hours until a single colony grew; 10 single colonies were picked and cultured in LB liquid medium; a double-layer plate was used to determine whether the strain had undergone a phage-resistant mutation. It was found that it could completely resist both phages phQ1 and phQ2. From these, a mutant strain with good growth and resistance to phages phQ1 and phQ2 was selected and cultured at 30°C. The culture was cultured overnight at 14°C. The culture was streaked onto LB plates until a single colony grew. The single colony was then purified three times and subcultured three times. The strain from the final subculture was again tested on double-layer plates to determine whether the phage-resistant mutation was stably inherited. After three subcultures, the strain that remained resistant to phages phQ1 and phQ2 was identified as QS1. The double-layer plate assay involved the following steps: An overnight culture of Pseudomonas putida and a semi-solid medium were mixed by inversion and quickly poured onto a solid plate. After solidification, a serial dilution of the phage (the original phage solution was serially diluted using SM buffer) was dripped onto the double-layer plate in sequence. After the liquid dried, the plate was incubated overnight to observe changes in the number, size, and morphology of the plaques.
[0035] Using QS1 as the starting strain, the above procedure was repeated using phage phQ3 to identify a mutant strain that exhibited excellent growth and was fully resistant to phages phQ1, phQ2, and phQ3. After streak purification and multiple passages, its anti-phage properties were again tested using the double-layer plate method. After three passages, strains that remained resistant to phages phQ1, phQ2, and phQ3 were identified and designated QS2A.
[0036] Example 2 Determination of the anti-phage ability of Pseudomonas putida QS2A Take 800 μL of overnight culture of Pseudomonas putida B6-2 and QS2A respectively, add them into 10 mL EP tube, then add 9 mL of LB semi-solid medium, mix thoroughly by inversion, and quickly pour onto LB solid square plate. After solidification, take the titer of 10 9 -10 10 Phage phQ1, phQ2, and phQ3 stock solutions within the PFU / mL range were serially diluted with SM buffer to 10 -6 , take 5μL 10 -1 -10 -6 The dilutions were dripped onto the double-layer plates in sequence. After the liquid dried, they were placed in a 30°C incubator for overnight culture. The changes in the number, size, and morphology of the plaques were observed. Figure 1 No visible plaques appeared on the double-layer plates, indicating that the phage-resistant Pseudomonas putida mutant QS2A could simultaneously produce resistance to phQ1, phQ2, and phQ3 by more than six orders of magnitude.
[0037] Example 3 Species determination of Pseudomonas putida QS2A The phage-resistant mutant strain QS2A of Pseudomonas putida was streaked onto LB plates to obtain a single colony. The colony was then cultured overnight in LB medium at 30°C in a shaker. 1 μL of the overnight culture was used as a PCR template. Universal primers 27F and 1492R were used to amplify the 16S rRNA of the QS2A mutant strain. The PCR product was sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. A BLAST comparison of the sequence results against the NCBI database revealed a 100% similarity between the 16S rRNA and that of P. putida. Therefore, the phage-resistant mutant strain QS2A was confirmed to be P. putida and not a contaminating strain.
[0038] The 16S rRNA sequence of strain QS2A is shown in SEQ ID NO: 1.
[0039]
[0040] Pseudomonas putida QS2A was deposited in the China Center for Type Culture Collection on March 28, 2025, with the deposit number being CCTCC NO: M 2025619.
[0041] Example 4 Detection of growth status of Pseudomonas putida QS2A Pseudomonas putida B6-2 and QS2A were inoculated into LB liquid medium and cultured overnight at 30°C in a shaking incubator. The overnight culture solution was diluted with LB liquid medium from the original solution to 10 -8 Immediately take 20 μL of each gradient dilution solution and drop it onto LB solid medium in sequence. After drying, place it in a 30 ℃ incubator for overnight culture. The CFU of Pseudomonas putida was calculated by the number of single colonies grown. Take 10 μL of the overnight culture solution of Pseudomonas putida B6-2 and QS2A with different volumes. -1 The dilution was transferred to 5 mL of LB liquid medium to ensure that the initial CFU of the test bacteria was exactly the same, about 7.5×10 9 CFU / mL, as the phage-free group. Phages phQ1, phQ2, and phQ3 were added to the phage-free group at optimal multiplicities of infection (MOIs) of 0.00001, 0.00001, and 0.001, respectively, to form phage-infected groups. Both the phage-free and phage-infected groups were simultaneously placed in a shaker at 30°C and incubated at 220 rpm for 15 h.
[0042] Take the time of inoculation of Pseudomonas putida B6-2 and QS2A as hour 0. Starting from hour 0, sample 100 μL every 3 hours in a transparent 96-well plate and measure the absorbance of the sample at 600 nm using a microplate reader. Subtract the absorbance of the LB liquid culture medium from the obtained value to obtain the OD600. Repeat the measurement three times in parallel and take the average value. Plot a graph of the change of OD600 over time with time as the horizontal axis and the OD600 value as the vertical axis, as shown in the figure below. Figure 2 shown.
[0043] In the absence of phage, the growth of mutant QS2A was essentially identical to that of wild-type strain B6-2, entering the exponential growth phase after the third hour of culture and reaching an OD600 of 1 around the ninth hour. In the presence of phage, the growth of wild-type strain B6-2 was strongly inhibited, with its OD600 fluctuating around the baseline level before the ninth hour of culture. However, the growth of mutant QS2A was unaffected by phage, and its growth curve remained identical to that observed in the absence of phage. This result further confirms that the mutant QS2A has indeed undergone a phage-resistant mutation, enabling it to maintain a normal growth rate despite the stress of phages phQ1, phQ2, and phQ3.
[0044] Example 5: Detection of the pollutant degradation ability of Pseudomonas putida Pseudomonas putida B6-2 and QS2A were streaked on LB solid medium and cultured in a 30°C incubator overnight. Single colonies were picked and inoculated into LB liquid medium and cultured in a 30°C shaker overnight. The overnight culture solution was diluted to 10% with LB liquid medium. -7 , take 100 μL 10 -7 The gradient dilution solution was spread on LB solid plates, blown dry and placed upside down in a 30°C incubator for overnight culture. The next day, the CFU was calculated based on the number of single colonies on the LB plates. The calculated concentration of B6-2 was 5×10 9 CFU / mL, the concentration of QS2A was 8×10 9 CFU / mL. Transfer 400 μL of B6-2 culture medium and 250 μL of QS2A overnight culture medium to 40 mL of LB liquid medium to ensure that the initial CFU of the two cultures are exactly the same. Incubate in a shaker at 30°C for 24 h. The cultures of Pseudomonas putida B6-2 and QS2A were centrifuged at 4500 rpm for 15 min, the supernatant was discarded, and 20 mL of MSM medium was added to disperse the bacterial pellet. The above steps of centrifugation, discarding the supernatant, and adding MSM medium to wash were repeated three times. After the final centrifugation, the bacteria were suspended in MSM medium and added to 400 mL of MSM medium containing 15 mM biphenyl (BP). The cells were cultured in a shaker at 30°C until the late logarithmic growth phase. The cultures of Pseudomonas putida B6-2 and QS2A were centrifuged at 4500 rpm for 15 min, the supernatant was discarded, and 20 mL of MSM medium was added to disperse the bacterial pellet. The above steps of centrifugation, discarding the supernatant, and adding MSM medium to wash were repeated three times. After the final centrifugation, the bacteria were suspended in MSM medium to OD600 = 5. Fluorene (FN), dibenzothiophene (DBT), and 4-bromodiphenyl ether (4-BDE) were added to a final concentration of 0.2 mM, respectively. Similarly, 0.2 mM FN, DBT, and 4-BDE were added to the high-temperature and high-pressure sterilized MSM culture medium as a negative control.
[0045] Taking the time when FN, DBT, and 4-BDE were added as the 0th hour, 10 mL of samples were taken at intervals of 24 hours and 72 hours respectively. An equal volume of ethyl acetate was added to the sample for extraction three times. The upper layer solution was collected in each extraction into a 100 mL conical flask, and anhydrous sodium sulfate was added to remove the water. After filtration and washing, the solution was collected into a 100 mL eggplant-shaped flask. The ethyl acetate was completely removed by a rotary evaporator. Finally, 1 mL of acetonitrile was added to dissolve all the precipitates at the bottom of the flask. The sample was injected into the HPLC analysis to detect the concentrations of FN, DBT, and 4-BDE in the sample. The analysis conditions of HPLC were as follows: the chromatographic column was Dikma Endeavorsil 1.8 μm C18 50 × 2.1 mm, phase A was water, phase B was acetonitrile plus 0.1% formic acid, gradient elution was from 50% phase B to 80% phase B, the flow rate was 1 mL / min, the injection volume was 5 μL, and the detection wavelength was 245 nm. Figure 3 As shown, compared with the negative control, at 24 hours, B6-2 and QS2A both had some ability to degrade FN, DBT, and 4-BDE, with FN and 4-BDE being more degraded than DBT. At 72 hours, the concentrations of FN, DBT, and 4-BDE in both B6-2 and QS2A showed a significant downward trend. This suggests that QS2A does not have a significant metabolic defect and its ability to degrade organic pollutants is similar to that of B6-2.
[0046] Standard mixed solutions of FN, DBT, and 4-BDE were prepared in acetonitrile at concentrations of 3 mM, 2 mM, 1 mM, 0.4 mM, 0.2 mM, 0.1 mM, and 0.05 mM, respectively. HPLC analysis was performed to generate a standard curve showing the peak area of each compound versus concentration. The concentrations of FN, DBT, and 4-BDE in the samples were calculated using the standard curves. The reduction in concentration compared to the negative control indicates the strain's ability to degrade the pollutants. The experiment was repeated three times in parallel, and the average value was taken as the final degradation rate. As shown in Table 1, at 24 h, the degradation rates of FN by B6-2 and QS2A were 61.3% and 61.5%, the degradation rates of DBT were 25.1% and 29.6%, and the degradation rates of 4-BDE were 46.0% and 45.8%, respectively. Within 72 h, both B6-2 and QS2A could degrade approximately 85% of FN, 65% of DBT, and 75% of 4-BDE, indicating that the mutant strain QS2A has no defect in its metabolic capacity and has a strong degradation ability for FN, DBT, and 4-BDE, just like the wild-type strain B6-2.
[0047] Table 1 Degradation rates of FN, DBT, and 4-BDE by Pseudomonas putida B6-2 and QS2A
[0048] The above embodiments are only used to help illustrate the present invention. The implementation methods of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.
Claims
1. A strain of Pseudomonas putida, characterized in that: It is a Pseudomonas putida with a deposit number of CCTCC NO: M 2025619 ( Pseudomonas putida )QS2A.
2. The Pseudomonas putida strain according to claim 1, characterized in that: Its 16S rRNA sequence is shown in SEQ ID NO:
1.
3. The Pseudomonas putida strain according to claim 1, characterized in that: It is resistant to bacteriophages.
4. The Pseudomonas putida strain according to claim 3, characterized in that: The anti-phage includes phages against the following genera: Tepukevirus Genus.
5. Use of the Pseudomonas putida strain according to claim 1 in environmental remediation or treatment.
6. Use of the Pseudomonas putida strain according to claim 1 in pollutant degradation.
7. A pollutant degradation agent, characterized in that: Comprising the Pseudomonas putida strain or a culture thereof according to claim 1.
8. Use of the Pseudomonas putida strain according to claim 1 as chassis cells.
9. Use of the Pseudomonas putida strain according to claim 1 in synthetic biology.
10. Use of the Pseudomonas putida strain according to claim 1 in industrial fermentation.