Rice low-temperature-resistant related gene OsCPK4 as well as encoding protein and application thereof

By expressing OsCPK4 protein in rice or regulating its gene expression, the problem of low temperature sensitivity in rice seedlings is solved, and the low temperature resistance of rice is improved or reduced, and its survival rate at low temperature is enhanced or weakened.

CN120485154APending Publication Date: 2025-08-15NANJING AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510906568.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-02
Publication Date
2025-08-15

AI Technical Summary

Technical Problem

The rice seedling stage is sensitive to low temperature and cold damage, resulting in slowing growth of rhizomes and leaves and reducing tillering, affecting yield and quality. The existing technology lacks effective methods of low temperature resistance gene improvement.

Method used

Provide rice low-temperature-resistant protein OsCPK4 and its encoding genes, and improve or reduce the expression level of OsCPK4 by constructing recombinant expression vectors and gene editing technology to regulate the low-temperature resistance of rice.

Benefits of technology

It significantly improves or reduces the sensitivity of rice to low temperatures, enhances or weakens its survival rate at low temperatures, and has important breeding value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120485154A_ABST
    Figure CN120485154A_ABST
Patent Text Reader

Abstract

The invention discloses a rice low-temperature-resistant protein OsCPK4 as well as a coding gene and application of the rice low-temperature-resistant protein OsCPK4. The protein provided by the invention affects the resistance of rice to low-temperature stress. The gene is knocked out, so that the low-temperature resistance of the rice is remarkably reduced. By improving the expression of the protein coding gene, the resistance of the rice to low-temperature stress can be remarkably improved, so that the low-temperature-resistant rice can be cultivated. The protein and the coding gene thereof can be applied to genetic improvement of rice.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering, and in particular relates to a rice low-temperature-resistance-related gene OsCPK4, its encoded protein and application. Background Art

[0002] my country's rice-growing areas are widespread, and low temperatures and chilling damage are frequent. Early rice seedlings and late rice heading stages in tropical South China and the middle and lower reaches of the Yangtze River often experience low temperatures. Cold damage in Northeast China and the high-altitude areas of Southwest China often causes large-scale yield reductions. Low temperatures and chilling damage are one of the major abiotic stresses affecting rice production in my country. During rice production, chilling damage can occur at every stage throughout the growing season. The rice seedling stage is particularly sensitive to low temperatures and chilling damage. Low temperatures during the seedling stage can cause rice seedlings to lose their green color, wilt, or even die, and reduce the growth and tillering of roots, stems, and leaves. This can affect the timing of subsequent growth stages, severely impacting rice yield and quality.

[0003] Therefore, exploring rice cold-tolerant genes and cultivating cold-tolerant rice varieties are the primary ways to solve the problem of low temperature damage during the rice seedling stage. Summary of the Invention

[0004] In order to solve the above technical problems existing in the prior art, the present invention provides a plant cold tolerance-related protein OsCPK4 and its encoded protein and application.

[0005] The first object of the present invention is to provide the rice OSCPK4 protein of the present invention, wherein the OSCPK4 protein is selected from the following (a) or (b):

[0006] (a) a protein with an amino acid sequence as shown in SEQ ID NO. 1;

[0007] (b) a protein derived from the amino acid sequence shown in SEQ ID NO. 1 by substitution and / or deletion and / or addition of one or more amino acid residues and related to plant cold tolerance;

[0008] Preferably, the (b) is one or more of the following tags connected to the amino terminus or carboxyl terminus of the amino acid sequence shown in SEQ ID NO.1:

[0009]

[0010]

[0011] In a specific embodiment, the Poly-Arg is 5 Rs, namely RRRRR (SEQ ID NO. 14).

[0012] In a specific embodiment, the Poly-His is 6 Hs, namely HHHHHH (SEQ ID NO. 15).

[0013] The second object of the present invention is to provide an OSCPK4 gene encoding the aforementioned OSCPK4 protein.

[0014] Furthermore, the gene is any one of the following 1) to 4):

[0015] 1) cDNA as shown in SEQ ID NO. 2;

[0016] 2) a DNA molecule having a genomic sequence as shown in SEQ ID NO. 3;

[0017] 3) a DNA molecule that hybridizes with the DNA sequence defined in 1) or 2) under stringent conditions and encodes a rice cold tolerance-related protein; the stringent conditions are hybridization at 65° C. in a solution of 0.1× SSPE or 0.1× SSC, 0.1% SDS, and membrane washing;

[0018] 4) A DNA molecule having more than 90% homology with the DNA sequence defined in 1) or 2) and encoding a plant cold tolerance-related protein.

[0019] The third object of the present invention is to provide a recombinant expression vector, interference vector, gene editing vector, expression cassette, transgenic cell line or recombinant bacteria of the aforementioned OSCPK4 gene.

[0020] Plant expression vectors include binary Agrobacterium vectors and vectors suitable for plant microprojectile bombardment. Plant expression vectors may also contain the 3' untranslated region of the exogenous gene, i.e., a polyadenylation signal and any other DNA fragments involved in mRNA processing or gene expression. The polyadenylation signal can direct the addition of polyadenylic acid to the 3' end of the mRNA precursor. For example, the 3' transcribed untranslated region of Agrobacterium crown gall-inducing (Ti) plasmid genes (such as the rouge synthase Nos gene) and plant genes (such as the soybean storage protein gene) all have similar functions.

[0021] When using the gene construction recombinant plant expression vector, any enhanced promoter or constitutive promoter can be added before its transcription initiation nucleotide, such as cauliflower mosaic virus (CAMV) 35S promoter, corn ubiquitin promoter (Ubiquitin), which can be used alone or in combination with other plant promoters; In addition, when using the gene construction plant expression vector of the present invention, enhancers can also be used, including translation enhancers or transcription enhancers, and these enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The source of the translation control signal and the start codon is extensive, and can be natural or synthetic. The translation initiation region can be from a transcription initiation region or a structural gene.

[0022] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be modified, such as by adding genes encoding enzymes or luminescent compounds that can be expressed in plants (such as the GUS gene or luciferase gene), antibiotic resistance markers (such as gentamicin and kanamycin), or chemical resistance marker genes (such as herbicide resistance genes). For the safety of transgenic plants, it is possible to omit any selectable marker genes and directly screen for transformed plants using stress.

[0023] The protein, the gene, the recombinant expression vector, the expression cassette, the transgenic cell line or the recombinant bacteria or the method can all be applied to rice breeding.

[0024] By introducing the gene encoding the protein into plant cells using any vector capable of directing exogenous gene expression in plants, transgenic cell lines and transgenic plants can be obtained. The expression vector carrying the gene can be transformed into plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, and Agrobacterium-mediated transformation, and the transformed plant tissues can be cultivated into plants.

[0025] Furthermore, the recombinant expression vector is constructed by inserting the aforementioned gene into the recombination site Pst I of the pCUbi1390 vector.

[0026] Furthermore, the interference vector is a CRISPR / Cas9 vector with the sequence shown in SEQ ID NO.4 as the knockout target.

[0027] The fourth object of the present invention is to provide a specific primer pair for amplifying the full length of the aforementioned OSCPK4 gene or any fragment thereof.

[0028] Preferably, the primer pair is the CPK4-CDS primer pair shown in SEQ ID NO.7 and SEQ ID NO.8, or the CPK4-OE primer pair shown in SEQ ID NO.9 and SEQ ID NO.10.

[0029] A fifth object of the present invention is to provide a use of at least one of the aforementioned OSCPK4 protein, the aforementioned OSCPK4 gene, the aforementioned recombinant expression vector, interference vector, gene editing vector, expression cassette, transgenic cell line or recombinant bacteria in regulating rice cold resistance.

[0030] Furthermore, increasing the expression level of the aforementioned OSCPK4 protein in rice, or increasing the expression amount of the aforementioned OSCPK4 gene in rice, or transferring the aforementioned recombinant expression vector, expression cassette, transgenic cell line or recombinant bacteria into rice can improve the low temperature resistance of rice.

[0031] In a specific embodiment, the rice is a low-temperature-intolerant variety.

[0032] Furthermore, reducing the expression level of the aforementioned OSCPK4 protein in rice, or reducing the expression amount of the aforementioned OSCPK4 gene in rice, or transferring the aforementioned interference vector or gene editing vector into rice can reduce the rice's low temperature resistance.

[0033] In a specific embodiment, the rice is a low-temperature tolerant variety.

[0034] The beneficial effects of the technical solution of the present invention are:

[0035] The rice cold-tolerance gene OSCPK4 and its encoding protein of the present invention affect rice's sensitivity to low temperatures and survival rate. Overexpressing the protein's encoding gene in rice can produce transgenic rice with enhanced cold resistance. The protein and its encoding gene can be used for genetic improvement of rice. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 Comparison of phenotypes of wild-type Ningjing 7 and knockout lines cpk4-1, cpk4-2, and cpk4-3 after low-temperature treatment, including: A. Comparison of phenotypes before low-temperature treatment;

[0037] B. Comparison of phenotypes after low temperature treatment;

[0038] Comparison of survival rates.

[0039] Figure 2 Schematic diagram of sequencing identification of knockout lines cpk4-1, cpk4-2, and cpk4-3.

[0040] Figure 3Comparison of phenotypes of wild-type Ningjing 8 and overexpression lines 4-OE-1, 4-OE-2, and 4-OE-3 after low temperature treatment, including: A. Comparison of phenotypes before low temperature treatment;

[0041] B. Comparison of phenotypes after low temperature treatment;

[0042] Comparison of survival rates. DETAILED DESCRIPTION

[0043] The present invention is further explained below with reference to the following examples, but the examples do not limit the present invention in any form.

[0044] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified.

[0045] CPK4-crispr-F:GGCATTCGAGGGGAGGTACCAGGT (SEQ ID NO.5);

[0046] CPK4-crispr-R:AAACACCTGGTACCTCCCCTCGAA (SEQ ID NO. 6);

[0047] CPK4-CDS-F:ATGGGCGCGTGCTTCTCATC (SEQ ID NO.7);

[0048] CPK4-CDS-R:TCACAGGGGTTGTGGATTTG (SEQ ID NO.8);

[0049] CPK4-OE-F:CACTAGGTACCTGCGATGGGGCGCGTGCTTCTCATC (SEQ ID NO.9);

[0050] CPK4-OE-R: ATCCGTCGACCTGCAGCAGGGGTTGTGGATTTGGAG (SEQ ID NO. 10).

[0051] Example 1: Construction of Rice OsCPK4 Gene Knockout Vector

[0052] A 20-bp knockout target, CPK4-crispr (TTCGAGGGGAGGTACCAGGT, SEQ ID NO. 4), targeting OsCPK4 was designed using the CRISPR-P editing tool (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR). Primer dimers were formed using 10 μmol of a master mix of knockout primers with linkers (the CPK4-crispr primer pair shown in SEQ ID NOs. 5 and 6 in Table 1), and then ligated into the CRISPR / Cas9 vector pCAMBIA1305.1, which carries the CaMV35S promoter, using Aar I and T4 DNAase.

[0053] The knockout vector plasmid, which had been successfully sequenced, was transformed into the high-yielding recipient rice variety Ningjing 7 via Agrobacterium-mediated transformation. After callus induction, Agrobacterium infection, co-cultivation, and resistance marker screening, transgenic rice regenerated plants were obtained. The specific operation method of the Agrobacterium-mediated rice genetic transformation system was the same as that reported by Hiei et al. (Hiei et al., 1994).

[0054] The positive knockout lines were sequenced to confirm the successful knockout of transgenic plants, and three loss-of-function mutants (cpk4-1, cpk4-2, and cpk4-3) were obtained. The sequencing results of the knockout lines cpk4-1, cpk4-2, and cpk4-3 are as follows: Figure 2 shown.

[0055] Example 2: Construction of Rice OsCPK4 Gene Overexpression Vector

[0056] The hygromycin-resistant expression vector pCUbi1390 was digested with Pst I, and the vector fragment was recovered for future use. Using the cDNA of Ningjing No. 7 as a template, PCR amplification was performed to obtain a fragment containing the OsCPK4 genomic coding region (SEQ ID NO. 2). Recombinant adapters were added to both ends of this fragment and recombined into the pCUbi1390 vector Pst I, and sequencing was performed to confirm the fragment.

[0057] The PCR primer sequences are as follows:

[0058] CPK4-OE-F (the underlined sequence is the Pst I recombination site):

[0059] 5'- CACTAGGTACCTGCAG ATGGGCGCGTGCTTCTCATC-3'(SEQ ID NO.9);

[0060] CPK4-OE-R (the underlined sequence is the Pst I recombination site):

[0061] 5'- ATCCGTCGACCTGCAG CAGGGGTTGTGGATTTGGAG-3' (SEQ ID NO. 10);

[0062] The successfully sequenced overexpression vector plasmid was transferred into the recipient high-yield variety Ningjing No. 8 through Agrobacterium-mediated method. After callus induction, Agrobacterium infection, co-cultivation, and resistance marker screening, transgenic rice regenerated plants (4-OE-1, 4-OE-2, and 4-OE-3) were obtained.

[0063] The PCR primer sequences used to amplify the full-length fragment of the OsCPK4 genomic coding region are as follows:

[0064] CPK4-CDS-F

[0065] 5'-ATGGGCGCGTGCTTCTCATC-3'(SEQ ID NO.7)

[0066] CPK4-CDS-R

[0067] 5'-TCACAGGGGTTGTGGATTTG-3'(SEQ ID NO.8)

[0068] Example 3: Identification of cold tolerance of transgenic plants

[0069] Seeds of the knockout lines cpk4-1, cpk4-2, and cpk4-3 to be identified, as well as the background variety Ningjing 7 (a cold-tolerant variety), were soaked and germinated for three days. Seeds of the overexpression lines 4-OE-1, 4-OE-2, and 4-OE-3 to be identified, as well as the background variety Ningjing 8 (a cold-intolerant variety), were soaked and germinated for three days. The seeds were then sown in 96-well hydroponic culture trays. After sowing, the seeds were cultured in dd / 4 Yoshida nutrient solution for two days, then in 1 / 4 Yoshida nutrient solution for two days, and then in complete nutrient solution for another two days. The seeds were then cultured in a plant incubator until they reached the two-leaf, one-heart stage, which takes approximately 10 days. The incubator temperature was set at 30°C, with a photoperiod of 12 hours light and 12 hours dark, and an illumination of 40,000 lux.

[0070] Preparation of Yoshida nutrient solution mother solution

[0071]

[0072] The above solution is the mother solution, which should be diluted 800 times when preparing the working solution (add 5 ml to 4 L).

[0073] 7.NaOH: 2M for pH adjustment, adjust the pH of the working solution to 5.8-6.0.

[0074] The seedlings cultured to the 2-leaf 1-heart stage were transferred to a low-temperature incubator for low-temperature treatment. The temperature of the low-temperature incubator was set at 4°C, and the photoperiod was set to 12 hours of light and 12 hours of darkness.

[0075] Determine treatment time based on phenotype:

[0076] Ningjing No. 7 and its knockout families were treated with low temperature for about 7 days, and Ningjing No. 8 and its overexpression families were treated with low temperature for about 5 days.

[0077] The reason for the difference in treatment days is that, because Ningjing 7 is highly cold-tolerant, we maintained low-temperature treatment for a sufficient number of days to demonstrate the differences between Ningjing 7 and the knockout family in this context. Ningjing 8, on the other hand, is less cold-tolerant, and its survival rate dropped significantly after only five days of low-temperature treatment. Therefore, based on the differences in cold tolerance between their parents, the knockout family using the Ningjing 7 background and the overexpression family using the Ningjing 8 background were treated for different days in this experiment.

[0078] After treatment, the seedlings were transferred to a 30°C incubator and cultured with Yoshida nutrient solution for approximately 10 days. The survival rate of each material was calculated. Each experiment was performed with at least four biological replicates per material, with 40 seedlings per replicate.

[0079] Figure 3 As shown, compared with the wild-type Ningjing 8, the survival rates of the overexpression lines 4-OE-1, 4-OE-2, and 4-OE-3 were significantly enhanced. Figure 1 As shown, compared with the wild-type Ningjing 7, the survival rates of the knockout lines cpk4-1, cpk4-2, and cpk4-3 were significantly reduced.

[0080] These results indicate that low temperatures during the seedling stage significantly affect rice seedling survival. Under low-temperature stress, the OsCPK4-overexpressing line exhibited significantly greater cold tolerance than Ningjing 8. In contrast, the OsCPK4-knockout line exhibited significantly lower cold tolerance than Ningjing 7. This suggests that OsCPK4 positively regulates cold tolerance in rice seedlings and can improve rice plant survival under low-temperature stress, demonstrating its potential for breeding.

[0081] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. Rice OSCPK4 protein, characterized in that The OSCPK4 protein is selected from the following (a) or (b): (a) a protein with an amino acid sequence as shown in SEQ ID NO. 1; (b) a protein derived from the amino acid sequence shown in SEQ ID NO. 1 by substitution and / or deletion and / or addition of one or more amino acid residues and related to plant cold tolerance; Preferably, the (b) is one or more of the following tags connected to the amino terminus or carboxyl terminus of the amino acid sequence shown in SEQ ID NO.1: 。 2. An OSCPK4 gene encoding the OSCPK4 protein according to claim 1.

3. The OSCPK4 gene according to claim 2, characterized in that The gene is any one of the following 1) to 4): 1) cDNA as shown in SEQ ID NO. 2; 2) a DNA molecule having a genomic sequence as shown in SEQ ID NO. 3; 3) a DNA molecule that hybridizes with the DNA sequence defined in 1) or 2) under stringent conditions and encodes a rice cold tolerance-related protein; the stringent conditions are hybridization at 65° C. in a solution of 0.1× SSPE or 0.1× SSC, 0.1% SDS, and membrane washing; 4) A DNA molecule having more than 90% homology with the DNA sequence defined in 1) or 2) and encoding a plant cold tolerance-related protein.

4. The recombinant expression vector, interference vector, gene editing vector, expression cassette, transgenic cell line or recombinant bacteria of the OSCPK4 gene according to claim 2 or 3.

5. The recombinant expression vector according to claim 4, characterized in that The recombinant expression vector is constructed by inserting the gene according to claim 2 or 3 between the recombination sites Pst I of the pCUbi1390 vector.

6. The interference carrier according to claim 4, characterized in that The interference vector is a CRISPR / Cas9 vector with the sequence shown in SEQ ID NO.4 as the knockout target.

7. A specific primer pair for amplifying the full length of the OSCPK4 gene or any fragment thereof according to claim 2 or 3, preferably, the primer pair is the CPK4-CDS primer pair shown in SEQ ID NO. 7 and SEQ ID NO. 8, or the CPK4-OE primer pair shown in SEQ ID NO. 9 and SEQ ID NO.

10.

8. Use of at least one of the OSCPK4 protein according to claim 1, the OSCPK4 gene according to claim 2 or 3, and the recombinant expression vector, interference vector, gene editing vector, expression cassette, transgenic cell line, or recombinant bacteria according to claim 4 or 5 in regulating cold tolerance in rice.

9. The use according to claim 8, characterized in that Increasing the expression level of the OSCPK4 protein according to claim 1 in rice, or increasing the expression amount of the OSCPK4 gene according to claim 2 or 3 in rice, or transferring the recombinant expression vector, expression cassette, transgenic cell line or recombinant bacteria according to claim 4 into rice can improve the low temperature resistance of rice.

10. The use according to claim 8, characterized in that Reducing the expression level of the OSCPK4 protein according to claim 1 in rice, or reducing the expression amount of the OSCPK4 gene according to claim 2 or 3 in rice, or transferring the interference vector or gene editing vector according to claim 4 into rice can reduce the low temperature resistance of rice.