Os-miR6225y sequence for inhibiting toxicity of sclerotinia sclerotiorum and application of Os-miR6225y sequence

Abstract

The invention discloses an Os-miR6225y sequence for inhibiting toxicity of sclerotinia sclerotiorum and application of the Os-miR6225y sequence, and belongs to the field of plant molecular biology. The nucleotide sequence of the Os-miR6225y mature miRNA provided by the invention is as shown in SEQ ID NO. 29, and the nucleotide sequence of a precursor of the Os-miR6225y mature miRNA is as shown in SEQ ID NO. 18. The Os-miR6225y can silence the sclerotinia sclerotiorum effector gene Ssv263 in the rice in a targeted manner, so that the sclerotinia rot resistance of the rice can be remarkably reduced, the bacterium pathogenicity is remarkably reduced by the overexpression of the Os-miR6225y in sclerotinia sclerotiorum, and the disease area is also effectively reduced by the overexpression of the Os-miR6225y in hosts such as arabidopsis thaliana and brassica napus; the sclerotiniose resistance of the host to sclerotiniose of sclerotinia sclerotiorum is improved, and the method has a good application prospect in the aspect of improving the sclerotiniose resistance of the host plant sclerotiniose of sclerotinia sclerotiorum.

Description

Technical Field

[0001] This invention relates to the field of plant molecular biology, specifically to an Os-miR6225y sequence that inhibits the toxicity of Sclerotinia sclerotiorum and its applications. Background Technology

[0002] Sclerotium sclerotiorum ( Sclerotinia sclerotiorum *Sclerotinia sclerotiorum* (Lib.) de Bary is a typical necrotrophic filamentous plant pathogen with a wide host range, distributed across 95 countries and regions. It can infect more than 600 plant species, including some important crops such as soybeans, rapeseed, sunflowers, and Brassica vegetables. Under suitable conditions, *Sclerotinia sclerotiorum* can rapidly infect host plants, causing sclerotinia rot. Plant resistance to *Sclerotinia sclerotiorum* manifests as basic resistance. To date, the pathogenic genes of *Sclerotinia sclerotiorum* and corresponding resistance genes in plants have not been identified, thus hindering progress in breeding host plants for resistance to sclerotinia rot. Currently, production mainly relies on agricultural measures and chemical agents to control sclerotinia rot, but the effects are unstable and there are problems such as environmental pollution and drug resistance. Plant non-host resistance is a widely existing disease resistance system in nature, possessing persistence and broad spectrum, and has important application value for crop disease resistance breeding. Rice is one of the non-host plants for *Sclerotinia sclerotiorum*. Research on sRNA that can inhibit *Sclerotinia sclerotiorum*, and subsequently guide host plant production practices, is of great significance for achieving safe and stable plant yields. Summary of the Invention

[0003] The purpose of this invention is to provide an Os-miR6225y sequence that inhibits the virulence of Sclerotinia sclerotiorum. Overexpression of this miRNA in the host can significantly reduce the pathogenicity of Sclerotinia sclerotiorum mycelium and improve the host's resistance to Sclerotinia sclerotiorum disease. It can be used to screen and prepare plant lines with high resistance to Sclerotinia sclerotiorum disease and has good application prospects in improving the resistance of host plants to Sclerotinia sclerotiorum disease.

[0004] To achieve the above objectives, the present invention provides a mature miRNA of Os-miR6225y, which contains a nucleotide sequence as shown in SEQ ID NO.29.

[0005] The mature miRNA provided by this invention can be used to regulate the resistance of Sclerotinia stem rot in host or non-host plants of Sclerotinia stem rot.

[0006] This invention, by overexpressing the aforementioned mature miRNA in host or non-host plants, can be used to improve the resistance of host or non-host plants to Sclerotinia sclerotiorum rot.

[0007] This invention provides a method to reduce the resistance of host or non-host plants to Sclerotinia stem rot by silencing the expression of mature miRNAs in the host or non-host plants.

[0008] Preferably, the non-host plants mentioned above include rice or other plants.

[0009] The present invention also provides a coding sequence for encoding the above-mentioned mature miRNA, the coding sequence comprising the nucleotide sequence shown in SEQ ID NO. 18.

[0010] The mature miRNA or coding sequence provided by this invention can be used to prepare plant lines with high resistance to Sclerotinia sclerotiorum rot.

[0011] This invention also provides a method for preparing highly resistant plant lines to Sclerotinia sclerotinia disease, comprising the following steps: Construct an overexpression vector containing the nucleotide sequence shown in SEQ ID NO.18; The obtained overexpression vector was transformed into Agrobacterium to obtain overexpressing Agrobacterium; The obtained Agrobacterium overexpression was used to transfect plants, and the positive strains identified were identified as highly resistant plant strains to Sclerotinia sclerotiorum rot.

[0012] Preferably, the overexpression vector described above can be selected from eukaryotic plasmids, and more preferably from pBinGlyRed3.

[0013] The present invention has the following advantages: This invention discloses for the first time an Os-miR6225y associated with resistance to Sclerotinia sclerotiorum. Bioinformatics prediction and dual-luciferase reporter system detection show that Os-miR6225y can target effector genes of Sclerotinia sclerotiorum. Ssv263 The STTM silencing vector for Os-miR6225y was constructed using genetic engineering techniques. Transforming this vector into wild-type rice and silencing the miRNA improved the rice's susceptibility to *Sclerotinia sclerotiorum*. An overexpression vector for Os-miR6225y in *Sclerotinia sclerotiorum* was also constructed using genetic engineering techniques. Overexpression of this vector in wild-type *Sclerotinia sclerotiorum* significantly reduced pathogenicity. Furthermore, a plant overexpression vector for Os-miR6225y was constructed using genetic engineering techniques. Overexpression of this vector in wild-type *Arabidopsis thaliana* and rapeseed effectively improved the host's resistance to *Sclerotinia sclerotiorum* disease.

[0014] The Os-miR6225y provided by this invention can be used to screen and prepare plant strains with high resistance to Sclerotinia sclerotiorum rot, and has good application prospects in improving the resistance of host plants to Sclerotinia sclerotiorum rot. Attached Figure Description

[0015] Figure 1 It is Os-miR6225y and the target gene S sv263 The base binding prediction results are shown, where A represents the prediction result from the psRNATarget website and B represents the prediction result from the TAPIR website.

[0016] Figure 2 It is a dual-luciferase activity assay for Os-miR6225y and S sv263 The results of the target relationship are shown in Figure A, which is a schematic diagram of Os-miR6225y expression and empty vector construction, and a schematic diagram of target site (empty vector, wt, mut) expression vectors. Figure B shows the dual-luciferase activity detection value (Luc / Ren). The six sets of data are as follows: miR-NC bacterial culture + SsV263-EV bacterial culture, miR6225y bacterial culture + SsV263-EV bacterial culture, miR-NC bacterial culture + SsV263 wt Bacterial liquid, miR6225y bacterial liquid + SsV263 wt Bacterial solution, miR-NC bacterial solution + SsV263 mut Bacterial liquid, miR6225y bacterial liquid + SsV263 mut Bacterial solution. ** indicates... P <0.01.

[0017] Figure 3 This diagram illustrates the identification of the silenced Os-miR6225y line in rice. Figure A shows the construction of the silencing vector STTM6225, and Figure B is an electrophoresis diagram of DNA detection from the transformed plants. Different lanes represent different transgenic single plants, with an amplified fragment of 557 bp. M represents the DL2000 marker, B represents the blank control, N represents the negative control, and P represents the positive control.

[0018] Figure 4 This study identifies the resistance of *Sclerotinia sclerotiorum* to the STTM6225 transgenic rice. Figure A shows the expression levels of Os-miR6225y and the target gene SsV263 identified by RT-PCR, which show a negative correlation. Figures B and C show the in vitro inoculation phenotypes of *Sclerotinia sclerotiorum* in three silent lines of Os-miR6225y (STTM6225-01, STTM6225-03, and STTM6225-05), and the quantitative statistical analysis of plaque length of the inoculated phenotypes 48 hours later.

[0019] Figure 5 These are images of Os-miR6225y overexpression transformants. Image A shows the DNA identification of the overexpression transformants using specific primers, with numbers 1-6 indicating the selected Os-miR6225y overexpression transformants. Image B shows the expression levels of Os-miR6225y and the target gene SsV263 in the transformants, identified using RT-PCR.

[0020] Figure 6The results are phenotypic identification of Os-miR6225y overexpression transformants, where A represents the mycelial tips, mycelial growth, and sclerotium formation phenotypes of the Os-miR6225y overexpression transformants Ss-OE6225y-5 and Ss-OE6225y-6; B represents the mycelial growth rate determination of Ss-OE6225y-5 and Ss-OE6225y-6; C represents the pathogenicity identification of Ss-OE6225y-5 and Ss-OE6225y-6 inoculated on rapeseed leaves; and D represents the pathogenicity identification of Ss-OE6225y-5 and Ss-OE6225y-6 inoculated on rapeseed stems.

[0021] Figure 7 This image shows the identification of transgenic Arabidopsis lines overexpressing Os-miR6225y. Figure A shows the results of double enzyme digestion of the Ath-OE6225y vector. Lane 1 shows the vector plasmid DNA, lane 2 shows the banding after double digestion of the plasmid with BamHI and SphI, and lane M is the DNA marker. Figure B shows the expression level of Os-miR625y in homozygous transgenic lines identified by RT-PCR.

[0022] Figure 8 The identification of Sclerotinia sclerotiorum resistance in Arabidopsis thaliana Os-miR6225y transgenic lines is shown in Figure A, where A shows the phenotypes of two overexpressing transgenic Arabidopsis thaliana lines, Ath-OE6225y-8 and Ath-OE6225y-17, after in vitro inoculation with Sclerotinia sclerotiorum; B shows the bacterial plaque statistics in A 24 hours after inoculation.

[0023] Figure 9 This is the identification of transgenic rapeseed overexpressing Os-miR6225y. Figure A shows the DNA identification of transgenic Arabidopsis thaliana. Different lanes represent different transgenic single plants. The amplified fragment is 557 bp. M represents the DL2000 marker, B represents the blank control, N represents the negative control, and P represents the positive control. Figure B shows the expression level of Os-miR625y in the transgenic lines identified by RT-PCR.

[0024] Figure 10 Figure 1 shows the identification of Sclerotinia sclerotinia resistance in rapeseed overexpressing Os-miR6225y. Figure A shows the leaf inoculation phenotype of Sclerotinia sclerotinia and the statistical analysis of plaque area after 48 hours for three rapeseed lines Bn-OE6225y-5, Bn-OE6225y-12, and Bn-OE6225y-20 overexpressing Os-miR6225y. Figure B shows the stem inoculation phenotype of Sclerotinia sclerotinia and the statistical analysis of plaque length after 72 hours for the three overexpressing lines. Detailed Implementation

[0025] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0026] Note: Unless otherwise specified, the experimental methods in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field, or according to the product instructions, such as Sambrook et al.'s Molecular Cloning: A Laboratory Manual (Sambrook J & Russell DW, 2001), or according to the conditions recommended in the manufacturer's instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0027] Based on combined analysis of small RNA sequencing (sRNA-Seq) and transcriptome sequencing (RNA-Seq) of rice and rapeseed before and after inoculation with Sclerotinia sclerotiorum, this application identified a rice-specific miR6225y that responds to Sclerotinia sclerotiorum induction. This miRNA can target Sclerotinia sclerotiorum effector genes. SsV263 Based on its mature miRNA sequence characteristics and its inclusion in the microRNA database (miRBase), it is classified into the miR6225 family, a novel rice miRNA family, and designated as Os-miR6225y in this invention. This invention studies the antibacterial function of Os-miR6225y and develops pathways for enhancing host plant resistance, providing a foundation for improving sclerotinia stem rot resistance in host plants. The specific research plan is as follows:

[0028] Example 1: Screening and identification of rice miR6225y Rice has long been a non-host of *Sclerotinia sclerotiorum*. Previous experiments showed that rice inoculated with *Sclerotinia sclerotiorum* showed no visible symptoms. Even after leaf epidermal wounds, large mycelial invasion could be observed, but the lesions did not expand significantly. Therefore, rice possesses certain mechanisms to resist the spread of *Sclerotinia sclerotiorum*. To explore this reason, sRNA-Seq and RNA-Seq analyses were performed on two rice samples (Japanese late-season rice, Jinhui 10) and two rapeseed samples (Zhongshuang 11, 8M501) and their corresponding *Sclerotinia sclerotiorum* strains at four time points (0 h, 6 h, 12 h, and 24 h) before and after inoculation to identify rice-specific miRNAs targeting *Sclerotinia sclerotiorum* genes. During this process, a rice-specific miRNA, Os-miR6225y, induced by *Sclerotinia sclerotiorum* (the mature sequence of this miRNA is absent in rapeseed), was identified. Based on its mature miRNA sequence characteristics and inclusion in the microRNA database (miRBase), it is classified into the miR6225 family, a new rice miRNA family, and is designated as Os-miR6225y. Its mature sequence is SEQ ID NO.29, specifically: 5'-AGACGAAUCUUUUAAGCCUAA-3'.

[0029] The patmatch_v1.2 software was used to perform complementary pairing between small RNAs and target genes. The final results were then obtained through program-based screening and prediction. The screening criteria required the following simultaneous conditions: a maximum of 4 mismatches were allowed in the complementary relationship between the small RNA and the target gene (GU pairing counts as 0.5 mismatches); consecutive mismatches were not allowed; base mismatches were not allowed at the 5' end (positions 2-12) of the small RNA; base mismatches were not allowed at positions 10-11 of the small RNA / target; a maximum of 2.5 mismatches were allowed at positions 1-12 of the 5' end of the small RNA / target miRNA; and the minimum free energy (MFE) of the small RNA / target must be greater than or equal to 60% of the MFE for perfect binding between the miRNA and the target gene. Based on the software prediction using these parameters, the gene SsV263 (XM_001598127.1) was found to be complementary to Os-miR6225y in *Sclerotinia sclerotiorum*, confirming SsV263 as the target gene of Os-miR6225y.

[0030] Example 2 Os-miR6225y and Sclerotinia sclerotiorum SsV263 Validation of gene targeting relationships 1. Bioinformatics prediction The Os-miR6225y gene and *Sclerotinia sclerotiorum* genes were predicted using the websites psRNATarget (https: / / www.zhaolab.org / psRNATarget / ) and TAPIR (http: / / bioinformatics.psb.ugent.be / webtools / tapir / ). SsV263 Complementary binding sites of the mRNA sequence were identified, and Os-miR6225y was associated with the Sclerotinia sclerotiorum gene. SsV263 The mRNA sequence contains a complementary binding site at positions 392-412, see details below. Figure 1 As shown.

[0031] 2. Targeted Relationship Verification (1) Construction of dual-fluorescence reporter system carrier Using pGrDL_SPb plasmid as a template, and TF / SsV263 wt -R、SsV263 wt -F / TR is the primer combination (specific primer sequences are as follows), which amplifies two fragments located downstream of the luciferase reporter gene LUC, respectively. The cloned fragments are named fragment 1 and fragment 2, and the substituted target site sequence is contained in SsV263. wt -F / SsV263 wt -R. Same template, using TF / SsV263 mut -R、SsV263 mut Using -F / TR primers (specific primer sequences are shown below), fragments 3 and 4 were cloned. Fragments 1, 2, 3, and 4 were recovered from the gel and mixed at a molar ratio of 1:1 (fragment 1 + fragment 2, fragment 3 + fragment 4). Using this mixture as a template, fusion PCR was performed using TF / TR primers. The reaction mixture consisted of: 2 μL fragment 1, 2 μL fragment 2, 25 μL 2×Taq Mix, 2 μL TF (10 μM), 2 μL TR (10 μM), and 17 μL dd H2O. The reaction program was: 94 ℃, 5 min; 94 ℃, 30 s; 60 ℃, 30 s; 72 ℃, 1 min; 30 cycles, 72 ℃, 5 min; 16 ℃, 10 min. The fusion PCR product was recovered from the gel and ligated into the T vector. After the ligation product was transformed into *E. coli*, single clones were picked and sequenced using TF / TR primers. Plasmids were extracted from bacterial cultures with correct sequencing results and amplified using CZ-F / CZ-R primers (specific primer sequences are shown below) to obtain the target fragment containing the target site. Sal I / SpeThe pGrDL_SPb plasmid was double-digested with enzyme I to obtain a linearized vector backbone. The vector and target fragment were ligated using T4 DNA ligase. The ligation product was transformed into competent *E. coli* cells. A suitable number of single colonies were selected for bacterial testing using primers CZ-F / CZ-R. Plasmids were extracted from one bacterial culture that passed the bacterial test and named SsV263. wt and SsV263 mut The location of this mutation site is marked in red in the middle of the target site, see details below. Figure 2 In the A group, plasmids were extracted for transformation of Agrobacterium competent cells.

[0032] The primer sequences described above are as follows (all 5'-3'): TF (SEQ ID NO.1): CGCCGGTGAACTTCCCGCCG, TR (SEQ ID NO.2): CTGGATTTTGGTTTTAGGAAT, SsV263 wt -F (SEQ ID NO.3): GTCGACTTCGTCTTGAAAGATTCGTCTCTGCAGTCGCCATGCGG, SsV263 wt -R (SEQ ID NO.4): AGACGAATCTTTCAAGACGAAGTCGACAAGGAATTCTTACACGG, SsV263 mut -F (SEQ ID NO.5): GTCGACTTCGTCTTGATTCTAAAGGTCTCTGCAGTCGCCATGCGG, SsV263 mut -R (SEQ ID NO.6): AGACCTTAGAATCAAGACGAAGTCGACAAGGAATTCTTACACGG, CZ-F (SEQ ID NO.7):GTGTAAGAATTCCTTGTCGAC, CZ-R (SEQ ID NO. 8): ACTACTCACACATTAACTAGT.

[0033] (2) Agrobacterium transformation GV3101 (pSoup) Agrobacterium competent cells stored at -80 ℃ were thawed in an ice-water bath. Under aseptic conditions, 100 ng to 1 μg of the constructed plasmid DNA was added to the competent cells and gently mixed. The mixture was then incubated in an ice-water bath for 5 min. The centrifuge tubes were then rapidly frozen in liquid nitrogen for 5 min. The centrifuge tubes were then quickly placed in a 37 ℃ water bath for 5 min, without disturbing the water surface. The centrifuge tubes were returned to the ice-water bath and incubated for 5 min. Under aseptic conditions, 800 μL of antibiotic-free LB broth was added, and the mixture was incubated at 28 ℃ with shaking for 2–3 hours. The cells were collected by centrifugation at 5000 rpm for 5 min, and approximately 100 μL of supernatant was collected. The cells were gently resuspended by pipetting, and a suitable amount of the bacterial suspension was spread onto LB agar plates containing the appropriate antibiotic. The plates were then incubated upside down overnight in a 28 ℃ incubator. Simultaneously, Agrobacterium transformed with the wild-type pGrDL_SPb plasmid was also constructed.

[0034] (3) Transient co-expression of tobacco Agrobacterium carrying the recombinant plasmid was cultured overnight at 28°C. After centrifugation, the supernatant was discarded, and an appropriate amount of tobacco suspension was added to suspend the bacterial cells. The OD600 value was adjusted to 0.6-1.2. The cells containing pGrDL_SPb(EV) and SsV263 were then cultured. wt and SsV263 mut The bacterial culture of the vector was mixed with the bacterial culture of miR-NC (GV3101 containing the empty plasmid pBin35SRed) and miR6225y (pBin35S-miR6225y) at a ratio of 1:10 and then injected into tobacco leaves (according to different combination ratios: miR-NC+EV, miR6225y+EV, miR-NC+SsV263). wt miR6225y+ SsV263 wt miR-NC + SsV263 mut and miR6225y + SsV263 mut One-month-old leaves of *Nicotiana benthamiana* were injected. Using a 1 mL syringe, two wounds were made on each leaf, with the veins as the boundary. Three leaves were injected with 1 mL of the solution, and the infection sites were circled with a marker. Three leaves were injected into each group of bacterial suspensions. The treated tobacco leaves were marked and incubated in the dark for 2-3 days. Leaves were then cut from the circled areas and ground. The fluorescence intensity of luciferase was then detected according to the instructions of the Promega Dual-Luciferase Reporter Assay System kit. The experiment was performed in triplicate. The interaction between Os-miR6225y and the *Sclerotinia sclerotiorum* SsV263 gene was confirmed by dual-luciferase activity assay. The results are shown in [Figure number missing]. Figure 2 The six sets of data are, in order: miR-NC+EV, miR6225y+EV, miR-NC+SsV263wt miR6225y+ SsV263 wt miR-NC+ SsV263 mut and miR6225y + SsV263 mut ** indicates that P < 0.01.

[0035] Example 3: Construction of Os-miR6225y rice silencing vector and acquisition of silencing lines The mature miRNA sequence of Os-miR6225y is shown in SEQ ID NO.29. Os-miR6225y was knocked out using Short Target Membrane Technique (STTM). The principle of this technique is that STTM consists of a specific 48nt sequence bridging two TMs. At the miRNA cleavage sites of these two TMs (between bases 10 and 11), there is a 3-base (cta) protrusion. This structure allows the miRNA to bind to it but prevents it from cleaving. In other words, the miRNA competes with STTM for binding, hindering the recognition and cleavage between the miRNA and its target gene.

[0036] Reference Appendix Figure 3 Based on the above principles, the transcript structure of STTM6225 was designed. This designed sequence was sent to a biotechnology company, and BamHI and SacI were used to place this sequence after the rice-specific promoter Ubi in the vector pTCK303. A schematic diagram of the vector construction is shown below. Figure 3 In section A, after the biotechnology company returned the constructed vector plasmid, it sequenced it to ensure the correct insertion sequence. The vector was then sent to Wuhan Tianwen Biotechnology Co., Ltd. for rice genetic transformation, with the recipient being japonica rice Zhonghua 11 (ZH11). The company returned several rice seedlings, and PCR identification was performed using primers hpt557-F / hpt557-R (specific sequences below). The results showed 27 positive STTM6225 silent rice seedlings and 3 negative seedlings. The PCR identification results are shown below. Figure 3 B in the middle.

[0037] hpt557-F (SEQ ID NO.9): 5'- ACACTACATGGCGTGATTTCAT-3', hpt557-R (SEQ ID NO. 10): 5'-TCCACTATCGGCGAGTACTTCT-3'.

[0038] Example 4: Detection of Sclerotinia stem rot resistance in the Os-miR6225y rice silent strain During the tillering stage of rice, take the second leaf from the bottom of wild-type and silent rice plants, place them in a sealable box lined with moist filter paper or a towel, press the ends of the leaves firmly with moist cotton, and then attach 6 mm sclerotium mycelial blocks to the leaf surface. Inoculate 3 places on each leaf and incubate at 22 ℃ with humidity.

[0039] Rice leaves and mycelia were collected 24 h after inoculation and total RNA was extracted using the TRNzol method. The miRNA was reverse transcribed (tailing method) using TransScript® miRNA First-Strand cDNA Synthesis SuperMix produced by Beijing TransGen Biotech Co., Ltd. The system was as follows: 5 μL Total miRNA, 1 μL TransScript® miRNA RTEnzyme Mix, 10 μL 2×TS miRNA Reaction Mix, 4 μL RNase-Free Water. The reaction program was 37℃ for 1 h. After reverse transcription of miRNA, quantitative real-time PCR was performed to detect the expression level of Os-miR6225y in STTM6225-silenced rice, using OsU6 as an internal control (primers: OsU6F (SEQ ID NO.11): 5′-CGATAAAATTGGAACGATACAGA-3′; Universal miRNA-R (SEQ ID NO.12): 5′-GATCGCCCTTCTACGTCGTAT-3′). The PCR reaction program was as follows: pre-denaturation at 94℃ for 5 min; 45 cycles of 94℃ for 20 s, 56℃ for 20 s, and 72℃ for 20 s. Then, the melting curve was collected: the temperature was adjusted to 60℃ for 90 s for pre-dissolution; then the temperature was increased at a rate of 1.0℃ / s, and held for 5 s for every 1℃ increase, until 95℃ was reached.

[0040] Using the total RNA mentioned above as a template, cDNA reverse transcription was performed using Evo M-MLV RTPremix for qPCR produced by Aikerui Biotechnology Co., Ltd. The system was as follows: 1 μg Total RNA, 2 μL 5X Evo M-MLV RTMaster Mix, and RNase-free water to a final volume of 10 μL. The reaction conditions were: 37 ℃ for 15 min; 85 ℃ for 5 sec; and 4 ℃ for storage. Real-time quantitative PCR was performed using the reverse-transcribed cDNA, with Sstub as the internal reference gene (primer sequences: QSstub-F (SEQ ID NO.14): 5′- GTGAGGCTGAGGGCTGTGA-3′; QSstub-R (SEQ ID NO.15): 5′-CCTTTGGCGATGGGACG-3′) to detect the expression level of the target gene SsV263 (primer sequences: QSsV263-F (SEQ ID NO.16): 5′-CGACTTTGAGGATGGAACTTG-3′; QSsV263-R (SEQ ID NO.17): 5′-AGACGAATCTTTCAAGACGAA-3′). The PCR reaction program was as follows: pre-denaturation at 94℃ for 5 min; 94℃ for 20 s, 56℃ for 20 s, 72℃ for 20 s, for 41 cycles. Then, the melting curve was collected: the temperature was adjusted to 60℃ for 90 s for pre-dissolution; then the temperature was increased at a rate of 1.0℃ / s, and held for 5 s for every 1℃ increase, until 95℃ was reached.

[0041] refer to Figure 4 Fluorescent PCR results showed that the expression levels of Os-miR6225y in the STTM6225 silent rice lines were decreased to varying degrees compared to ZH11, and the expression levels of its target gene SsV263 were negatively correlated with those of Os-miR6225y. (See attached figures.) Figure 4 A in the middle.

[0042] Based on the quantitative fluorescence results, three STTM6225 lines (designated STTM6225-1, STTM6225-3, and STTM6225-5) were selected for sclerotinia disease resistance identification. 48 hours after inoculation, the lesion lengths of the three STTM6225 lines were 13.21±2.42 cm, 13.11±2.26 cm, and 12±2.43 cm, respectively, significantly larger than those of wild-type rice ZH11 (5.57±1.71 cm) (P<0.01). The lesion area of ​​the Os-miR6225y silent transgenic lines increased by 115.6%-137.4%, respectively. (See attached figures). Figure 4 B and Figure 4 C in the middle.

[0043] Example 5 Construction and transformation of the Sclerotium sclerotiorum transgenic vector Ss-OE6225y of Os-miR6225y 1. Carrier Construction The precursor sequence of Os-miR6225y (its nucleotide sequence is shown in SEQ ID NO.18) is difficult to obtain during conventional amplification due to its unique hairpin structure. To save time and obtain the correct sequence, this sequence was sent to a biotechnology company for synthesis. The plasmid containing this sequence returned by the biotechnology company was amplified using primers OEmiR6225-F / OEmiR6225-R (specific sequences are shown below). Additionally, [further details are needed]. EcoR The pEF1 vector plasmid was digested with V single enzyme, and the digestion volume was 2 μL. EcoRV. 5 μL plasmid DNA (pEF1 vector, 1000 ng / μL), 5 μL 10x FastDigest buffer, 38 μL ddH2O were incubated in a PCR instrument at 37 °C for 1 h. The amplification product and enzyme digestion product were separated by 1% agarose gel electrophoresis. A gel block of the target fragment size (Os-miR6225y precursor sequence is 164 bp, pEF1 vector is approximately 9000 bp) was collected in a 1.5 mL centrifuge tube and recovered using an agarose gel extraction kit. The linearized pEF1 vector was dephosphorylated using the following reaction system: 1 μL Quick CIP, 5 μL CutSmart® Buffer, 2 μL DNA (1000 ng / μL), 12 μL ddH2O. The reaction conditions were 37 °C for 30 min; 80 °C for 2 min. The precursor sequence obtained from the gel recovery and the dephosphorylated linearized pEF1 vector were ligated using T4 DNA ligase. The ligation system consisted of 3 μL gel-recovered product, 3 μL pEf1 vector, 1 μL T4 DNA Ligase, and 3 μL ddH2O. Ligation was performed in a PCR instrument at 22 °C for 1 h. The ligation product was transformed into competent *E. coli* cells. An appropriate number of single clones were picked and cultured in LB broth containing the corresponding antibiotic (with added Amp, 100 mg / mL) at 37 °C for 6–8 hours using a shaker at 200 rpm. After incubation, bacterial PCR was performed using primers OEmiR6225-F / GFP-R. The PCR system was: 2 μL bacterial culture, 12.5 μL 2×Taq Mix, 2 μL OEmiR6225-F (10 μM), 2 μL GFP-R (10 μM), and 6.5 μL ddH2O. The reaction program was: 94 °C, 5 min; 94 °C, 30 s; 58 °C, 30 s; 72 °C, 30 s; 30 cycles, 72 °C, 5 min; 16 °C, end. The amplified bacterial cultures were sent to a biotechnology company for sequencing. Plasmids with correct sequencing results were extracted and used for *Sclerotinia sclerotiorum* protoplast transformation.

[0044] Os-miR6225y precursor sequence (SEQ ID NO.18): 5'-AAAACTAATTTCATAACTCGTCTGGAAACCGCGAGAAGAATCTCTTGAGCCTAATTAATCCGTCATTAGCACATGCGGGTTACTGTAGCATTTATGGCTAATCATGACCTAATTAGGCTTAAAAGATTCGTCTCGCGATTTACATGCAAATTGTGTAATTAGTTT-3'; OEmiR6225-F (SEQ ID NO.19): 5'-tcacaatcgatccaaGATATCTTTGGCTGTAGCAGCAGCAG-3'; OEmiR6225-R (SEQ ID NO.20): 5'-ggaaaccatgatatcCTATAGCAGAACAGCCTAGCAGCAGGA-3'); GFP-R (SEQ ID NO.21); 5'-CTCTTGGACATTCCTCTGG-3'.

[0045] 2. Preparation and transformation of Sclerotinia sclerotiorum protoplasts The *Sclerotinia sclerotiorum* strain '1980' was inoculated onto potato dextrose (PDA) medium lined with cellophane and cultured for 36 h. One to two dishes of mycelium were scraped from a clean bench and placed into 100 mL of PDB medium, and cultured at 22 ℃ and 150 rpm for 36 h with shaking. The cultured mycelium was filtered through a 300-mesh sieve to obtain mycelial cells, which were then washed twice with 0.8 M MgSO4. The mycelial cells were then transferred to an enzymatic hydrolysate and incubated at 30 ℃ and 150 rpm for 2–3 h, with 1 mL of the hydrolysate observed on a counting plate during this period. The hydrolysate was filtered through a sterile funnel and centrifuged at 4000 rpm and 4 ℃ for 10 min; the precipitate was the *Sclerotinia sclerotiorum* protoplasts. The precipitate was washed twice with 2–5 mL of 0.8 M MgSO4 solution and centrifuged at 4000 rpm and 4 ℃ for 10 min. After min, discard the supernatant; resuspend the protoplast suspension by pipetting, and dispense 100 μL into 1.5 mL centrifuge tubes; store the prepared Sclerotinia sclerotiorum protoplasts in a -80 ℃ freezer for later use.

[0046] After linearization by single-enzyme digestion of the Ss-OE6225y plasmid, *Sclerotinia sclerotiorum* strain 1980 was transformed using PEG-mediated protoplast transformation. The specific steps were as follows: After single-enzyme digestion of the plasmid, gel extraction was performed, and 2 μL of spermidine and 2 μL of heparin sodium were added to the gel extraction product. This mixture was then added to 100 µL of prepared protoplasts and incubated on ice for 40 min. 1 mL of PTC was added to a centrifuge tube and gently mixed, without shaking or vortexing, and incubated at 25 °C for 30 min. The mixture was then added to prepared RM bottom medium (the medium temperature should not be too high; it should be warm to the touch). The medium was gently shaken to mix, and then quickly poured into petri dishes, approximately 20 mL per dish. The dishes were incubated upside down at 22 °C. After 16 h of incubation, the petri dishes were reopened, and approximately 5 mL of RM top medium containing 200 µg / L hygromycin was added, ensuring the top medium evenly covered the bottom. The dishes were then incubated upright at 22 °C for approximately 4 hours. After 5 days, visible colonies will grow on the surface of the top culture medium. Single colonies growing from the top culture medium surface are picked up with an inoculation needle and placed on PDA medium containing hygromycin (300 µg / mL), and incubated upside down in the dark at 22 ℃ for 1 day. Single mycelia on the medium are continuously placed on hygromycin-containing medium for screening. Single colonies that have undergone three screenings are numbered to obtain transformants with stable hygromycin resistance.

[0047] Transformants selected for hygromycin resistance were inoculated onto PDA medium lined with cellophane and incubated at 22 °C for 36 h. Hyphae were scraped into 2 mL centrifuge tubes containing steel beads and immediately placed in liquid nitrogen. Sclerotinia sclerotiorum DNA was extracted using the CTAB method. Using Sclerotinia sclerotiorum 1980 as a control, PCR amplification was performed using primers OEmiR6225-F / GFP-R. Single hyphae with a product of 402 bp were selected as positive transformants. Additionally, total RNA was extracted from the hyphae using the TRNzol method, and miRNA and cDNA were obtained by reverse mixing using the method described in Example 4. Quantitative PCR of miRNA was performed using SsU6-F as an internal control. The specific amplification primers for the internal control are as follows: For detecting the expression level of Os-miR6225y in the Ss-OE6225 transformant, the detection primers are RT-miR6225F and UniversalmiRNA-R. Quantitative PCR was performed using the reverse-transcribed cDNA, with Sstub as the internal control gene (internal control detection primers are QSstub-F and QSstub-R), and for detecting the expression level of the target gene SsV263 (detection primers are QSsV263-F and QSsV263-R). The PCR reaction procedure was the same as in Example 4.

[0048] Internal reference primer SsU6-F (SEQ ID NO.22): 5′-CCAGTCAGCTTCCTCCTCTC-3′; Universal miRNA-R (SEQ ID NO.12):: 5′-GATCGCCCTTTCTACGTCGTAT-3′; PCR testing identified six positive transformants with bands of 402 bp each. Figure 5 In the A section, quantitative real-time PCR showed that the expression levels of Os-miR6225y in all six transformants were higher than those in the wild-type strain 1980, while the expression level of the target gene SsV263 resisted that of the wild-type strain 1980. Figure 5 B in the middle.

[0049] Example 6 Phenotypic Identification of Transgenic Sclerotinia sclerotiorum Os-miR6225y Based on the quantitative PCR results in Example 5, transformants Ss-OE6225-5 and Ss-OE6225-6 were selected for subsequent phenotypic identification. Wild-type *Sclerotinia sclerotiorum* strain 1980 (wt) and the transformants were activated on ordinary PDA medium. A 6 mm diameter punch was used to make holes along the edge of the hyphae, and fresh hyphal blocks were transferred to the center of a new PDA medium (20 mL / plate). The medium was then incubated at 22 ℃ in a mold incubator. The growth diameter was measured every 12 h using the cross-sectional method, and the average value was used to calculate the growth area. S (Calculated in circles, unit: cm) 2 ) and the degree of change in growth area D S , D S (%)=100*( S 转化子 - S wt ) / S wt The experiment was repeated 5 times, with 5 dishes per treatment / replication. The *Sclerotinia sclerotiorum* strains that had undergone growth rate determination were then cultured in a 22 °C mold incubator, and sclerotium formation was observed after 10 days of culture.

[0050] Mycelial blocks were collected from the edges of mycelia cultured on PDAs for 36 h using a 6 mm punch. During the 6-9 leaf stage of rapeseed, inoculation was performed on the third leaf from the bottom of the *Shuang 11* variety of rapeseed using the detached leaf inoculation method. Five leaves were inoculated per strain at a time, with two mycelial blocks inoculated on each leaf. After inoculation, the plants were placed at 22±1°C and >85% humidity. Forty-eight h after inoculation, the long diameter *a* and short diameter *b* of the mycelial plaques were measured using the cross-crossing method, and the results were calculated using the formula... s =π*a*b / 4 Calculate the diseased area of ​​the leaf and the degree of change in lesion area. d s(%)=100*( s 转化子 - s wt ) / s wt The experiment was repeated 5 times.

[0051] Mycelial blocks were collected from the edges of mycelia cultured on PDAs for 36 h using a 6 mm punch. Two weeks before rapeseed maturity, the mycelial blocks were inoculated onto the flat internodes of rapeseed variety Shuang 11 using the in vitro stem inoculation method. Five stems were inoculated for each strain at a time, with three mycelial blocks inoculated on each stem, spaced 15 cm apart. After inoculation, the plants were placed at 22±1°C and >85% humidity. The length of the mycelial plaques was measured after 96 h. l Calculate the degree of change in lesion length d l (%)=100*( l 转化子 - l wt ) / l wt The experiment was repeated 5 times.

[0052] Phenotypic identification showed that the Ss-OE6225-5 and Ss-OE6225-6 transformants did not differ significantly from the wild-type 1980 in mycelial morphology, growth rate, and sclerotium formation. The mycelial growth of the Os-miR6225y overexpression transformants Ss-OE6225y-5 and Ss-OE6225y-6 is shown in [the table below]. Figure 6 The mycelial growth rates of A, Ss-OE6225y-5, and Ss-OE6225y-6 were measured as follows: Figure 6 In the pathogenicity assay, the lesion area inoculated with the Ss-OE6225y transformant was significantly lower than that inoculated with the wild-type strain "1980" (P<0.01). Specifically, the lesion area inoculated with the Ss-OE6225y transformant (S Ss-OE6225y-5 =2.86 ± 0.48 cm 2 S Ss-OE6225-6 = 2.82 ± 0.62 cm 2 ) and 1980 (S 1980 = 6.84 ± 0.93 cm 2 Compared to that, it decreased by 58.2% and 58.8% ( P <0.01), while there was no significant difference between the two transformants (P =0.9017) (see Figure 6 The lesion length of the inoculated transformant was also significantly shorter than that of the wild-type 1980 (P<0.01), that is, the lesion length of the inoculated Ss-OE6225y transformant (L) was significantly shorter. Ss-OE6225y-5=1.74 ± 0.17 cm, L Ss-OE6225-6 =1.81 ± 0.48 cm) and 1980 (L 1980 = 3.167 ± 0.31 cm) compared to 45.1% and 42.6%, respectively, while there was no significant difference between the two transformants (P = 0.7056) (see Figure 6 (D in the above results) In summary, the expression of Os-miR6225y in Sclerotinia sclerotiorum does not affect the growth and development of Sclerotinia sclerotiorum, but only affects its pathogenicity.

[0053] Example 7 Construction and transformation of the plant transgenic vector Ath-OE6225y of Os-miR6225y The plasmid containing the Os-miR6225y precursor sequence returned by the biotechnology company is the one used for [the purpose of this]. Xba I / Xho The pBinGlyRed3-OsmiR6225y plasmid, containing the precursor sequence, was ligated at the I restriction site. The returned vector was sequenced and validated by double restriction enzyme digestion; the validation results are shown below. Figure 7 The plasmid was then transferred into Agrobacterium for Arabidopsis thaliana genetic transformation.

[0054] Agrobacterium tumefaciens culture was cultured overnight at 28 °C and 200 rpm in LB liquid medium containing Kan (50 mg / L), Rif (25 mg / L), and Str (25 mg / L). The cultured Agrobacterium tumefaciens culture was transferred to 50 ml sterile centrifuge tubes and centrifuged at 4 °C and 4000 rpm for 10 min using a low-temperature high-speed centrifuge. The supernatant was discarded. An appropriate amount of infection suspension was added to the centrifuge tubes and the precipitate was agitated to suspend the bacteria. The OD 600 of the infection solution was adjusted to 0.8 ~ 1.0 using a spectrophotometer. Wild-type Arabidopsis thaliana Col-0 was grown in an artificial climate incubator. After the fertilized pods were removed during the full flowering period, the Arabidopsis thaliana inflorescences were immersed in the infection solution and gently shaken for 30 s. After removal, the Arabidopsis thaliana was covered with plastic wrap to keep it moist and cultured in the dark for 24 h. Then, it was transferred to an incubator for normal culture. To improve the infection efficiency, the above steps can be repeated 2-3 times. The seeds were harvested after the Arabidopsis thaliana matured.

[0055] After infection, Arabidopsis seeds were irradiated with 540nm excitation light using a handheld LUYOR-3415RG dual fluorescent protein observation lamp. Seeds exhibiting red fluorescence were selected as the T0 generation under LUV-50A glasses. After planting the T0 generation seeds, individual plants were harvested to obtain T1 seeds. The seeds of each individual plant were irradiated and screened again, and the ratio of red fluorescent to non-fluorescent seeds was selected to plant the next generation of the line. Approximately 20 plants were planted in each line. The plants in the T2 generation that exhibited all red fluorescence were considered homozygous plants of that line.

[0056] DNA was crudely extracted from the leaves of transformed Arabidopsis thaliana and wild-type Arabidopsis thaliana (negative control) seedlings using the CTAB method and then identified by PCR. The primer combination used was pLRed-F / pLRed-R, and the specific sequence is as follows. Plants with a 396 bp amplified fragment were identified as transgenic positive plants.

[0057] pLRed-F (SEQ ID NO. 23): 5'-ATGGCCTCCTCCGAGAAC-3'; pLRed-R (SEQ ID NO.24): 5'-GTCGGAGGGGAAGTTCAC-3'), One to two young leaves from homozygous positive transgenic plants were placed into 2 ml RNase-free centrifuge tubes containing steel beads and immediately placed in liquid nitrogen. Total RNA was extracted using the TRNzol method, and miRNA reverse transcription was performed using the tailing method, following the same transcription steps as in Example 5. After reverse transcription to synthesize miRNA, quantitative real-time PCR was performed for detection. AT-U6 As an internal control (primers are shown below), the expression level of Os-miR6225y in transgenic Arabidopsis thaliana was detected (detection primers are shown in SEQ ID NO.13 and SEQ ID NO.12). The PCR reaction procedure was the same as in Example 5.

[0058] Internal reference primer: AtU6-F (SEQ ID NO.25): 5′-CGATAAAATTGGAACGATACAG-3′; Universal miRNA-R12 (SEQ ID NO.12): 5′-GATCGCCCTTTCTACGTCGTAT-3′); Eighteen positive transgenic lines were identified by PCR. Quantitative real-time PCR was performed on six homozygous transgenic lines, Ath-OE6225y (#1, #2, #5, #8, #12, #17). The expression levels of Os-miR6225y in these six transgenic lines were all higher than those in wild-type Arabidopsis thaliana Col-0 and the empty vector Arabidopsis thaliana EV. Specifically, the expression levels of Ath-OE6225y-8 and Ath-OE6225y-17 were 55.10 and 61.46 times higher than those in Col-0 and EV, respectively. (See details below.) Figure 7 B in the middle.

[0059] Example 8 Phenotypic Identification of Transgenic Arabidopsis thaliana Os-miR6225y Leaves of uniform growth stage from Arabidopsis thaliana seedlings were selected as inoculation material. Mycelial blocks were extracted from the edge of the mycelium of wild-type Sclerotinia sclerotiorum strain cultured for 36 hours using a 2 mm diameter punch. In vitro inoculation was employed, with the mycelial-covered side attached to the surface of the Arabidopsis leaf. The leaves were incubated at 22 ℃ under humidity. 24 hours after inoculation, the diameter of the lesion was measured using a cross-sectional method with the inoculation point as the center, and the lesion area was calculated using the same method as in Example 6. The experiment was repeated three times, with at least five seedlings inoculated for each line each time.

[0060] Phenotypic identification of Arabidopsis thaliana revealed that, 24 h after inoculation, the lesion area of ​​Ath-OE6225y-8 and Ath-OE6225y-17 was 0.52 ± 0.15 cm². 2 0.73 ± 0.21 cm 2 It was significantly smaller than the wild type (1.03 ± 0.23 cm). 2 (1.29 ± 0.19 cm) compared to the unloaded control. 2 The leaf spot area (P<0.01) and the transgenic lines showed increased resistance to sclerotinia stem rot by 62.5% and 52.1%, respectively. The phenotype and quantitative results after infection are shown in […]. Figure 8 As shown in A and B in the diagram.

[0061] Example 9: Construction and transformation of the plant transgenic vector Bn-OE6225y of Os-miR6225y The plasmid containing the sequence returned by the biotechnology company was amplified using primers PremiR6225-F / PremiR6225-R (specific sequence below). The pC1300s vector plasmid was then digested with BamHI and KpnI, using the same digestion system as in Example 5. The gel recovery, ligation, and bacterial testing procedures were also performed as in Example 5. Following these steps, bacterial cultures with correct bacterial testing were sent for sequencing, and plasmids with correct sequencing results were extracted for rapeseed genetic transformation.

[0062] PremiR6225-F (SEQ ID NO.26): 5'-gagctcggtacccggggatccTTTGGCTGTAGCAGCAGCAG-3', PremiR6225-R (SEQ ID NO.27): 5'-cttgcatgcctgcaggtcgacCAGAACAGCCTAGCAGCAGGA-3' The plasmid was then sent to Wuhan Tianwen Biotechnology Co., Ltd. for genetic transformation of rapeseed, with the recipient being the susceptible rapeseed plant Westar. The company returned several rapeseed tissue culture seedlings, and PCR identification was performed using primers hpt557-F / hpt557-R (specific sequences shown in SEQ ID NO. 9 and 10). The results showed 24 positive transgenic seedlings. PCR identification results are shown below. Figure 9 A in the middle.

[0063] Transgenic Brassica napus (T2 generation) was obtained through multiple generations in an incubator. One to two young leaves from positive T2 generation transgenic plants were placed in 2 ml RNase-free centrifuge tubes containing steel beads and immediately placed in liquid nitrogen. Total RNA was extracted using the TRNzol method, and miRNA reverse transcription was performed using the tailing method, following the same transcription steps as in Example 5. After reverse transcription to synthesize miRNA, quantitative real-time PCR was performed. AT-U6 was used as an internal control (BnU6-F and Universal miRNA-R, specific sequences below) to detect the expression level of Os-miR6225y in transgenic Brassica napus. The specific sequences are SEQ ID NO. 13 and 12. The PCR reaction procedure was the same as in Example 5. The quantitative real-time PCR results showed that the expression levels of Os-miR6225y in Bn-OE6225y-5, Bn-OE6225y-12, and Bn-OE6225y-20 were all higher than those in wild-type Westar. (See attached table). Figure 9 B in the middle.

[0064] BnU6-F (SEQ ID NO.28): 5′-TTGGAACGATACAGAGAAGATTAGCA-3′; UniversalmiRNA-R (SEQ ID NO.12): 5′-GATCGCCCTTTCTACGTCGTAT-3′.

[0065] Example 10 Phenotypic Identification of Transgenic Rapeseed Overexpressing Os-miR6225y Leaf resistance (9-12 leaf stage, taking the top three leaves) and stem resistance (green pod stage, taking samples from 30-60 cm above ground) were assessed in wild-type and transgenic rapeseed. Mycelial blocks were collected from the edge of the mycelium of the wild-type *Sclerotinia sclerotiorum* strain after 36 h of culture using a 6 cm diameter punch. In vitro inoculation was performed by attaching the mycelium-covered side to the surface of *Arabidopsis thaliana* leaves and incubating at 22 ℃. The leaf plaque area and stem plaque length were recorded at 48 h and 72 h after inoculation, respectively. The calculation method was the same as in Example 6. The experiment was repeated three times, with at least five individual plants inoculated for each line each time.

[0066] Phenotypic identification of transgenic rapeseed revealed that, 48 hours after inoculation, the plaque areas of the three transgenic lines (#5, #12, and #20) were 8.87 ± 2.36 cm². 2 8.56±3.49 cm 2 and 11.30±3.80 cm 2 It was significantly smaller than the wild control plant (16.77 ± 2.31 cm). 2 (P<0.01) (see) Figure 10 (A, phenotype and quantitative results); Sclerotinia stem resistance was assessed in transgenic rapeseed plants of the same species. 72 h after inoculation, the mycelial plaque lengths of the three identical transgenic lines (#5, #12, and #20) were 2.45±1.19 cm, 2.47±0.75 cm, and 3.94±1.41 cm, respectively, significantly shorter than the 6.62±0.85 cm of the wild control plant (P<0.01) (see A, phenotype and quantitative results); Figure 10 (B in the figure, phenotype and quantitative results).

[0067] Although the present invention has been described in detail through the preferred embodiments above, it should be understood that the above description should not be considered as a limitation of the present invention. Various modifications and substitutions to the present invention will be apparent to those skilled in the art after reading the above description. Therefore, the scope of protection of the present invention should be defined by the appended claims.

Claims

1. A mature miRNA of Os-miR6225y, characterized in that The mature miRNA comprises the nucleotide sequence shown in SEQ ID NO.

29.

2. Use of the mature miRNA according to claim 1 in regulating the resistance of Sclerotinia sclerotiorum host or non-host plant to sclerotinia disease.

3. The use according to claim 2, characterized in that By overexpressing the mature miRNA in host or non-host plants, the miRNA can be used to improve the resistance of host or non-host plants to Sclerotinia sclerotiorum.

4. The use according to claim 2, characterized in that By silencing the expression of the mature miRNA in the host or non-host plant, it can be used to reduce the resistance of the host or non-host plant to Sclerotinia sclerotiorum.

5. The use according to claim 3 or 4, characterized in that The non-host plant comprises rice.

6. The coding sequence encoding the mature miRNA according to claim 1, characterized in that The coding sequence comprises the nucleotide sequence shown in SEQ ID NO.

18.

7. Use of the mature miRNA according to claim 1 or the coding sequence according to claim 6 in preparing a plant strain highly resistant to Sclerotinia sclerotiorum.

8. A method for preparing a plant strain highly resistant to Sclerotinia sclerotiorum, characterized in that: The following steps are included: Constructing an overexpression vector comprising the nucleotide sequence shown in SEQ ID NO.18; Transforming the overexpression vector into Agrobacterium to obtain overexpression Agrobacterium; The overexpression Agrobacterium is transfected into plants to obtain positive strains, and the identified positive strains are plant strains with high resistance to Sclerotinia sclerotiorum.

9. The method according to claim 8, characterized in that The overexpression vector is a eukaryotic plasmid.

10. The method according to claim 9, characterized in that The eukaryotic plasmid is selected from pBinGlyRed3.

Images