Application of rice endosperm protein content gene

The OsAFB3 gene was edited through the CRISPR/Cas9 system to regulate the protein content of rice endosperm, which solved the problem of unclear protein genetic regulation mechanism in the improvement of rice quality, and achieved the improvement of rice nutritional value and food taste quality.

CN120485202APending Publication Date: 2025-08-15INST OF FOOD CROPS HUBEI ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510570271.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-06
Publication Date
2025-08-15

AI Technical Summary

Technical Problem

In the prior art, the genetic regulation mechanism of endosperm protein content and components of rice has not been systematically analyzed, resulting in a lack of theoretical guidance on the improvement of rice quality, and it is difficult to cultivate new varieties with high yield characteristics and high-quality protein traits.

Method used

The OsAFB3 gene was edited using the CRISPR/Cas9 system, and by knocking out the OsAFB3-T target, the protein content of rice endosperm was regulated, the total protein and gluten content was increased, and the content of globulin, gliprotein and albumin were reduced.

Benefits of technology

It significantly regulates the protein content of rice endosperm, improves the nutritional value and food taste quality of rice, and achieves a multi-dimensional improvement in rice quality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120485202A_ABST
    Figure CN120485202A_ABST
Patent Text Reader

Abstract

The invention provides application of a rice endosperm protein content gene, and belongs to the technical field of biology. According to the application, the OsAFB3 gene is used for regulating and controlling the content of the rice endosperm protein. According to the application of the rice endosperm protein content gene provided by the embodiment of the invention, the OsAFB3 gene is used for regulating and controlling the content of the rice endosperm protein, and the effect is remarkable.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present disclosure relates to the field of biotechnology, and in particular to an application of a rice endosperm protein content gene. Background Art

[0002] As the staple food for over half of the world's population, improving both rice yield and quality is a core issue in ensuring food security. Driven by dwarfing breeding and hybrid vigor technologies, rice yields have achieved historic breakthroughs, essentially addressing the rigid demand for "quantity." However, with the upgrading of consumption patterns, the market's focus on rice quality has shifted from "high yield and guaranteed supply" to "nutrition and health," with a particularly significant increase in demand for refined protein content and composition. Therefore, cultivating new rice varieties that combine high yield with high-quality protein has become a strategic direction that urgently needs breakthroughs in modern rice breeding.

[0003] Rice quality traits include appearance, processing, cooking, flavor, and nutritional quality. Protein, the second-largest endosperm storage substance after starch, has a multi-dimensional regulatory effect on rice quality. Endosperm proteins primarily include glutenins, albumins, globulins, and alcohol-soluble proteins. Glutenins, the primary storage protein, have an amino acid composition that directly influences the nutritional value of rice. Alcohol-soluble protein accumulation is negatively correlated with rice grain transparency and flavor quality. The metabolic dynamics of albumins and globulins regulate the polished rice yield during processing.

[0004] At present, the genetic regulatory mechanism of endosperm protein content and composition has not been systematically analyzed, resulting in a lack of theoretical guidance for rice quality improvement; the identified storage protein-related genes are mostly limited to genes encoding structural proteins, while upstream signaling factors that regulate protein synthesis rate, transport efficiency and subcellular localization are rarely reported; therefore, the discovery of new endosperm protein regulatory genes has become an urgent problem that needs to be solved.

[0005] Public content

[0006] To solve the problems of the prior art, the present disclosure provides an application of a rice endosperm protein content gene. The technical solution is as follows:

[0007] The present disclosure provides an application of a rice endosperm protein gene, which includes: using the OsAFB3 gene to regulate the content of rice endosperm protein.

[0008] Specifically, the application includes: modifying the amino acid sequence of the OsAFB3 gene to increase the total protein content and gluten content, and reduce the globulin content, alcohol-soluble protein content and albumin content.

[0009] Specifically, the application includes: selecting OsAFB3-T in the sequence of the OsAFB3 gene as a target for gene knockout, wherein the sequence of the OsAFB3-T is shown in SEQ ID NO: 1 in the sequence listing;

[0010] An OsAFB3 gene knockout vector was constructed based on the OsAFB3-T using a first forward primer, a first reverse primer, a second forward primer, and a second reverse primer, wherein the sequence of the first forward primer is shown in SEQ ID NO: 2 in the sequence listing, the sequence of the first reverse primer is shown in SEQ ID NO: 3 in the sequence listing, the sequence of the second forward primer is shown in SEQ ID NO: 4 in the sequence listing, and the sequence of the second reverse primer is shown in SEQ ID NO: 5 in the sequence listing;

[0011] The OsAFB3 gene knockout vector was transformed into a recipient material, Nipponbare, to obtain an OsAFB3 gene homozygous knockout mutant.

[0012] Furthermore, the application includes: using the pYLsgRNA-OsU6a plasmid as a template, performing a first round of PCR amplification using the first forward primer and the first reverse primer to obtain a first amplification product containing the U6b promoter of the OsAFB3-T, and performing a second round of PCR amplification using the second forward primer and the second reverse primer to obtain a second amplification product containing the sgRNA fragment of the OsAFB3-T;

[0013] Purifying and recovering the first amplification product and the second amplification product to obtain purified first amplification product and purified second amplification product;

[0014] Using overlap extension PCR technology to connect the purified first amplification product and the purified second amplification product to obtain a connection product;

[0015] The ligation product was connected to the pYLCRISPR / Cas9Pubi-H vector to obtain the OsAFB3 gene knockout vector.

[0016] Furthermore, the reaction system for the first round of PCR amplification per 50 μL includes: 4 μL of the first forward primer at a concentration of 10 μM; 4 μL of the first reverse primer at a concentration of 10 μM; 5 μL of 10×Pfu Buffer; 4 μL of 2 mM dNTP; 1 μL of template DNA; 0.25 μL of Pfu DNA high-fidelity polymerase at a concentration of 5 U / μL; and 31.75 μL of ddH2O.

[0017] Furthermore, per 50 μL of the second PCR amplification reaction system includes: 5 μL of 10×Pfu Buffer; 4 μL of 2 mM dNTP; 4 μL of the second forward primer at a concentration of 10 μM; 4 μL of the second reverse primer at a concentration of 10 μM; 1 μL of template DNA; 0.25 μL of Pfu DNA high-fidelity polymerase at a concentration of 5 U / μL; and 31.75 μL of ddH2O.

[0018] Furthermore, the reaction system of the recombination amplification per 50 μL includes: 5 μL of 10×Pfu Buffer; 4 μL of 2 mM dNTP; 4 μL of the first forward primer with a concentration of 10 μM; 4 μL of the second reverse primer with a concentration of 10 μM; 50 ng of the U6a promoter; 50 ng of the guide fragment sgRNA; 0.25 μL of Pfu DNA high-fidelity polymerase with a concentration of 5 U / μL; and ddH2O is supplemented to a total volume of 50 μL.

[0019] Furthermore, each 15 μL of the ligation reaction system includes: 1.5 μL of 10×CutSmart Buffer; 1.5 μL of 10 mM ATP mixture; 0.5 μL of 100 ng / μL pYLCRISPR / Cas9Pubi-H vector; 1 μL of 100 ng / μL sgRNA expression cassette fragment; 0.5 μL of 20 U / μL BsaI-HF endonuclease; 0.2 μL of 400 U / μL T4 DNA ligase; and 9.8 μL of ddH2O.

[0020] Furthermore, the receptor material is Nipponbare.

[0021] The beneficial effects of the technical solution provided by the embodiments of the present disclosure are as follows: the embodiments of the present invention provide an application of a rice endosperm protein content gene, which uses a method for editing the OsAFB3 gene using the CRISPR / Cas9 system to knock out the OsAFB3 gene to regulate the rice endosperm protein content, and the effect is significant. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the technical solutions in the embodiments of the present disclosure, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present disclosure. For ordinary technicians in this field, other drawings can be obtained based on these drawings without any creative work.

[0023] Figure 1Statistical graphs of total protein content in the endosperm of the control group Nip and the OsAFB3-KO-5 and OsAFB3-KO-6 groups provided in the examples of the present disclosure. Asterisks on the error bars indicate significant differences compared with the control group (p values ​​calculated by one-way ANOVA, *p<0.05, **p<0.01).

[0024] Figure 2 Statistical graphs of albumin content in endosperm of the control group Nip and the OsAFB3-KO-5 and OsAFB3-KO-6 groups provided in the examples of the present disclosure are shown. Asterisks on the error bars indicate significant differences compared with the control group (p value calculated by one-way ANOVA, **p<0.01).

[0025] Figure 3 Statistical graphs of globulin content in endosperm of the control group Nip and the OsAFB3-KO-5 and OsAFB3-KO-6 groups provided in the examples of the present disclosure. Asterisks on the error bars indicate significant differences compared with the control group (p value calculated by one-way ANOVA, **p<0.01).

[0026] Figure 4 Statistical graphs of the alcohol-soluble protein content in the endosperm of the control group Nip and the OsAFB3-KO-5 and OsAFB3-KO-6 groups provided in the examples of the present disclosure. Asterisks on the error bars indicate significant differences compared with the control group (p value calculated by one-way ANOVA, **p<0.01).

[0027] Figure 5 Statistical graphs of gluten content in the endosperm of the control group Nip and the OsAFB3-KO-5 and OsAFB3-KO-6 groups provided in the examples of the present disclosure. Asterisks on the error bars indicate significant differences compared with the control group (p value calculated by one-way ANOVA, **p<0.01). DETAILED DESCRIPTION

[0028] In order to make the objectives, technical solutions and advantages of the present disclosure more clear, the embodiments of the present disclosure will be further described in detail below with reference to the accompanying drawings.

[0029] The present disclosure provides an application of a rice endosperm protein gene, which includes: using the OsAFB3 gene to regulate the content of rice endosperm protein.

[0030] Specifically, the application includes: modifying the amino acid sequence of the OsAFB3 (LOC_Os11g31620) gene to increase the total protein content and gluten content, and reduce the globulin content, alcohol-soluble protein content and albumin content.

[0031] In this example, the sequence of the OsAFB3 gene can be obtained from the Rice Genome Annotation Project (uga.edu) website, and the coding sequence is shown as SEQ ID NO: 6 in the sequence listing.

[0032] Specifically, the application includes: designing a target site sequence (OsAFB3-T) for knocking out the OsAFB3 gene through the CRISPR-P website of Huazhong Agricultural University (http: / / crispr.hzau.edu.cn / CRISPR2 / ). The sequence of the target site OsAFB3-T is shown in SEQ ID NO: 1 in the sequence listing, and the specific sequence is: GTCCAGGTCGTCGTCGGTGACGG.

[0033] The OsAFB3 gene knockout vector was constructed based on OsAFB3-T;

[0034] The OsAFB3 gene knockout vector is transformed into a recipient material to obtain an OsAFB3 gene homozygous knockout mutant, that is, a mutant with loss of OsAFB3 gene function.

[0035] Furthermore, the application includes: using the pYLsgRNA-OsU6a plasmid as a template, using a first forward primer and a first reverse primer to perform a first round of PCR amplification to obtain a first amplified product of the U6b promoter containing OsAFB3-T, and using a second forward primer and a second reverse primer to perform a second round of PCR amplification to obtain a second amplified product of the sgRNA fragment containing OsAFB3-T, the sequence of the first forward primer (UF) is shown in SEQ ID NO: 2 in the sequence listing, specifically: CTCCGTTTTACCTGTGGAATCG, the first reverse primer (OsAFB3-U6aT) is shown in SEQ ID NO: 3 in the sequence listing, specifically: GCTGAAGCGGATGGTTGTCACGGCAGCCAAGCCAGCA, the sequence of the second forward primer (OsAFB3-gT) is shown in SEQ ID NO: 4 in the sequence listing, specifically: TGACAACCATCCGCTTCA GCGTTTTAGAGCTAGAAAT, and the second reverse primer (gR-R) is shown in SEQ ID NO: 5 in the sequence listing. NO: 5, specifically: CGGAGGAAAATTCCATCCAC.

[0036] Purifying and recovering the first amplification product and the second amplification product to obtain a purified first amplification product and a purified second amplification product;

[0037] Using overlap extension PCR technology to connect the purified first amplification product and the purified second amplification product to obtain a connection product;

[0038] The ligation product was connected to the pYLCRISPR / Cas9Pubi-H vector to obtain the OsAFB3 gene knockout vector.

[0039] Furthermore, the reaction system for the first round of PCR amplification per 50 μL includes: 4 μL of the first forward primer with a concentration of 10 μM; 4 μL of the first reverse primer with a concentration of 10 μM; 5 μL of 10×PfuBuffer; 4 μL of 2 mM dNTP; 1 μL of template DNA; 0.25 μL of Pfu DNA high-fidelity polymerase with a concentration of 5 U / μL; and 31.75 μL of ddH2O.

[0040] Furthermore, the first round of PCR amplification reaction procedure was: pre-denaturation at 98°C for 2 min; 32 cycles of reaction, each cycle including the following steps: denaturation at 98°C for 15 s, annealing at 57°C for 20 s, extension at 72°C for 30 s; and final extension at 72°C for 10 min.

[0041] Furthermore, the reaction system for the second PCR amplification per 50 μL includes: 5 μL of 10×Pfu Buffer; 4 μL of 2 mM dNTPs; 4 μL of a second forward primer with a concentration of 10 μM; 4 μL of a second reverse primer with a concentration of 10 μM; 1 μL of template DNA; 0.25 μL of Pfu DNA high-fidelity polymerase with a concentration of 5 U / μL; and 31.75 μL of ddH2O.

[0042] Furthermore, the second round of PCR amplification reaction procedure was: pre-denaturation at 98°C for 2 min; 32 cycles of reaction, each cycle including the following steps: denaturation at 98°C for 15 s, annealing at 57°C for 20 s, extension at 72°C for 30 s; and final extension at 72°C for 10 min.

[0043] Furthermore, the reaction system for each 50 μL of recombination amplification includes: 5 μL of 10×Pfu Buffer; 4 μL of 2 mM dNTP; 4 μL of the first forward primer with a concentration of 10 μM; 4 μL of the second reverse primer with a concentration of 10 μM; 50 ng of U6a promoter; 50 ng of the guide fragment sgRNA; 0.25 μL of Pfu DNA high-fidelity polymerase with a concentration of 5 U / μL; and ddH2O is supplemented to a total volume of 50 μL.

[0044] Furthermore, the overlapping PCR reaction program was as follows: pre-denaturation at 98°C for 4 min; 30 cycles of reaction, each cycle comprising the following steps: denaturation at 98°C for 20 s, annealing at 55°C for 20 s, extension at 72°C for 40 s; and final extension at 72°C for 10 min.

[0045] After the overlap extension PCR reaction, the amplified product was recovered using a 1% mass-to-volume agarose gel. The target product (sgRNA expression cassette) was approximately 700 bp in size. The sgRNA expression cassette was ligated to the pYLCRISPR / Cas9Pubi-H vector, which was prepared and donated by the team of Academician Liu Yaoguang, using the Golden Gate ligation method.

[0046] Furthermore, the reaction system for each 15 μL ligation includes: 10× CutSmart Buffer 1.5 μL; 10 mM ATP mixture 1.5 μL; 100 ng / μL pYLCRISPR / Cas9Pubi-H vector 0.5 μL; 100 ng / μL sgRNA expression cassette fragment 1 μL; 20 U / μL BsaI-HF endonuclease 0.5 μL; 400 U / μL T4 DNA ligase 0.2 μL; ddH2O 9.8 μL.

[0047] Furthermore, the ligation reaction procedure is as follows: 15 cycles of reaction, each cycle comprising: 37°C for 5 minutes, 10°C for 5 minutes, 20°C for 5 minutes, and 37°C for 5 minutes. After the ligation reaction is completed, the knockout vector of the gene OsAFB3 is obtained.

[0048] The OsAFB3 gene knockout vector was transformed into Agrobacterium competent cells EHa105 (purchased from Shanghai Weidi Biotechnology Co., Ltd.) by electroporation. The specific method is as follows:

[0049] 1. Thaw EHa105 competent cells (100 μL) frozen at -80°C in an ice bath;

[0050] 2. Add 1 μg of OsAFB3 gene knockout vector to the competent cell suspension and mix gently;

[0051] 3. Place EHa105 Agrobacterium competent cells on ice for 5 minutes, in liquid nitrogen for 5 minutes, heat shock at 37°C for 5 minutes, and then on ice for 5 minutes.

[0052] 4. Add 700 μL of antibiotic-free LB liquid medium to EHa105 Agrobacterium competent cells and shake at 28°C and 150 rpm for 2 h.

[0053] 5. Centrifuge at 6000 rpm for 1 min, discard the supernatant, resuspend the pellet in 100 μL of antibiotic-free LB liquid medium, spread the resuspension onto LB solid medium supplemented with 50 μg / mL kanamycin and 10 μg / mL rifampicin, and incubate inverted at 28°C in the dark for 72 h.

[0054] 6. After picking a single clone, perform colony PCR with primers UF and gR-R to detect the positive clone, and streak it onto new LB solid medium for expansion culture.

[0055] The OsAFB3 gene knockout vector was transformed into the recipient material Nipponbare rice by Agrobacterium-mediated method. The specific method is as follows:

[0056] 1. Inducing callus

[0057] A rice huller was used to remove the husks of mature Nipponbare seeds. Seeds with full grains were manually selected and retained. 16 g of full-grained seeds were collected and placed in a 50 mL centrifuge tube. The seeds were washed with tap water and then distilled water several times, followed by immersion and shaking in a shaker for 5 minutes in 70% ethanol. The seeds were then rinsed three times with sterile water and disinfected by shaking in 1% sodium hypochlorite solution at 100 rpm for 15–20 minutes. After disinfection, the seeds were rinsed four times with sterile water in a clean hood, transferred to sterile filter paper, and dried for 1.5 hours. The seeds were then inoculated individually onto N6 solid induction medium and cultured in the dark at 28°C for 28 days.

[0058] 2. Subculture

[0059] Select light yellow dense callus tissue, transfer it to fresh N6 solid induction medium, and culture it in the dark at 28°C for about 10 days.

[0060] 3. Agrobacterium-mediated transformation

[0061] Agrobacterium EHa105 transformed with the RSM gene knockout vector was screened on YEB solid medium containing rifampicin and kanamycin.

[0062] Add 10 mL of 1 / 2N6 liquid culture medium (containing 1 / 1000 volume of AS) to a 50 mL centrifuge tube, transfer the Agrobacterium cells transformed with the target vector into the liquid culture medium, shake to mix, and adjust the bacterial solution concentration to OD600 = 0.8.

[0063] Transfer the subcultured fresh callus to the Agrobacterium culture medium and mix evenly for 15 minutes. Pour off the culture medium and transfer the callus to a fresh sterilized filter paper. Place the filter paper on a clean bench to dry for two hours. Then, transfer the callus to 1 / 2N6 solid medium (containing 1 / 1000 volume of AS) and incubate in the dark at 20°C in a constant temperature incubator for approximately two days.

[0064] 4. Sterilization

[0065] The infected callus tissue was transferred to a sterilized 250 mL conical flask, 150 mL of sterile water was added, and the solution was shaken and washed and the sterile water was replaced several times until the liquid was clear.

[0066] The washed callus tissue was transferred to N6 liquid medium containing 500 mg / L cephalosporin and placed on a shaker with low speed shaking for 15-20 minutes to wash three times. The callus tissue was then transferred to sterile filter paper and placed on a clean bench to dry thoroughly.

[0067] 5. Resistance screening

[0068] The dried callus tissue was transferred to N6 solid culture medium containing 250 mg / L cephalosporin and 50 mg / L hygromycin, and cultured in a 28° C. constant temperature incubator in the dark for one month.

[0069] 6. Differentiation

[0070] The screened active callus was transferred to MS medium, cultured in a 28°C constant temperature incubator in the dark for 10 days and then cultured in the light for 20 days.

[0071] 7. Rooting and transplanting

[0072] The differentiated green seedlings were transferred to 1 / 2MS culture medium and placed in a constant temperature incubator at 28°C for two weeks under light. The seedlings in the 1 / 2MS culture medium were taken out and the roots were washed with tap water to avoid culture medium residue. Subsequently, the seedlings were cultured in a centrifuge tube filled with sterile water. The sterile water was replaced in time. After 1 week of culture, the seedlings were transplanted into the field. After the seedlings matured, two generations of self-pollination were performed to obtain T2 generation seeds.

[0073] The phenotype of the homozygous knockout mutants of the OsAFB3 gene was observed. Specifically, in this example, two homozygous knockout mutants of the OsAFB3 gene, namely OsAFB3-KO-5 and OsAFB3-KO-6, were selected as experimental groups. At the same time, the receptor material Nipponbare was used as the control group Nip.

[0074] Seeds from the control, OsAFB3-KO-5, and OsAFB3-KO-6 groups were sown and raised as normal. When the seedlings reached four weeks of age, they were transplanted into the field with a plant spacing of 16.7 cm and a row spacing of 26.7 cm. Sixty plants of each seedling were planted and maintained as normal. After seed maturity, samples were collected and the husks were removed using a brown rice mill. The seeds were then ground into polished rice flour using a grinder for determination of endosperm protein content.

[0075] The total protein content in the endosperm was determined using a BCA protein assay kit (purchased from Shanghai Qiyi Biotechnology Co., Ltd., QYS-237013). Figure 1 As shown. Figure 1It can be seen that the total protein content in the endosperm of the control group Nip was significantly lower than that in the endosperm of the OsAFB3-KO-5 group and the OsAFB3-KO-6 group. 0.1g of refined rice flour was added to a 1.5mL centrifuge tube, and 1mL of distilled water was poured into it and placed on a shaker for 2h. After centrifugation at 10000rpm for 10min, the supernatant was collected into a 10mL centrifuge tube. The supernatants of the three repeated experiments were combined into a centrifuge tube, and 1mL of 0.1% Coomassie Brilliant Blue-G250 colorimetric solution was added to the centrifuge tube to a total volume of 10mL. The absorbance of the extract at a wavelength of 595nm was measured using a UV-754 spectrophotometer. A working curve was prepared using a bovine serum albumin standard solution, and the albumin content was calculated based on the working curve. The results are as follows: Figure 2 As shown. Figure 2 It can be seen that the albumin content in the endosperm of the control group Nip was significantly higher than that in the endosperm of the OsAFB3-KO-5 and OsAFB3-KO-6 groups. Globulin was extracted by adding 1 mL of 5% NaCl solution to the albumin-extracted polished rice flour precipitate. The extraction and determination process were carried out according to the albumin content measurement method. The results are shown in Figure 2. Figure 3 As shown. Figure 3 It can be seen that the globulin content in the endosperm of the control group Nip was significantly higher than that in the endosperm of the OsAFB3-KO-5 and OsAFB3-KO-6 groups. The alcohol-soluble proteins were extracted by adding 1 mL of 70% ethanol solution to the refined rice flour precipitate from which the globulin had been extracted. The extraction and determination process were carried out according to the albumin content measurement method. The results are shown in Figure 2. Figure 4 As shown. Figure 4 It can be seen that the alcohol-soluble protein content in the endosperm of the control group Nip was significantly higher than that in the endosperm of the OsAFB3-KO-5 group and the OsAFB3-KO-6 group. 1 mL of 0.2% NaOH solution was added to the refined rice flour precipitate from which alcohol-soluble protein had been extracted, and the mixture was placed on a shaker for 2 hours and centrifuged at 12,000 rpm for 10 minutes. The supernatant was collected into a 50 mL volumetric flask, and the mixture was repeated 3 times to combine the extracts and dilute to 50 mL. 3 mL of the dilute solution was transferred to a 10 mL centrifuge tube, and 1 mL of 0.1% Coomassie Brilliant Blue-G250 colorimetric solution was added and diluted to 10 mL. The absorbance of the extract at a wavelength of 595 nm was then measured using a UV-754 spectrophotometer. The gluten content was calculated according to the working curve, and the results are as follows: Figure 5 As shown. Figure 5 It can be seen that the gluten content in the endosperm of the control group Nip was significantly lower than that in the endosperm of the OsAFB3-KO-5 group and the OsAFB3-KO-6 group.

[0076] The above description is merely an optional embodiment of the present disclosure and is not intended to limit the present disclosure. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present disclosure shall be included in the scope of protection of the present disclosure.

Claims

1. An application of a rice endosperm protein gene, characterized in that: The application includes: using the OsAFB3 gene to regulate the content of rice endosperm protein.

2. The use according to claim 1, characterized in that The application includes: modifying the amino acid sequence of the OsAFB3 gene to increase the total protein content and gluten content, and reduce the globulin content, alcohol-soluble protein content and albumin content.

3. The use according to claim 1, characterized in that The applications include: OsAFB3-T is selected as a target site for gene knockout in the sequence of the OsAFB3 gene, and the sequence of the OsAFB3-T is shown in SEQ ID NO: 1 in the sequence listing; An OsAFB3 gene knockout vector was constructed based on the OsAFB3-T using a first forward primer, a first reverse primer, a second forward primer, and a second reverse primer, wherein the sequence of the first forward primer is shown in SEQ ID NO: 2 in the sequence listing, the sequence of the first reverse primer is shown in SEQ ID NO: 3 in the sequence listing, the sequence of the second forward primer is shown in SEQ ID NO: 4 in the sequence listing, and the sequence of the second reverse primer is shown in SEQ ID NO: 5 in the sequence listing; The OsAFB3 gene knockout vector is transformed into a recipient material to obtain an OsAFB3 gene homozygous knockout mutant.

4. The use according to claim 3, characterized in that The application includes: using the pYLsgRNA-OsU6a plasmid as a template, performing a first round of PCR amplification using the first forward primer and the first reverse primer to obtain a first amplification product containing the U6b promoter of the OsAFB3-T, and performing a second round of PCR amplification using the second forward primer and the second reverse primer to obtain a second amplification product containing the sgRNA fragment of the OsAFB3-T; Purifying and recovering the first amplification product and the second amplification product to obtain purified first amplification product and purified second amplification product; Using overlap extension PCR technology to connect the purified first amplification product and the purified second amplification product to obtain a connection product; The ligation product was connected to the pYLCRISPR / Cas9Pubi-H vector to obtain the OsAFB3 gene knockout vector.

5. The use according to claim 4, characterized in that The reaction system for the first round of PCR amplification per 50 μL includes: 4 μL of the first forward primer at a concentration of 10 μM; 4 μL of the first reverse primer at a concentration of 10 μM; 5 μL of 10× Pfu Buffer; 4 μL of 2 mM dNTPs; 1 μL of template DNA; 0.25 μL of Pfu DNA high-fidelity polymerase at a concentration of 5 U / μL; and 31.75 μL of ddH2O.

6. The use according to claim 4, characterized in that The reaction system for the second PCR amplification per 50 μL includes: 5 μL of 10×Pfu Buffer; 4 μL of 2 mM dNTP; 4 μL of the second forward primer at a concentration of 10 μM; 4 μL of the second reverse primer at a concentration of 10 μM; 1 μL of template DNA; 0.25 μL of Pfu DNA high-fidelity polymerase at a concentration of 5 U / μL; and 1.75 μL of ddH2O3.

7. The use according to claim 4, characterized in that The reaction system for the recombination amplification per 50 μL includes: 5 μL of 10×Pfu Buffer; 4 μL of 2 mM dNTP; 4 μL of the first forward primer at a concentration of 10 μM; 4 μL of the second reverse primer at a concentration of 10 μM; 50 ng of the U6a promoter; 50 ng of the guide fragment sgRNA; 0.25 μL of Pfu DNA high-fidelity polymerase at a concentration of 5 U / μL; and ddH2O is supplemented to a total volume of 50 μL.

8. The use according to claim 4, characterized in that Each 15 μL of the ligation reaction system includes: 1.5 μL of 10× CutSmart Buffer; 1.5 μL of 10 mM ATP mixture; 0.5 μL of 100 ng / μL pYLCRISPR / Cas9Pubi-H vector; 1 μL of 100 ng / μL sgRNA expression cassette fragment; 0.5 μL of 20 U / μL BsaI-HF endonuclease; 0.2 μL of 400 U / μL T4 DNA ligase; and 9.8 μL of ddH2O.

9. The use according to claim 4, characterized in that The receptor material is Nipponbare.