Application of rice endosperm starch content gene

Abstract

The invention provides application of a rice endosperm starch content gene, and belongs to the technical field of biology. According to the application, the OsAFB3 gene is used for regulating and controlling the content of rice endosperm starch. According to the application of the rice endosperm starch content gene provided by the embodiment of the invention, the OsAFB3 gene is used for regulating and controlling the content of rice endosperm starch, and the effect is remarkable.

Description

Technical Field

[0001] The present disclosure relates to the field of biotechnology, and in particular to an application of a rice endosperm starch content gene. Background Art

[0002] As the staple food of over half the world's population, rice production safety and quality improvement are crucial to human survival and development. Traditional rice breeding techniques, through the utilization of dwarfing genes and the development of hybrid vigor, have successfully achieved significant yield increases, effectively alleviating the food crisis brought on by population growth. However, as consumer demand shifts from "high yield and guaranteed supply" to "high-quality nutrition," improving rice quality has become a core goal of modern rice breeding. Cultivating new rice varieties with both high yield potential and excellent quality has become a strategic direction for ensuring food security and meeting the dual demands of consumer spending.

[0003] Rice quality traits include appearance, processing, cooking, flavor, and nutritional quality. Their formation is closely related to the synthesis and accumulation of starch in the endosperm. Studies have shown that starch accounts for over 80% of the dry weight of the endosperm. The ratio of amylose to amylopectin, its crystal structure, and molecular weight distribution directly determine key quality indicators such as rice transparency, viscoelasticity, and gelatinization properties. For example, excessive amylose content can lead to increased rice hardness and decreased flavor quality, while the structure of amylopectin affects the softness of the rice.

[0004] Currently, the discovery of key genes involved in starch synthesis and regulation is lagging behind. The number of cloned quality-related genes is limited, and most of them are concentrated in genes encoding starch synthases. Upstream signaling factors that regulate starch granule assembly, endosperm cell development, and metabolic flux distribution remain to be explored. Therefore, systematically identifying new key genes that regulate endosperm starch synthesis has become an urgent issue.

[0005] Public content

[0006] To solve the problems of the prior art, the present disclosure provides an application of a rice endosperm starch content gene. The technical solution is as follows:

[0007] The present disclosure provides an application of a rice endosperm starch gene, which includes: using the OsAFB3 gene to regulate the content of rice endosperm starch.

[0008] Specifically, the application includes: modifying the amino acid sequence of the OsAFB3 gene to reduce the amylose content and increase the amylopectin content of rice, while keeping the total starch content of the rice unchanged.

[0009] Specifically, the application includes: selecting OsAFB3-T in the sequence of the OsAFB3 gene as a target for gene knockout, wherein the sequence of the OsAFB3-T is shown in SEQ ID NO: 1 in the sequence listing;

[0010] An OsAFB3 gene knockout vector was constructed based on the OsAFB3-T using a first forward primer, a first reverse primer, a second forward primer, and a second reverse primer, wherein the sequence of the first forward primer is shown in SEQ ID NO: 2 in the sequence listing, the sequence of the first reverse primer is shown in SEQ ID NO: 3 in the sequence listing, the sequence of the second forward primer is shown in SEQ ID NO: 4 in the sequence listing, and the sequence of the second reverse primer is shown in SEQ ID NO: 5 in the sequence listing;

[0011] The OsAFB3 gene knockout vector was transformed into a recipient material, Nipponbare, to obtain an OsAFB3 gene homozygous knockout mutant.

[0012] Furthermore, the application includes: using the pYLsgRNA-OsU6a plasmid as a template, performing a first round of PCR amplification using the first forward primer and the first reverse primer to obtain a first amplification product containing the U6b promoter of the OsAFB3-T, and performing a second round of PCR amplification using the second forward primer and the second reverse primer to obtain a second amplification product containing the sgRNA fragment of the OsAFB3-T;

[0013] Purifying and recovering the first amplification product and the second amplification product to obtain purified first amplification product and purified second amplification product;

[0014] Using overlap extension PCR technology to connect the purified first amplification product and the purified second amplification product to obtain a connection product;

[0015] The ligation product was connected to the pYLCRISPR / Cas9Pubi-H vector to obtain the OsAFB3 gene knockout vector.

[0016] Furthermore, the reaction system for the first round of PCR amplification per 50 μL includes: 4 μL of the first forward primer at a concentration of 10 μM; 4 μL of the first reverse primer at a concentration of 10 μM; 5 μL of 10×Pfu Buffer; 4 μL of 2 mM dNTP; 1 μL of template DNA; 0.25 μL of Pfu DNA high-fidelity polymerase at a concentration of 5 U / μL; and 31.75 μL of ddH2O.

[0017] Furthermore, per 50 μL of the second PCR amplification reaction system includes: 5 μL of 10×Pfu Buffer; 4 μL of 2 mM dNTP; 4 μL of the second forward primer at a concentration of 10 μM; 4 μL of the second reverse primer at a concentration of 10 μM; 1 μL of template DNA; 0.25 μL of Pfu DNA high-fidelity polymerase at a concentration of 5 U / μL; and 31.75 μL of ddH2O.

[0018] Furthermore, the reaction system of the recombination amplification per 50 μL includes: 5 μL of 10×Pfu Buffer; 4 μL of 2 mM dNTP; 4 μL of the first forward primer with a concentration of 10 μM; 4 μL of the second reverse primer with a concentration of 10 μM; 50 ng of the U6a promoter; 50 ng of the guide fragment sgRNA; 0.25 μL of Pfu DNA high-fidelity polymerase with a concentration of 5 U / μL; and ddH2O is supplemented to a total volume of 50 μL.

[0019] Furthermore, each 15 μL of the ligation reaction system includes: 1.5 μL of 10×CutSmartBuffer; 1.5 μL of 10 mM ATP mixture; 0.5 μL of 100 ng / μL pYLCRISPR / Cas9Pubi-H vector; 1 μL of 100 ng / μL sgRNA expression cassette fragment; 0.5 μL of 20 U / μL BsaI-HF endonuclease; 0.2 μL of 400 U / μL T4 DNA ligase; and 9.8 μL of ddH2O.

[0020] Furthermore, the receptor material is Nipponbare.

[0021] The technical solution provided by the embodiments of the present disclosure has the following beneficial effects: the embodiments of the present invention provide an application of a rice endosperm starch content gene, which utilizes a method for editing the OsAFB3 gene using the CRISPR / Cas9 system to knock out the OsAFB3 gene for regulating the rice endosperm starch content, with significant results. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the technical solutions in the embodiments of the present disclosure, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present disclosure. For ordinary technicians in this field, other drawings can be obtained based on these drawings without any creative work.

[0023] Figure 1 Statistical graphs of total starch content in the endosperm of the control group Nip and the OsAFB3-KO-5 and OsAFB3-KO-6 groups provided in the examples of the present disclosure.

[0024] Figure 2 Statistical graphs of amylose content in the endosperm of the control group Nip and the OsAFB3-KO-5 and OsAFB3-KO-6 groups provided in the examples of the present disclosure. Asterisks on the error bars indicate significant differences compared with the control group (p values ​​calculated by one-way ANOVA, *p<0.05, **p<0.01).

[0025] Figure 3 Statistical graphs of amylopectin content in the endosperm of the control group Nip and the OsAFB3-KO-5 and OsAFB3-KO-6 groups provided in the examples of the present disclosure. Asterisks on the error bars indicate significant differences compared with the control group (p values ​​calculated by one-way ANOVA, *p<0.05, **p<0.01). DETAILED DESCRIPTION

[0026] In order to make the objectives, technical solutions and advantages of the present disclosure more clear, the embodiments of the present disclosure will be further described in detail below with reference to the accompanying drawings.

[0027] Example 1

[0028] The present disclosure provides an application of a rice endosperm starch gene, which includes: using the OsAFB3 gene to regulate the content of rice endosperm starch.

[0029] Specifically, the application includes: modifying the amino acid sequence of the OsAFB3 (LOC_Os11g31620) gene to reduce the amylose content of rice, increase the amylopectin content, and maintain the total starch content of rice unchanged.

[0030] In this example, the sequence of the OsAFB3 gene can be obtained from the Rice Genome Annotation Project (uga.edu) website, and the coding sequence is shown as SEQ ID NO: 6 in the sequence listing.

[0031] Specifically, the application includes: designing a target site sequence (OsAFB3-T) for knocking out the OsAFB3 gene through the CRISPR-P website of Huazhong Agricultural University (http: / / crispr.hzau.edu.cn / CRISPR2 / ). The sequence of the target site OsAFB3-T is shown in SEQ ID NO: 1 in the sequence listing, and the specific sequence is: GTCCAGGTCGTCGTCGGTGACGG.

[0032] The OsAFB3 gene knockout vector was constructed based on OsAFB3-T;

[0033] The OsAFB3 gene knockout vector is transformed into a recipient material to obtain an OsAFB3 gene homozygous knockout mutant, that is, a mutant with loss of OsAFB3 gene function.

[0034] Furthermore, the application includes: using the pYLsgRNA-OsU6a plasmid as a template, using a first forward primer and a first reverse primer to perform a first round of PCR amplification to obtain a first amplified product of the U6b promoter containing OsAFB3-T, and using a second forward primer and a second reverse primer to perform a second round of PCR amplification to obtain a second amplified product of the sgRNA fragment containing OsAFB3-T, the sequence of the first forward primer (UF) is shown in SEQ ID NO: 2 in the sequence list, specifically: CTCCGTTTTACCTGTGGAATCG, the first reverse primer (OsAFB3-U6aT) is shown in SEQ ID NO: 3 in the sequence list, specifically: GCTGAA GCGGATGGTTGTCACGGCAGCCAAGCCAGCA, the sequence of the second forward primer (OsAFB3-gT) is shown in SEQ ID NO: 4 in the sequence list, specifically: TGACAACCATCCGCTTCA GCGTTTTAGAGCTAGAAAT, and the second reverse primer (gR-R) is shown in SEQ ID NO: 5 in the sequence list. NO: 5, specifically: CGGAGGAAAATTCCATCCAC.

[0035] Purifying and recovering the first amplification product and the second amplification product to obtain a purified first amplification product and a purified second amplification product;

[0036] Using overlap extension PCR technology to connect the purified first amplification product and the purified second amplification product to obtain a connection product;

[0037] The ligation product was connected to the pYLCRISPR / Cas9Pubi-H vector to obtain the OsAFB3 gene knockout vector.

[0038] Furthermore, the reaction system for the first round of PCR amplification per 50 μL includes: 4 μL of the first forward primer with a concentration of 10 μM; 4 μL of the first reverse primer with a concentration of 10 μM; 5 μL of 10×PfuBuffer; 4 μL of 2 mM dNTP; 1 μL of template DNA; 0.25 μL of Pfu DNA high-fidelity polymerase with a concentration of 5 U / μL; and 31.75 μL of ddH2O.

[0039] Furthermore, the first round of PCR amplification reaction procedure was: pre-denaturation at 98°C for 2 min; 32 cycles of reaction, each cycle including the following steps: denaturation at 98°C for 15 s, annealing at 57°C for 20 s, extension at 72°C for 30 s; and final extension at 72°C for 10 min.

[0040] Furthermore, the reaction system for the second PCR amplification per 50 μL includes: 5 μL of 10×Pfu Buffer; 4 μL of 2 mM dNTPs; 4 μL of a second forward primer with a concentration of 10 μM; 4 μL of a second reverse primer with a concentration of 10 μM; 1 μL of template DNA; 0.25 μL of Pfu DNA high-fidelity polymerase with a concentration of 5 U / μL; and 31.75 μL of ddH2O.

[0041] Furthermore, the second round of PCR amplification reaction procedure was: pre-denaturation at 98°C for 2 min; 32 cycles of reaction, each cycle including the following steps: denaturation at 98°C for 15 s, annealing at 57°C for 20 s, extension at 72°C for 30 s; and final extension at 72°C for 10 min.

[0042] Furthermore, the reaction system for each 50 μL of recombination amplification includes: 5 μL of 10×Pfu Buffer; 4 μL of 2 mM dNTP; 4 μL of the first forward primer with a concentration of 10 μM; 4 μL of the second reverse primer with a concentration of 10 μM; 50 ng of U6a promoter; 50 ng of the guide fragment sgRNA; 0.25 μL of Pfu DNA high-fidelity polymerase with a concentration of 5 U / μL; and ddH2O is supplemented to a total volume of 50 μL.

[0043] Furthermore, the overlapping PCR reaction program was as follows: pre-denaturation at 98°C for 4 min; 30 cycles of reaction, each cycle comprising the following steps: denaturation at 98°C for 20 s, annealing at 55°C for 20 s, extension at 72°C for 40 s; and final extension at 72°C for 10 min.

[0044] After the overlap extension PCR reaction, the amplified product was recovered using a 1% mass-to-volume agarose gel. The target product (sgRNA expression cassette) was approximately 700 bp in size. The sgRNA expression cassette was ligated to the pYLCRISPR / Cas9Pubi-H vector, which was prepared and donated by the team of Academician Liu Yaoguang, using the Golden Gate ligation method.

[0045] Furthermore, the reaction system for each 15 μL ligation includes: 10× CutSmart Buffer 1.5 μL; 10 mM ATP mixture 1.5 μL; 100 ng / μL pYLCRISPR / Cas9Pubi-H vector 0.5 μL; 100 ng / μL sgRNA expression cassette fragment 1 μL; 20 U / μL BsaI-HF endonuclease 0.5 μL; 400 U / μL T4 DNA ligase 0.2 μL; ddH2O 9.8 μL.

[0046] Furthermore, the ligation reaction procedure is as follows: 15 cycles of reaction, each cycle comprising: 37°C for 5 minutes, 10°C for 5 minutes, 20°C for 5 minutes, and 37°C for 5 minutes. After the ligation reaction is completed, the knockout vector of the gene OsAFB3 is obtained.

[0047] The OsAFB3 gene knockout vector was transformed into Agrobacterium competent cells EHa105 (purchased from Shanghai Weidi Biotechnology Co., Ltd.) by electroporation. The specific method is as follows:

[0048] 1. Take out a tube of EHa105 Agrobacterium competent cells (100 μL) from the -80°C ultra-low temperature freezer and place it on ice to slowly thaw;

[0049] 2. Add 1 μg of OsAFB3 gene knockout vector to the completely thawed EHa105 Agrobacterium competent cells and gently tap the bottom of the tube to mix.

[0050] 3. Place EHa105 Agrobacterium competent cells in an ice bath for 5 minutes, liquid nitrogen for 5 minutes, a 37°C water bath for 5 minutes, and an ice bath for 5 minutes in sequence;

[0051] 4. Add 700 μL of antibiotic-free liquid LB medium to EHa105 Agrobacterium competent cells and shake at 150 rpm in a 28°C constant temperature incubator for about 2 hours;

[0052] 5. Centrifuge at 6000 rpm for 1 min, discard the supernatant, collect the precipitated cells, add 100 μL of antibiotic-free LB liquid medium to resuspend the cells, spread the resuspension onto LB solid medium supplemented with 50 μg / mL kanamycin and 10 μg / mL rifampicin, and culture in an inverted manner at 28°C in the dark for 3 days;

[0053] 6. After picking a single clone, perform colony PCR with primers UF and gR-R to detect the positive clone, and streak it onto new LB solid medium for expansion culture.

[0054] The OsAFB3 gene knockout vector was transformed into the recipient material Nipponbare rice by Agrobacterium-mediated method. The specific method is as follows:

[0055] 1. Inducing callus

[0056] Mature seeds of Nipponbare were dehulled using a brown rice mill. Glumes of full-grained seeds (16 g) were manually selected and placed in a 50 mL centrifuge tube. The seeds were washed sequentially with tap water and then distilled water, shaken in 70% ethanol, and shaken on a shaker for 5 minutes. The seeds were rinsed three times with sterile water and then disinfected with 1% sodium hypochlorite solution, shaken at 100 rpm for 15–20 minutes. After disinfection, the seeds were rinsed four times with sterile water in a clean hood, transferred to sterile filter paper, and dried for 1.5 hours. The seeds were then inoculated individually onto N6 solid induction medium and cultured in the dark at 28°C for 28 days.

[0057] 2. Subculture

[0058] Pick the light yellow and dense callus tissue, transfer it to fresh N6 solid induction medium, and culture it in the dark at 28°C for about 10 days.

[0059] 3. Agrobacterium-mediated transformation

[0060] Agrobacterium EHa105 transformed with the RSM gene knockout vector was screened on YEB solid medium containing rifampicin and kanamycin.

[0061] Add 10 mL of 1 / 2N6 liquid culture medium (containing 1 / 1000 volume of AS) to a 50 mL centrifuge tube, transfer the Agrobacterium cells transformed with the target vector into the liquid culture medium, shake to mix, and adjust the bacterial solution concentration to OD600 = 0.8.

[0062] Transfer the subcultured fresh callus to the Agrobacterium culture medium and mix evenly for 15 minutes. Pour off the culture medium and transfer the callus to a fresh sterilized filter paper. Place the filter paper on a clean bench to dry for two hours. Then, transfer the callus to 1 / 2N6 solid medium (containing 1 / 1000 volume of AS) and incubate in the dark at 20°C in a constant temperature incubator for approximately two days.

[0063] 4. Sterilization

[0064] Transfer the infected callus tissue to a sterilized 250 mL conical flask, add 150 mL of sterile water, shake gently to clean the callus tissue, and then pour out the sterile water. Repeat several times until the liquid is clear.

[0065] The washed callus tissue was transferred to N6 liquid culture medium containing 500 mg / L cephalosporin, and placed on a shaker with low speed shaking for 15 to 20 minutes to wash three times.

[0066] After sterilization, the callus tissue was transferred to sterile filter paper and placed on a clean bench to dry thoroughly.

[0067] 5. Resistance screening

[0068] The completely dried callus tissue was transferred to N6 solid culture medium containing 250 mg / L cephalosporin and 50 mg / L hygromycin, and cultured in a 28° C. constant temperature incubator in the dark for one month.

[0069] 6. Differentiation

[0070] The screened active callus was transferred to MS medium, cultured in a 28°C constant temperature incubator in the dark for 10 days and then cultured in the light for 20 days.

[0071] 7. Rooting and transplanting

[0072] The differentiated green seedlings were transferred to 1 / 2MS culture medium and placed in a constant temperature incubator at 28°C for two weeks under light. Then, the seedlings in the 1 / 2MS culture medium were taken out and the roots were cleaned to avoid residual culture medium. Subsequently, the seedlings were cultured in a centrifuge tube filled with sterile water. The sterile water was replaced in time. After one week of culture, the seedlings were transplanted into the field. After the seedlings matured, two generations of self-pollination were performed to obtain T2 generation seeds.

[0073] The phenotype of the homozygous knockout mutants of the OsAFB3 gene was observed. Specifically, in this example, two homozygous knockout mutants of the OsAFB3 gene, namely OsAFB3-KO-5 and OsAFB3-KO-6, were selected as experimental groups. At the same time, the receptor material Nipponbare was used as the control group Nip.

[0074] Seeds from the control, OsAFB3-KO-5, and OsAFB3-KO-6 groups were sown and raised as normal. When the seedlings reached four weeks of age, they were transplanted into the field with a spacing of 16.7 cm between plants and 26.7 cm between rows. Sixty plants of each seedling were planted and maintained as normal. After seed maturity, samples were collected and the husks were removed using a brown rice mill. The seeds were then ground into polished rice using a grinder to produce polished rice flour for determination of endosperm starch content.

[0075] The total starch content in the endosperm was determined using a plant starch content kit (purchased from Shanghai Qiyi Biotechnology Co., Ltd., QYS-234027) and the results were statistically analyzed. Figure 1 As shown. Figure 1 It can be seen that there is no significant difference in the total starch content in the endosperm of the control group Nip and the OsAFB3-KO-5 and OsAFB3-KO-6 groups. The amylose content in the endosperm was determined using an amylose content kit (purchased from Shanghai Qiyi Biotechnology Co., Ltd., QYS-234044). Figure 2 As shown. Figure 2It can be seen that the amylose content in the endosperm of the control group Nip was significantly higher than that in the endosperm of the OsAFB3-KO-5 group and the OsAFB3-KO-6 group. The amylopectin content in the endosperm was determined using an amylopectin content kit (purchased from Shanghai Qiyi Biotechnology Co., Ltd., QYS-234046). Figure 3 As shown. Figure 3 It can be seen that the amylopectin content in the endosperm of the control group Nip was significantly lower than that in the endosperm of the OsAFB3-KO-5 group and the OsAFB3-KO-6 group.

[0076] The above description is merely an optional embodiment of the present disclosure and is not intended to limit the present disclosure. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present disclosure shall be included in the scope of protection of the present disclosure.

Claims

1. An application of rice endosperm starch gene, characterized in that: The application includes: using the OsAFB3 gene to regulate the starch content in rice endosperm.

2. The use according to claim 1, characterized in that The application includes: modifying the amino acid sequence of the OsAFB3 gene to reduce the amylose content of rice, increase the amylopectin content, and keep the total starch content of the rice unchanged.

3. The use according to claim 1, characterized in that The applications include: OsAFB3-T is selected as a target site for gene knockout in the sequence of the OsAFB3 gene, and the sequence of the OsAFB3-T is shown in SEQ ID NO: 1 in the sequence listing; An OsAFB3 gene knockout vector was constructed based on the OsAFB3-T using a first forward primer, a first reverse primer, a second forward primer, and a second reverse primer, wherein the sequence of the first forward primer is shown in SEQ ID NO: 2 in the sequence listing, the sequence of the first reverse primer is shown in SEQ ID NO: 3 in the sequence listing, the sequence of the second forward primer is shown in SEQ ID NO: 4 in the sequence listing, and the sequence of the second reverse primer is shown in SEQ ID NO: 5 in the sequence listing; The OsAFB3 gene knockout vector is transformed into a recipient material to obtain an OsAFB3 gene homozygous knockout mutant.

4. The use according to claim 3, characterized in that The application includes: using the pYLsgRNA-OsU6a plasmid as a template, performing a first round of PCR amplification using the first forward primer and the first reverse primer to obtain a first amplification product containing the U6b promoter of the OsAFB3-T, and performing a second round of PCR amplification using the second forward primer and the second reverse primer to obtain a second amplification product containing the sgRNA fragment of the OsAFB3-T; Purifying and recovering the first amplification product and the second amplification product to obtain purified first amplification product and purified second amplification product; Using overlap extension PCR technology to connect the purified first amplification product and the purified second amplification product to obtain a connection product; The ligation product was connected to the pYLCRISPR / Cas9Pubi-H vector to obtain the OsAFB3 gene knockout vector.

5. The use according to claim 4, characterized in that The reaction system for the first round of PCR amplification per 50 μL includes: 4 μL of the first forward primer at a concentration of 10 μM; 4 μL of the first reverse primer at a concentration of 10 μM; 5 μL of 10× Pfu Buffer; 4 μL of 2 mM dNTPs; 1 μL of template DNA; 0.25 μL of Pfu DNA high-fidelity polymerase at a concentration of 5 U / μL; and 31.75 μL of ddH2O.

6. The use according to claim 4, characterized in that The reaction system for the second PCR amplification per 50 μL includes: 5 μL of 10×Pfu Buffer; 4 μL of 2 mM dNTP; 4 μL of the second forward primer at a concentration of 10 μM; 4 μL of the second reverse primer at a concentration of 10 μM; 1 μL of template DNA; 0.25 μL of Pfu DNA high-fidelity polymerase at a concentration of 5 U / μL; and 1.75 μL of ddH2O3.

7. The use according to claim 4, characterized in that The reaction system for the recombination amplification per 50 μL includes: 5 μL of 10×Pfu Buffer; 4 μL of 2 mM dNTP; 4 μL of the first forward primer at a concentration of 10 μM; 4 μL of the second reverse primer at a concentration of 10 μM; 50 ng of the U6a promoter; 50 ng of the guide fragment sgRNA; 0.25 μL of Pfu DNA high-fidelity polymerase at a concentration of 5 U / μL; and ddH2O is supplemented to a total volume of 50 μL.

8. The use according to claim 4, characterized in that Each 15 μL of the ligation reaction system includes: 1.5 μL of 10× CutSmart Buffer; 1.5 μL of 10 mM ATP mixture; 0.5 μL of 100 ng / μL pYLCRISPR / Cas9Pubi-H vector; 1 μL of 100 ng / μL sgRNA expression cassette fragment; 0.5 μL of 20 U / μL BsaI-HF endonuclease; 0.2 μL of 400 U / μL T4 DNA ligase; and 9.8 μL of ddH2O.

9. The use according to claim 4, characterized in that The receptor material is Nipponbare.

Images