Rice bHLH transcription factor gene OsbHLH6 and application thereof
By overexpressing or knocking out the bHLH transcription factor gene OsbHLH6 in rice, the problem of insufficient resistance to brown planthoppers is solved, the insect resistance of rice is enhanced, and the genetic resources and theoretical basis for molecular design and breeding is provided.
Patent Information
- Application Number
- CN202510624745.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-15
- Publication Date
- 2025-08-15
AI Technical Summary
In the prior art, research on the resistance of rice to brown planthoppers has not yet been comprehensive, and there is a lack of effective genetic resources and mechanism understanding, resulting in insufficient insect resistance and affecting rice yield and quality.
By studying and using the rice bHLH transcription factor gene OsbHLH6, genetic transformation method was used to overexpress or knock out the gene in rice, verifying its function in anti-brown planthoppers. The OsbHLH6 gene was introduced into rice using Agrobacterium-mediated genetic transformation technology for overexpression or knockout experiments.
OsbHLH6 overexpressing plants significantly enhance their resistance to brown planthoppers, and knockout plants significantly weaken their resistance, providing a basis for the molecular mechanism of rice to resist brown planthoppers, providing genetic resources for molecular design and breeding, and enhancing the insect resistance of rice.
Smart Images

Figure CN120485208A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of plant genetic engineering, and in particular relates to a rice bHLH transcription factor gene OsbHLH6 and an application thereof. Background Art
[0002] Rice (Oryza sativa) is one of the most important food crops in the world. Its yield and quality are crucial to ensuring food security in my country and even the world. However, during its growth, rice is often attacked by various pests, which seriously affect its yield and quality. Among them, the brown planthopper (BPH; Nilaparvata lugens The brown planthopper (NLP), a typical piercing-sucking pest, uses its specialized needle-like mouthparts to pierce rice stems and suck phloem sap, causing damage. This damage leads to nutrient loss, yellowing of leaves, withering and lodging, and severe yield reductions, sometimes even to total crop failure (Wang et al., 2008; Cheng et al., 2012). In addition to direct damage, the brown planthopper can also indirectly harm rice crops by spreading or inducing various diseases. As the number one pest in my country's rice production, curbing the development and damage of the brown planthopper is crucial to ensuring the safety of rice production in my country.
[0003] Some rice genes confer resistance to brown planthoppers. For example, Chinese patent publication CN118531023A proposes a rice tRNA isopentenyltransferase gene, OsIPT10, and its applications, which investigate its role in brown planthopper resistance. Chinese patent publication CN118956899A proposes a rice cytokinin response regulator gene, OsRR24, and its applications, which investigate its role in brown planthopper resistance. Research on rice genes that confer brown planthopper resistance requires further investigation from different perspectives and mechanisms to expand the pool of brown planthopper-resistant gene resources and provide more avenues for the development of brown planthopper-resistant rice varieties. Summary of the Invention
[0004] The present invention aims to provide a rice bHLH transcription factor gene OsbHLH6 and its application, so as to provide a gene that can be used in rice brown planthopper-resistant breeding and realize the application of the gene in brown planthopper-resistant rice breeding.
[0005] bHLH (basic helix–loop–helix) transcription factors are the second largest family of transcription factors in plants, playing a crucial regulatory role in plant responses to biotic and abiotic stresses. This class of transcription factors is named for their unique, conserved bHLH domain. This domain consists of two functionally distinct parts: a basic region at the N-terminus rich in positively charged amino acids that specifically recognizes and binds to cis-acting elements in target gene promoters; and a helix–loop–helix (HLH) structure at the C-terminus that promotes protein dimerization, helping bHLH transcription factors stably bind to DNA as dimers, thereby precisely regulating the expression of downstream genes. This synergistic effect of structure and function gives the bHLH family significant biological significance in various physiological processes, such as plant stress response and developmental regulation.
[0006] Currently, research in rice focuses on the induction of bHLH transcription factors by abiotic stresses such as low temperature, high salt concentration, drought, iron deficiency, and phosphorus deficiency, and their role in mediating plant-related stress resistance. For example, OsbHLH59, through alternative splicing, regulates different downstream target genes and signaling pathways, enabling fine-grained control of rice growth and drought resistance. Under normal conditions, it primarily regulates plant growth and development, while its expression is upregulated under drought stress, conferring enhanced drought resistance (Ning et al., 2025). OsbHLH18 and OsbHLH19 are involved in regulating root growth and acid phosphatase activity in rice under phosphorus deficiency, ultimately affecting rice growth and phosphorus uptake efficiency (Dong, 2024). However, whether rice bHLH transcription factors play a role in insect resistance and how they participate in this process remain unclear.
[0007] The rice brown planthopper resistance gene, Bph6, is a novel, broad-spectrum insect-resistant gene encoding a previously uncharacterized protein that confers high resistance to brown planthoppers and white-backed planthoppers, making it of great application value in rice breeding for brown planthopper resistance (Guo et al., 2018). A study found that, compared with controls lacking the Bph6 gene, Bph6 plants significantly increased the expression and endogenous content of genes involved in the synthesis and signaling pathways of salicylic acid (SA) and jasmonic acid (JA) after feeding by brown planthoppers (BPH). Furthermore, exogenous SA and JA treatment significantly enhanced the rice's resistance to brown planthoppers. The study also found that the expression of a bHLH transcription factor gene, OsbHLH6, was significantly elevated in response to JA treatment and feeding by brown planthoppers, and was even more pronounced in Bph6 plants, suggesting that OsbHLH6 may be involved in Bph6-mediated insect resistance. However, the regulatory relationship between OsbHLH6 and SA and JA remains unclear, particularly its role in rice resistance to brown planthoppers.
[0008] Discovery and experimental progress of the OsbHLH6 gene:
[0009] 1) Discovery process: When studying the changes in the expression levels of rice-related genes after MeJA (methyl jasmonate) treatment and feeding by brown planthoppers, it was found that the expression level of OsbHLH6 was significantly upregulated in the Bph6-NIL (highly resistant to brown planthoppers) material compared with the control group.
[0010] 2) Genetic transformation verification: The full-length OsbHLH6 ORF was ligated into the ubi promoter-containing vector pRHV. Using Agrobacterium tumefaciens EHA105-mediated genetic transformation, the overexpression vector was introduced into Nipponbare, resulting in 18 OsbHLH6-overexpressing transgenic plants. Similarly, the OsbHLH6 CRISPR-Cas9 vector was transformed into Bph6-NIL, generating 15 knockout mutant plants.
[0011] The primers for screening overexpression plants are
[0012] Hyg-L:GCTCCATACAAGCCAACCAC(5'-3')
[0013] Hyg-R:GAAAAAGCTGAACTCACCG(5'-3')
[0014] The primers for screening CRISPR-Cas9 gene-edited plants are
[0015] bHLH6-KO-F:ATGGACGCCGAGAT GGCCAT(5'-3')
[0016] bHLH6-KO-R:GGTCAAAGTCAAACTTGGAA(5'-3')
[0017] Insect resistance of T3 generation transgenic homozygous plants was identified, and it was found that OsbHLH6 overexpression plants had upregulated resistance to brown planthoppers, while OsbHLH6 knockout plants had significantly downregulated resistance to brown planthoppers.
[0018] In this research context, the purpose of the present invention is to provide a rice bHLH transcription factor gene OsbHLH6 and its application in functional research on rice resistance to brown planthoppers.
[0019] To achieve the above objectives, the present invention adopts the following technical solutions:
[0020] Provided is a rice bHLH transcription factor gene OsbHLH6, the nucleotide sequence of which is the full length and / or fragments thereof shown in SEQ ID NO.1.
[0021] The rice bHLH transcription factor gene OsbHLH6 provided by the present invention has a CDS sequence as shown in SEQ ID NO. 1 according to analysis of NCBI 9311, and its ORF is 933 bp in full length.
[0022] Those skilled in the art will understand that the present invention includes sense sequences or antisense sequences based on the polynucleotide described in SEQ ID NO.1. In addition, based on the nucleotide sequence shown in SEQ ID No.1, one or more nucleotides are replaced, deleted and / or added to obtain an amino acid sequence with the same function. For example, in sequences under different rice backgrounds, if one or more nucleotides are replaced or deleted, the encoded amino acid sequence does not have a frameshift mutation, but only has a partial amino acid deletion or point mutation, which is also within the scope of protection. Therefore, the gene described in the present invention also includes a nucleotide sequence shown in SEQ ID No.1 that has the same function after one or more nucleotides are replaced, deleted and / or added.
[0023] The present invention also provides the use of the aforementioned rice bHLH transcription factor gene OsbHLH6 in breeding brown planthopper-resistant rice varieties.
[0024] The present invention also provides a protein encoded by the aforementioned rice bHLH transcription factor gene OsbHLH6, the amino acid sequence of which is shown in SEQ ID NO.2.
[0025] The ORF sequence of the gene shown in SEQ ID NO.1 encodes 310 amino acids, as shown in SEQ ID NO.2.
[0026] It should be understood that, without affecting the activity of the OsbHLH6 protein (i.e., not in the active center of the protein), those skilled in the art can make various substitutions, additions, and / or deletions of one or more amino acids to the amino acid sequence shown in SEQ ID NO. 2 to obtain an amino acid sequence with equivalent function.
[0027] The present invention also provides the use of the above protein in breeding rice varieties resistant to brown planthoppers.
[0028] The present invention also provides a vector of the aforementioned rice bHLH transcription factor gene OsbHLH6.
[0029] The vector includes a cloning vector or an expression vector containing a polynucleotide sequence such as SEQ ID NO. 1 or a fragment thereof.
[0030] The present invention also provides a host containing the aforementioned vector.
[0031] The host includes host cells containing the aforementioned vector, and plant cells transformed with a vector containing the nucleotide sequence of SEQ ID NO. 1 or a fragment thereof.
[0032] The present invention also provides transgenic materials containing the above-mentioned vector.
[0033] The transgenic materials include OsbHLH6 overexpressing plants, or transgenic plants transformed with a vector containing the nucleotide sequence of SEQ ID NO. 1 or a fragment thereof.
[0034] The molecular detection method for the rice bHLH transcription factor gene OsbHLH6 described above is as follows: the genomic DNA of the transgenic rice overexpressing OsbHLH6 to be tested is amplified using a matching primer pair (the above-mentioned primers Hyg-L and Hyg-R), and the amplified product is detected. These primers are vector primers, and this sequence does not exist in the wild-type rice genome. If a 728bp amplified fragment is amplified using primers Hyg-L and Hyg-R, it indicates that the plant is transgenic-positive; if this fragment is not amplified, it indicates that the plant is transgenic-negative. The genomic DNA of the OsbHLH6 gene-edited rice to be tested was amplified using a matching primer pair (the above-mentioned primers bHLH6-KO-F and bHLH6-KO-R), and the sequence of the amplified product was obtained by Sanger sequencing. Compared with the sequence of the amplified fragment of the wild-type rice genome, if the fragment amplified using primers bHLH6-KO-F and bHLH6-KO-R had base deletions or additions at the target position, it indicated that the gene-edited plant was successfully generated. If there was no sequence difference, it indicated that the plant was gene-edited negative.
[0035] The method for cultivating OsbHLH6 overexpressing plants is as follows:
[0036] 1) transforming plant cells with a polynucleotide containing the ORF of the rice bHLH transcription factor gene OsbHLH6, the nucleotide sequence of which is shown in SEQ ID NO. 1;
[0037] 2) regenerating the transformed plant cells into plants;
[0038] 3) Cultivating the regenerated plants and overexpressing the polynucleotide.
[0039] The plant here is a monocotyledonous plant, specifically the monocotyledonous plant can be rice.
[0040] The advantages and effects of the present invention are as follows: plants overexpressing the rice bHLH transcription factor gene OsbHLH6 have significantly enhanced resistance to brown planthoppers, while knockout mutant plants have significantly weakened resistance to brown planthoppers; the gene OsbHLH6 is a good example of the involvement of rice bHLH transcription factors in crop insect resistance, which has reference value for understanding the regulation of rice bHLH transcription factor genes on pest resistance; research on the OsbHLH6 gene provides a good theoretical basis for the molecular mechanism of rice brown planthopper resistance genes, is of great significance for molecular design breeding, and also provides gene resources for molecular design breeding of rice insect resistance. BRIEF DESCRIPTION OF THE DRAWINGS
[0041] The accompanying drawings are used to provide a further understanding of the present invention and constitute a part of the specification. Together with the embodiments of the present invention, they are used to explain the present invention and do not constitute a limitation of the present invention. In the accompanying drawings:
[0042] Figure 1 This is the expression detection result of the rice bHLH transcription factor gene OsbHLH6 in the examples of the present invention.
[0043] Figure 2 To identify insect resistance of transgenic and knockout mutant plants by group method at the seedling stage.
[0044] Figure 3 To identify the insect resistance of transgenic and knockout mutant plants of brown planthopper using honeydew and insect weight gain methods. DETAILED DESCRIPTION
[0045] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention. Unless otherwise specified, the technical means used are conventional means familiar to those skilled in the art; the experimental methods used are all conventional methods and can be completed according to the described recombinant technology (see Molecular Cloning, A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); the materials, reagents, etc. used can be obtained from commercial channels.
[0046] Identification of the bHLH transcription factor gene OsbHLH6 from rice
[0047] When studying changes in rice gene expression after MeJA (methyl jasmonate) treatment, we found that OsbHLH6 expression was significantly upregulated compared to the control group. Primers were designed for the ORF, and PCR amplification was performed using Nipponbare rice (template) cDNA as a template using the high-fidelity enzyme KOD-Plus-Neo (TOYOBO, Japan) in a 50 μl reaction system. PCR conditions were: 94°C pre-denaturation for 2 minutes, 95°C denaturation for 10 seconds, and 68°C annealing and extension for 30 seconds / kb for 32 cycles. The PCR system is as follows:
[0048]
[0049]
[0050] The PCR product was recovered and ligated into the pMD18-T vector, and positive clones were screened and sequenced. The result is shown in SEQ ID No. 1.
[0051] Detection of OsbHLH6 Gene in Rice by Quantitative PCR
[0052] In order to understand whether the expression of OsbHLH6 gene is induced by MeJA (methyl jasmonate), expression analysis was performed on samples of Bph6-NIL (high brown planthopper-resistant material, i.e., high brown planthopper-resistant rice variety) treated with Mock (blank control group) and MeJA. The results showed that the expression of this gene was upregulated by MeJA treatment (see Figure 1 A) In Figure 1 In A, “OsbHLH6mRNA relativeexpression” is the relative expression level of OsbHLH6 gene messenger RNA.
[0053] In order to understand whether the OsbHLH6 gene is induced by brown planthopper feeding, the expression of the gene was analyzed by taking samples of Bph6-NIL (highly resistant to brown planthoppers) and the control material 9311 (highly susceptible to brown planthoppers) after being fed by brown planthoppers at different times. The results showed that the expression of this gene was upregulated by brown planthopper feeding ( Figure 1 B), in Figure 1 In panel B, “OsbHLH6 mRNA relativeexpression” is the relative expression level of OsbHLH6 gene messenger RNA, and “Days after BPH infestation” is the number of days after brown planthopper feeding.
[0054] The primers used for quantitative PCR are:
[0055] OsbHLH6-qRTF:5'-ATTTTTGCGACAACCCACTA-3'
[0056] OsbHLH6-qRTR:5'-GCTGGACCACCTTATTATTCATC-3'.
[0057] from Figure 1 It can be seen that the expression level of OsbHLH6 was significantly upregulated after MeJA treatment and feeding by brown planthoppers, indicating that OsbHLH6 expression was induced by MeJA treatment and feeding by brown planthoppers.
[0058] Construction of OsbHLH6 gene overexpression vector, CRISPR-Cas9 gene editing vector and Agrobacterium-mediated genetic transformation
[0059] 1. Construction of OsbHLH6 overexpression vector
[0060] The inventors designed primers by cutting a section from each end of the ORF of OsbHLH6. The primer sequences are as follows:
[0061] OEOsbHLH6-F:ATTACTAGTATGGACGCCGAGATGGCCATGG(5'-3')
[0062] OEOsbHLH6-R:CGGACTAGTCTAATAGCTCATGGAGCTCAA(5'-3').
[0063] The vector used was pRHV (provided by Researcher Ning Yuese of the Institute of Plant Protection, Chinese Academy of Agricultural Sciences). The pRHV vector was digested with SpeI, and the exogenous fragment was cleaved and directly ligated into the dephosphorylated vector. Based on the sequence of SEQ ID No. 1, the ORF was amplified using PCR and ligated into the vector after digestion. After sequencing verification, the resulting vector, identified as the OsbHLH6 gene overexpression vector, was electroporated into Agrobacterium tumefaciens EHA105. A single colony was selected and expanded, verified by PCR, and then mixed with an equal volume of 50% glycerol and stored at -80°C until further use.
[0064] 2. Construction of OsbHLH6 CRISPR-Cas9 gene editing vector
[0065] Find the specific target GGACGGGTCGCACTCGTCGTCGG on the target gene, design primers, and amplify the sgRNA fragment and U6a promoter fragment containing the specific target of the target gene respectively; overlap PCR method is used to overlap the two fragments; the PCR product is detected by agarose gel electrophoresis. If it is a single band, the product can be directly recovered. If there is a mixed band, the gel needs to be cut and then recovered by gel. The recovered fragment and pYLCRISPR / Cas9Pubi-H vector (pYLCRISPR / Cas9Pubi-H vector was provided by Academician Liu Yaoguang of South China Agricultural University) were connected using the Golden Gate cloning method (Ma et al., 2015, A robust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Molecular Plant 8: 1274-1284). The positive clones with correct sequencing were extracted with plasmids and electrotransformed into Agrobacterium EHA105 for subsequent genetic transformation experiments.
[0066] 3. Genetic Transformation
[0067] The OsbHLH6 gene overexpression vector was introduced into Nipponbare using the Agrobacterium EHA105-mediated genetic transformation method (Hiei et al., 1994, Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant Journal 6: 271-282).
[0068] Transgenic progeny were tested using hygromycin primers Hyg-L and Hyg-R, yielding 18 overexpressing transgenic plants and 15 gene-edited transgenic plants. Southern blot analysis and progeny PCR analysis yielded 12 homozygous overexpression lines at different insertion sites, while 10 gene knockout lines were obtained through PCR amplification and sequencing.
[0069] Phenotypic Analysis of OsbHLH6 Gene Overexpression and RNAi Suppression Plants
[0070] 1. Seedling Group Method
[0071] About 60 seeds were collected from the materials to be identified (OsbHLH6-overexpressing plants (OsbHLH6-OE), OsbHLH6-suppressed plants (OsbHLH6-KO), Nipponbare, and Bph6-NIL), and after soaking and germination, they were sown in plastic cups with a diameter of 10 cm, with about 20 seeds sown per cup, and three cups were sown for each material. When the seedlings grew to the three-leaf stage, the seedlings with poor growth status were removed, and each cup of material was covered with a mesh bag, and 2-3 instar brown planthopper nymphs were inoculated into the bag at a rate of 8 brown planthoppers per seedling. When more than 90% of the sensitive control died, the resistance grade of each cup of material was read (see Figure 2 ).
[0072] exist Figure 2 In the table, “Nipponbare” means “Nipponbare”; “OsbHLH6-KO” means “OsbHLH6-inhibited plant”; “OsbHLH6-OE” means “OsbHLH6-overexpressing plant”; “Bph6-NIL” means “highly resistant to brown planthoppers, i.e., highly resistant to brown planthoppers rice variety”; and “BPH resistance scores” means the resistance value to brown planthoppers (the lower the value, the stronger the resistance).
[0073] 2. Determination of honeydew amount and weight gain of brown planthopper
[0074] The sealing film was made into bags of appropriate size, each wax bag was numbered and weighed on a scale, and the wax bag was tied to the rice stem. At the same time, the newly emerged female brown planthoppers were caught, numbered and weighed on a scale, and then placed in the corresponding numbered wax bag. After the brown planthoppers had fed for 48 hours, the brown planthoppers and wax bags were weighed on a scale. The difference in the wax bag weights was recorded as the amount of honeydew of the brown planthoppers, and the difference in the two weighing weights of the brown planthopper nymphs was recorded as the weight gain of the brown planthoppers. Each material was subjected to 20 independent biological replicates (identification results are shown in Figure 2). Figure 3 ).
[0075] Figure 3 In the table, “BPH gain weight” is the weight gain of brown planthopper (the lower the value, the stronger the resistance), and “BPH honeydew secretion” is the honeydew secretion of brown planthopper (the lower the value, the stronger the resistance).
[0076] In the above experiments, to study the function of OsbHLH6 in rice, overexpression and CRISPR-Cas9 knockout vectors were introduced into Nipponbare and Bph6-NIL, respectively, through Agrobacterium-mediated genetic transformation. The overexpression plants showed significantly enhanced resistance to brown planthoppers, while the knockout mutant plants showed significantly reduced resistance to brown planthoppers. This is because the plant hormones salicylic acid (SA) and jasmonic acid (JA) play important roles in defense processes such as insect resistance and disease resistance. OsbHLH6 is a transcription factor-like gene in the downstream of the rice salicylic acid pathway, and its expression is upregulated by JA treatment. The gene of the present invention provides a good theoretical basis for studying the role of transcription factors in rice insect resistance by regulating the salicylic acid and jasmonic acid pathways, has reference significance for studying gene molecular functions, and also provides genetic resources for the design and breeding of insect-resistant rice.
[0077] It should be noted that, in this document, terms such as "comprises", "includes" or any other variations thereof are intended to cover non-exclusive inclusion, so that a process, method, article or apparatus that includes a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements that are inherent to such process, method, article or apparatus.
[0078] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to these embodiments without departing from the principles and spirit of the invention, and that the scope of the invention is defined by the appended claims and their equivalents.
Claims
1. A rice bHLH transcription factor gene OsbHLH6, characterized by: The nucleotide sequence of the gene is the full length and / or fragments thereof as shown in SEQ ID NO.
1.
2. Use of the rice bHLH transcription factor gene OsbHLH6 according to claim 1 in breeding brown planthopper-resistant rice varieties.
3. The protein encoded by the rice bHLH transcription factor gene OsbHLH6 according to claim 1, wherein the amino acid sequence of the protein is shown in SEQ ID NO.
2.
4. Use of the protein according to claim 3 in breeding rice varieties resistant to brown planthoppers. 5 . A vector containing the rice bHLH transcription factor gene OsbHLH6 according to claim 1 .
6. A host containing the vector according to claim 5.
7. A transgenic material containing the vector according to claim 5.
Citation Information
Patent Citations
Rice tRNA (transfer ribonucleic acid) isopentenyl transferase gene OsIPT10 and application thereof
CN118531023A
Rice cytokinin response regulatory factor gene OsRR24 and application thereof
CN118956899A