Rice brown planthopper resistant gene BGIOSGA006488 and application thereof

By cloning and gene editing the rice brown planthopper gene BGIOSGA006488, the problem of easy loss of resistance in rice varieties is solved, and efficient anti-brown planthopper ability is achieved, reducing the use of chemical insecticides, reducing production costs and environmental protection.

CN120485211APending Publication Date: 2025-08-15福建省农业科学院水稻研究所
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510693253.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-27
Publication Date
2025-08-15

AI Technical Summary

Technical Problem

Existing rice varieties are prone to loss of resistance when facing the new biological type of brown planthopper, and lack of efficient anti-brown planthopper genes, resulting in frequent use of chemical insecticides, increasing environmental pollution and production costs.

Method used

The rice anti-brown planthopper gene BGIOSGA006488 was discovered and cloned, and the gene was knocked out in rice through gene editing technology to verify its function in anti-brown planthopper.

Benefits of technology

It provides a new anti-brown planthopper gene, which can effectively improve the resistance of rice to brown planthoppers, reduce the use of chemical insecticides, reduce production costs, and protect the ecological environment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120485211A_ABST
    Figure CN120485211A_ABST
Patent Text Reader

Abstract

The embodiment of the invention discloses a rice brown planthopper resistant gene BGIOSGA006488 and application thereof, and belongs to the technical field of molecular biology and agriculture. The rice brown planthopper resistant gene BGIOSGA006488 has a nucleotide sequence as shown in SEQ ID NO: 1 (sequence identifier number 1). The novel brown planthopper resistant gene BGIOSGA006488 is found through resistance identification, genetic analysis and gene localization of resistant materials in combination with a gene editing technical means, the function of regulating and controlling the resistance of rice to brown planthoppers is determined, and the gene BGIOSGA006488 has very important application in agricultural production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The embodiments of the present invention relate to the fields of molecular biology and agricultural technology, and particularly to a rice brown planthopper resistance gene BGIOSGA006488 and applications thereof. Background Art

[0002] Rice is one of my country's most important food crops, and pests and diseases can lead to reduced grain production. The brown planthopper, a monophagous pest that feeds on rice, has become a significant pest in my country's rice production, posing a long-term threat to food security. The brown planthopper uses its needle-like mouthparts to pierce the rice phloem to suck sap, which not only affects rice growth, causing yield reductions or even complete crop failure, but also spreads rice viral diseases. For a long time, brown planthopper-resistant rice varieties were in short supply, and control of brown planthoppers relied primarily on chemical pesticides. However, long-term use of these chemicals has led to resistance in the brown planthoppers. Breeding brown planthopper-resistant rice varieties is the most effective and economical way to effectively control brown planthoppers. Leveraging rice varieties' resistance to brown planthoppers can reduce the use of chemical pesticides, lower rice production costs, and protect the ecological environment, ultimately achieving green and sustainable rice production.

[0003] Genetic and breeding research on rice resistance to brown planthoppers began in the 1960s, and more than 40 resistance loci have been discovered. However, with the emergence of new biotypes (or new harmful types), the insect-resistant varieties that have been discovered face the risk of short service life and loss of resistance. For example, the International Rice Research Institute first discovered in 1973 that the Bph1 gene had the ability to resist brown planthoppers and bred the variety IR26. However, with the emergence of the harmful brown planthopper biotype 2 two years later, it lost its resistance to brown planthoppers. The subsequent release of IR36 and IR42 containing the Bph2 gene also lost resistance to the new brown planthopper biotypes that subsequently appeared. With the emergence of new biotypes of brown planthoppers, previously highly resistant rice varieties have been reduced to moderate resistance or even susceptible levels.

[0004] Therefore, it is of great significance to continuously screen rice germplasm resources with resistance to brown planthoppers, find new brown planthopper-resistance genes, locate and clone them, develop molecular markers, apply them to rice breeding, and develop new rice varieties with high resistance levels. Summary of the Invention

[0005] To this end, an embodiment of the present invention provides a rice brown planthopper resistance gene BGIOSGA006488 and its application.

[0006] In order to achieve the above objectives, the embodiments of the present invention provide the following technical solutions:

[0007] According to a first aspect of the embodiments of the present invention, the present invention provides a rice brown planthopper resistance gene BGIOSGA006488 having a nucleotide sequence as shown in SEQ ID NO: 1.

[0008] According to a second aspect of the embodiments of the present invention, the present invention provides a rice anti-brown planthopper protein encoded by the nucleotide sequence described above.

[0009] According to a third aspect of the embodiments of the present invention, the present invention provides a recombinant vector comprising the rice brown planthopper resistance gene BGIOSGA006488 as described above.

[0010] According to a fourth aspect of the embodiments of the present invention, the present invention provides a host cell comprising the rice brown planthopper resistance gene BGIOSGA006488 as described above, or the recombinant vector as described above.

[0011] According to a fifth aspect of the embodiments of the present invention, the present invention provides the use of the rice brown planthopper-resistant gene BGIOSGA006488, the rice brown planthopper-resistant protein, the recombinant vector, or the host cell in rice brown planthopper-resistant breeding.

[0012] The embodiments of the present invention have the following advantages:

[0013] The present invention discovered a new brown planthopper resistance gene BGIOSGA006488 through resistance identification of resistant materials, genetic analysis and gene positioning, combined with gene editing technology, and determined that it has the function of regulating rice resistance to brown planthoppers, which has very important applications in agricultural production. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] To more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for the embodiments or the description of the prior art. Obviously, the drawings described below are merely exemplary, and those skilled in the art can derive other implementation drawings based on the provided drawings without inventive effort.

[0015] Figure 1 This is the knockout sequence comparison result provided by the present invention, wherein DP38_BGIOSGA006488 is the wild type, 3-3 is the base C mutated to the base T, and 3-4 is the missing CCA base.

[0016] Figure 2 The present invention provides a knockout strain for the identification of resistance to brown planthoppers, wherein DP38 is an insect-resistant variety; dp38-1 is knockout strain 1; dp38-2 is knockout strain 2; dp38-3 is knockout strain 3; RHT is an insect-resistant control variety; and TN1 is an insect-susceptible variety. DETAILED DESCRIPTION

[0017] The following describes the implementation of the present invention using specific embodiments. Those skilled in the art will readily understand the other advantages and benefits of the present invention from the disclosure herein. Obviously, the embodiments described are only a portion of the present invention, not all of it. All other embodiments derived by persons of ordinary skill in the art based on the embodiments of the present invention without inventive effort are intended to fall within the scope of protection of the present invention.

[0018] Test materials:

[0019] Insect-resistant variety DP38: Derived from the germplasm preserved by the Rice Research Institute of the Fujian Academy of Agricultural Sciences, it has been identified as having sustained resistance to brown planthoppers, and can survive brown planthopper infestation for 12 days.

[0020] Insect-susceptible variety TN1: TN1 is Taichung Local No. 1, which is preserved at the Rice Research Institute of Fujian Academy of Agricultural Sciences. It has clear insect-susceptibility characteristics and is easily attacked by pests such as brown planthoppers and rice leaf rollers.

[0021] The insect-resistant control variety RHT: The full name is Rathu Heenati, originated from Sri Lanka and preserved at the Rice Research Institute of Fujian Academy of Agricultural Sciences. It carries the main gene Bph3 for resistance to brown planthoppers, and shows high resistance to almost all the discovered harmful types of brown planthoppers, and has broad-spectrum and long-lasting resistance to brown planthoppers.

[0022] Example 1

[0023] The BGIOSGA006488 gene was located and cloned by hybridizing insect-resistant and susceptible varieties.

[0024] A population of F2 progeny was established by crossing DP38 with TN1, yielding a sample size of 806. Of these, 156 individuals were selected for resistance testing. The segregation ratio was 41 / 115, consistent with Mendelian genetic segregation. This suggests that the high resistance to brown planthoppers in the brown planthopper-resistant material DP38 used in this study is controlled by a pair of dominant nuclear genes.

[0025] Genome-wide association studies (GWAS) were performed on the target population, identifying two quantitative trait loci (QTLs) associated with resistance, located on chromosomes 2 and 4, respectively. Separating population analysis sequencing (BSA sequencing) was also performed on the same target population, identifying a resistance locus on chromosome 2. Association analysis between the GWAS-derived QTLs and the BSA-derived resistance loci identified an association interval, encompassing 13 genes. Among these, gene BGIOSGA006488, encoding an NBS-LRR protein, has been shown to be associated with insect resistance. Therefore, gene BGIOSGA006488 was identified as a candidate gene for insect resistance.

[0026] The gene BGIOSGA006488 was cloned and analyzed, and compared with TN1, it was found to have a SNP site: 395C / T.

[0027] The cDNA sequence of gene BGIOSGA006488 of the brown planthopper-resistant material DP38 is as follows:

[0028] ATGATTACTCAAGCAAAACTCATCATAAAGGAGTGTGATGGTCATCCTCTTGCAATAACCAATATTGCTGGTTTCTTGGCAAGAAAGCAAAAAACAACTACAGAATGGAAGAAGTTGAATGATAATTTTACTTCTGGGTCAGTGAACAAAGAAAATCTTGAAATGATAAGTACAACCCTTGAACCATCCTATAATAACTTGTCCTATCATCTAAAGTTATGCCTTCTGTACTTATCTGTTTTTCCCAAAGGCCATAATATTAGGCGCAAACGCATAGTAAGACGTTGGGTTGTAGAAGGTTACATAAGTAAGACTCATAGCTTGAGTGCAGAAGAAGTTGGTGAGAGCTATTTTGCAGAGCTTATCAATAGAAGCATCATTCAACCATCAGAACTAGTACCAGCTCACAATGTTGGCAATATTGAATATTGTCGAGTACATAATCTTATG CACAAGATTAGTGTTTCAAAATCCATGGAAGAAAATCATGGCTTTGTACTTGAAGTTAGCTCTAATAACGAAGGTACAGTACGACATTTATCTATAATCAACACTGGTGAGACAAACAAGAACGCATTGAAGTGTGTTGACCTAACCCATGTACGATCAGTGACTATATTTGGAGAGTGCAGAGCATCTTTAGATTTTAGCATGATGAGGATGCTTCGGATTCTT GATTTGGAGGGCACATCTGGTTTGAAAGATCATGAACTGAGTCAAATTGGCAATTTTCTTCACCTTAGGTACCTTTCATTGAGAGGATGCGCTGATATCTATCATCTACCAAATTCATTGGGCAACTTGTGGGACATCCAGATGTTAGATGTCAGTGGCACAAGTATCATCAAGCTACCAAAGACCATCACCAAGCTAAAGAAGCTCCACTACCTTCGTGCCGGCCACGTACCAAAGGATGATGCCACCTCTTCTATAGAGTTGAAAGAATCAAGTGATCTTTCGAAAATGGAGCACGAGCCAATTAATGATTTGGAAATACCATATGTTGAAGTCAAATCAGTTCAATTTGGCATGACGGTATTGGACACGACAAAAGCATATATCACAAAAACAATGCAAAATAATGACAATGTAAATAAGCATGACATATTCCACAAATATTGCAAGGCCTTGTTACCTGGCATTCCACAGGGACTTGATATGTATGGTGTTAAAGCACCTGAAGGGATTGGCCAACTGAATGACCTGCACACACTTGGTGTTGTTAACGTTGCAGCCGGGAAAGTCATATTGCGTGAGCTTGAAAAACTTAAAAAACTACATAAGTTAGGATTGATGGGTGTCAATAAGAAAAATAGCCAAGCTATCCTATCTGCCATTGCAAACCTTGCCCTCTTACACTCATTATCATTGCAAGCAGAGGGGGAATCAGGTTTACAAGGTTGTTTGGATCACACATTTGCACCTCCAAGTAAGCTTCAAAGTCTCAAGATTTATGGAAATCTAGTTACACTACCAATATGGATCACCCAACTCCAGAATTTGGCTAAGTTGAAGCTTAGGAGCACCCAGTTGAAGTTGGCTCCTTCCATGGAAATCCTTGGGAAGCTACCACATTTGGTCATTCTGCGACTGTGGAAGAATTCTGTTCTTCAGAGCAAAAAAAATACTTTTCGATTTTCAGCAGGGCACTTTCCCAAGCCTTGTAGTGATGGAGCTTAA(SEQ ID NO:1).

[0029] The cDNA sequence of the gene BGIOSGA006488 of the insect-susceptible rice TN1 is as follows:

[0030]

[0031] Example 2

[0032] Gene editing knockout experiments

[0033] Using gene editing technology, the BGIOSGA006488 gene of the resistant variety DP38 was knocked out, making the insect-resistant variety susceptible to insects.

[0034] Construction of rice gene knockout vector

[0035] According to the BGIOSGA006488 genome sequence, its front-end sequence was selected as the target sequence, and the gRNA sequence was designed and synthesized to construct the pBWA(V)H vector (Wuhan Boyuan Biotechnology Co., Ltd.) containing the gRNA sequence fragment. Using this CRISPR / Cas9 gene editing vector system, one or more bases in the target sequence were mutated. The cDNA sequence of the BGIOSGA006488 gene undergoes a frameshift mutation, and the expression product is not the original amino acid product, thereby achieving the knockout of the BGIOSGA006488 gene. The knockout sequence is as follows Figure 1 As shown, 3-3 has a single base mutation (CT), and 3-4 has a 3-base deletion (CCA).

[0036] Target sequence: CTAGTACCAGCTCACAATGT (SEQ ID NO: 3);

[0037] gRNA sequence: AGTAAGACGTTGGGTTGCAGA (SEQ ID NO: 4).

[0038] The target sequence for the BGIOSGA006488 gene was designed, a CRISPR / Cas9 knockout vector was constructed, and the knockout vector was transformed into EHA105 Agrobacterium. DP38 calli were induced, infected with Agrobacterium, screened on a screening medium, and induced to form seedlings. The knockout plants were sequenced to confirm positive results, resulting in the BGIOSGA006488 knockout strain. This work was completed by Wuhan Boyuan Biotechnology Co., Ltd.

[0039] Identification of insect resistance of T1 generation homozygous mutant lines with BGIOSGA006488 gene knockout

[0040] The insect resistance identification method is as follows: soak the rice seeds of RHT, TN1, DP38, mutant dp38-1 (corresponding to 3-3), mutant dp38-2 (corresponding to 3-4), and mutant dp38-3 (corresponding to 3-4) in water for 48 hours and germinate for 6 hours. When the seeds turn white, sow the seeds in small square pots, sow 10 plants per pot, one variety per pot, and treat them in the dark at 28°C for 48 hours. After the seedlings emerge, place them in a culture room with 16 hours of light. When they have two leaves and one heart, inoculate 2-3 instar brown planthoppers, about 20 heads per seedling, and culture them for 7 days to observe the resistance of TN1 and other varieties.

[0041] The experimental results show that ( Figure 2 ) Six days after infestation by brown planthoppers, the knockout strain and TN1 experienced plant mortality, with mortality exceeding 90% on the seventh day. The resistant rice varieties experienced no plant mortality. Therefore, the gene BGIOSGA006488 in the resistant rice material is a rice brown planthopper-resistance gene.

[0042] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made thereto. Therefore, such modifications and improvements, without departing from the spirit of the present invention, are intended to be within the scope of protection claimed herein.

[0043]

[0044]

[0045]

[0046]

Claims

1. A rice brown planthopper resistance gene BGIOSGA006488, characterized by: It has the nucleotide sequence shown in SEQ ID NO:

1.

2. A rice anti-brown planthopper protein, characterized in that: Encoded by the nucleotide sequence according to claim 1.

3. A recombinant vector, characterized in that The method comprises the rice brown planthopper-resistant gene BGIOSGA006488 as claimed in claim 1.

4. A host cell, characterized in that It comprises the rice brown planthopper-resistance gene BGIOSGA006488 as claimed in claim 1, or the recombinant vector as claimed in claim 3.

5. Use of the rice brown planthopper-resistant gene BGIOSGA006488 according to claim 1, the rice brown planthopper-resistant protein according to claim 2, the recombinant vector according to claim 3, or the host cell according to claim 4 in rice brown planthopper-resistant breeding.