Gene for regulating powdery mildew resistance of cucumber and application thereof

Abstract

The invention belongs to the technical field of plant biology, and particularly relates to a gene for regulating and controlling powdery mildew resistance of cucumbers and application of the gene, two cswrky31 mutants are obtained based on a cucumber Tnt1 reverse transcription transposon mutant library, and the two cswrky31 mutants both show high susceptibility to powdery mildew bacteria. A target gene Csa5G551250 which is directly regulated and controlled by CsWRKY31 is screened by virtue of a high-throughput transcriptome sequencing technology and a DNA affinity purification sequencing technology in combination with a yeast one-hybrid experiment. A dual luciferase report experiment shows that the CsWRKY31 positively regulates and controls the expression of the Csa5G551250, and the overexpression of the Csa5G551250 gene promotes the resistance of the cucumber to powdery mildew bacteria. A new reference gene resource is provided for cultivation of cucumber disease-resistant varieties, and a new thought is provided for molecular mechanism research of transcription factor mediated plant immunity.

Description

Technical Field

[0001] The invention belongs to the field of plant biotechnology, and particularly relates to a gene for regulating cucumber powdery mildew resistance and an application thereof. Background Art

[0002] Cucumber (Cucumis sativus L.) is a major cash crop cultivated in horticultural reserves and plays an indispensable role in the vegetable industry. However, with increasing planting density and continuous cropping, cucumbers are increasingly susceptible to various pathogens, particularly powdery mildew. Powdery mildew in cucumbers is primarily caused by Golovinomyces chicoracearum (formerly Erysiphecichoracearum) and Podosphaera xanthii (formerly Sphaerotheca fuliginea), with P. xanthii being the most common.

[0003] The interaction between cucumber and powdery mildew fungi is strongly influenced by resistance genes. Although previous studies have demonstrated that cucumber resistance to powdery mildew is controlled by multiple resistance loci, these studies have mostly been limited to mapping quantitative trait loci. Currently, only a few resistance genes have been successfully cloned and functionally validated, primarily including powdery mildew resistance genes (CsMLO1, CsMLO8, and CsMLO11), a phosphate transporter gene (CsPHO1; H3), and a leucine-rich repeat (LRR) gene (CsLRR1). Therefore, identifying more powdery mildew resistance-associated genes and revealing their molecular functions and mechanisms of action is crucial for controlling powdery mildew occurrence and increasing cucumber yield. Summary of the Invention

[0004] To solve the above technical problems, the present invention provides a gene for regulating powdery mildew resistance in cucumber and its application. A powdery mildew resistance candidate gene, CsWRKY31 (Cucsa.148640), was screened by RNA-seq. Based on this, further research on the role of CsWRKY31 in powdery mildew resistance in cucumber was carried out to clarify its molecular mechanism, in order to provide a new reference gene resource for the breeding of powdery mildew-resistant cucumber varieties.

[0005] The present invention is achieved by providing a gene for regulating cucumber powdery mildew resistance, which is gene CsWRKY31, and its nucleotide sequence is shown in SEQ ID NO.1.

[0006] A protein encoded by the gene CsWRKY31 regulating powdery mildew resistance in cucumber is provided, and the amino acid sequence of the protein is shown in SEQ ID NO.2.

[0007] A mutant cswrky31 of the gene CsWRKY31 regulating powdery mildew resistance in cucumber is provided. There are two mutant cswrky31, which are respectively from the powdery mildew-resistant cucumber line N9930 and the powdery mildew-susceptible cucumber line 9930.

[0008] Another gene for regulating powdery mildew resistance in cucumber is provided, which is gene Csa5G551250, and its nucleotide sequence is shown in SEQ ID NO.3.

[0009] A protein encoded by the gene Csa5G551250 for regulating cucumber powdery mildew resistance is provided, and the amino acid sequence of the protein is shown in SEQ ID NO.4.

[0010] Provided are recombinant expression vectors and recombinant bacteria for the gene CsWRKY31 and gene Csa5G551250 regulating the powdery mildew resistance of cucumber.

[0011] Provided are applications of the gene CsWRKY31 and gene Csa5G551250 for regulating cucumber powdery mildew resistance, for regulating cucumber resistance to powdery mildew fungi.

[0012] Specifically, the powdery mildew fungus is a biotrophic fungal pathogen with the Latin name Podosphaeraxanthii.

[0013] Provided is an application of the gene CsWRKY31 for regulating cucumber powdery mildew resistance. The CsWRKY31 gene regulates cucumber resistance to powdery mildew by binding to the promoter of the gene Csa5G551250 to promote the expression of the Csa5G551250 gene.

[0014] Compared with the prior art, the advantages of the present invention are:

[0015] This study cloned the transcription factor gene CsWRKY31 and its encoded protein, CsWRKY31, from cucumber. Using a cucumber Tnt1 retrotransposon mutant library, cswrky31 mutants were generated in two backgrounds (N9930, a powdery mildew-resistant cucumber line, and 9930, a powdery mildew-susceptible cucumber line). Functional analysis revealed that cswrky31 mutants in both backgrounds were highly susceptible to powdery mildew. Furthermore, RNA-seq and DAP-seq techniques, combined with yeast one-hybrid assays, identified a target gene, Csa5G551250, directly regulated by CsWRKY31. Dual-luciferase reporter assays demonstrated that CsWRKY31 positively regulates the expression of Csa5G551250. Using an Agrobacterium-mediated transient transformation system in cucumber cotyledons, overexpression of Csa5G551250 promoted resistance to powdery mildew in cucumber. The present invention provides a new reference gene resource for the breeding of disease-resistant cucumber varieties, and also provides a new idea for studying the molecular mechanism of plant immunity mediated by transcription factors. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 (A) is the specific sequence of CsPHO1 in N9930 and 9930 cucumbers; (B) is a schematic diagram of the insertion of Tnt1 retrotransposon into CsWRKY31;

[0017] Figure 2 Phenotypes of cucumber leaves of wild type (WT) and mutant (cswrky31) inoculated with powdery mildew for 7 days;

[0018] Figure 3 Coomassie blue staining of cucumber leaves from two backgrounds, WT and cswrky31, inoculated with powdery mildew fungi for 7 days;

[0019] Figure 4 The Venn diagram shows the overlap between DAP-seq target genes and RNA-seq differentially expressed genes.

[0020] Figure 5 It is a potential target gene of CsWRKY31 in response to powdery mildew;

[0021] Figure 6 For yeast one-hybrid assay, the binding of CsWRKY31 to the Csa5G551250 promoter was detected;

[0022] Figure 7 To analyze the transcriptional regulation of Csa5G551250 by CsWRKY31 for dual-luciferase reporter assay;

[0023] Figure 8 The phenotype of cucumber leaves overexpressing Csa5G551250 after inoculation with powdery mildew for 7 days;

[0024] Figure 9 Coomassie blue staining of cucumber leaves overexpressing Csa5G551250 inoculated with powdery mildew fungi for 7 days. DETAILED DESCRIPTION

[0025] The present invention is further described below through detailed descriptions of embodiments, which are not intended to limit the present invention and are merely illustrative.

[0026] Currently, there are relatively few powdery mildew resistance genes in cucumber that have been successfully cloned and functionally validated, including only a few, such as CsMLO1, CsMLO8, CsMLO11, CsPHO1;H3, and CsLRR1. Therefore, identifying more powdery mildew resistance-related genes and revealing their molecular mechanisms is crucial for controlling powdery mildew occurrence and improving cucumber yield. This application identified a candidate powdery mildew resistance gene, CsWRKY31, through RNA-seq. To further investigate the molecular mechanism of CsWRKY31-mediated powdery mildew resistance, this application analyzed the role of CsWRKY31 in cucumber powdery mildew resistance and its transcriptional regulation of downstream genes. By constructing cswrky31 mutants in two resistance backgrounds, it was demonstrated that CsWRKY31 positively regulates cucumber resistance to powdery mildew. Using RNA-seq and DAP-seq techniques, combined with yeast one-hybrid assays, a target gene, Csa5G551250, directly regulated by CsWRKY31 was identified. Dual-luciferase reporter assays demonstrated that CsWRKY31 positively regulates the expression of Csa5G551250. Furthermore, using an Agrobacterium-mediated transient transformation system in cucumber cotyledons, overexpression of the Csa5G551250 gene enhanced resistance to powdery mildew in cucumber. Therefore, this invention provides new insights into the molecular mechanisms of plant immunity mediated by transcription factors.

[0027] Example 1. Acquisition of experimental samples

[0028] 1. Plant Materials and Growth Conditions

[0029] Cucumber WT and cswrky31 mutants of powdery mildew-resistant and susceptible lines N9930, Xintai spiny cucumber, and Nicotiana benthamiana were used in the present invention. All plants were grown at 25°C under a photoperiod of 16 h (light): 8 h (dark).

[0030] 2. Powdery mildew inoculation

[0031] Powdery mildew fungi were collected from infected cucumber leaves in the greenhouse and purified in the laboratory. The infected leaves were immersed in distilled water to prepare a concentration of 2 x 10 5The suspension containing spores / mL was then evenly sprayed on the true leaves of two-week-old WT and cswrky31 plants and the cotyledons of 9-day-old Xintai Misaki.

[0032] 3. Gene cloning and expression analysis

[0033] The genomic DNA of the samples was extracted using the SteadyPure Plant Genomic DNA Extraction Kit; ® Total RNA was extracted from the sample using the Super Total RNA Extraction Kit; reverse transcription was performed using the EvoM-MLV RT for PCR Kit. Gene-specific primers were used to clone the corresponding sequences, and the PCR reaction procedure was performed according to the Hieff Canace ® Gold High-Fidelity DNA Polymerase" kit. The primers used in the present invention are listed in Table 1.

[0034] Table 1 List of primers used in the present invention

[0035] name Sequence (5'-3') CsWRKY31-GFP-F TTGATACATATGCCCGTCGACATGGTGGATGATGGGGTTTC CsWRKY31-GFP-R GCCCTTGCTCACCATGGATCCCTGTTGGGAGTTGCTACTTGTTT Csa5G551250-GFP-F TTGATACATATGCCCGTCGACATGGCAGATGAAATAGTAGAAAAAG Csa5G551250-GFP-R GCCCTTGCTCACCATGGATCCTTGATCATCAGTTATAGTTTCT pB42AD-CsWRKY31-F GATTATGCCTCTCCCGAATTCATGGTGGATGATGGGGTTTC pB42AD-CsWRKY31-R AGAAGTCCAAAGCTTCTCGAGTTACTGTTGGGAGTTGCTACTTGTTT pLacZ-proCsa5G551250-F TTTGATATTGGATCGGAATTCTCCATTCCTTCTCTCTCTACTTGTG pLacZ-proCsa5G551250-R ATACAGAGCACATGCCTCGAGTTTGGAAATTTTGACATGGTCAT pGreenII 0800-proCsa5G551250-LUC-F GCCCCCCCTCGAGGTCGACTCCATTCCTTCTCTCTCTACTTGTG pGreenII 0800-proCsa5G551250-LUC-R CTCTAGAACTAGTGGATCCTTTGGAAATTTTGACATGGTCAT F ACGTTTACTTGTGGGAACAACTTTCAC R CATGTCCAAAGATCTGTGGGAAGGTTT TF AGTGTTGTAGTGGTCTTTGGAGTATTTACCT

[0036] Example 2: Role of CsWRKY31 in Powdery Mildew Resistance in Cucumber

[0037] Disease resistance was analyzed using the powdery mildew-resistant cucumber line N9930 and the powdery mildew-susceptible cucumber line 9930. The difference in resistance between N9930 and 9930 to powdery mildew in cucumber is caused by a difference in bases at 1966 bp in the CDS region of the CsPHO1 (CsGy5G015960) gene (N9930: C; 9930: G). Figure 1 (A) A homozygous cswrky31 mutant in the 9930 background (9930 / cswrky31) was obtained from the Tnt1 retrotransposon mutant library. 9930 / cswrky31 was crossed with the WT in the N9930 background (N9930 / WT), and the resulting F1 plants were selfed for multiple generations until a homozygous cswrky31 mutant in the N9930 background (N9930 / cswrky31) was obtained. cswrky31 is formed by the Tnt1 retrotransposon insertion into the fourth intron of CsWRKY31. Homozygosity was confirmed using primers TF, F, and R, see [see Figure 1]. Figure 1 (B).

[0038] Two-week-old WT (9930 / WT), 9930 / cswrky31, N9930 / WT, and N9930 / cswrky31 plants under the 9930 background were inoculated with powdery mildew fungi and resistance was assessed 7 days later. The results showed that the powdery mildew lesions on the leaves of both N9930 and cswrky31 plants under the 9930 background were significantly more severe than those of WT plants. Figure 2 Furthermore, Coomassie Brilliant Blue staining showed that the abundance of hyphae in the leaves of cswrky31 plants under both backgrounds was significantly higher than that of WT plants, as shown in Figure 2. Figure 3 The above results indicate that the mutation of CsWRKY31 reduces the defense ability against powdery mildew.

[0039] Example 3. Screening and identification of target genes regulated by CsWRKY31

[0040] To screen for potential target genes regulated by CsWRKY31, RNA-seq analysis was performed using WT and cswrky31 plants in the 9930 background. A total of 35 downregulated differentially expressed genes (DEGs) and 20 upregulated DEGs regulated by CsWRKY31 were obtained. Furthermore, 6636 potential target genes regulated by CsWRKY31 were identified by DAP-seq analysis. Figure 4 Statistical analysis of 20 candidate genes simultaneously identified by RNA-seq and DAP-seq revealed that a salicylic acid-related gene (Csa5G551250) containing a MACPF domain attracted additional attention. Figure 5 Since salicylic acid signaling is an important pathway for plants to resist biotic stress, subsequent studies on this gene were conducted.

[0041] In order to determine whether CsWRKY31 can bind to the promoter of Csa5G551250, a yeast one-hybrid experiment was performed. The CDS of CsWRKY31 was recombined into the pB42AD vector to construct a prey vector. The promoter of Csa5G551250 was inserted into the pLacZ vector to form a bait vector. The prey vector and the pB42AD empty vector were combined with the bait vector and the pLacZ empty vector in pairs, respectively, and then introduced into the EGY48 yeast competent cell and plated on SD / -Trp-Ura medium for culture. After a single yeast colony was grown, it was added dropwise to the SD / -Trp-Ura (containing X-Gal) qualitative culture medium for mutual verification. The results showed that yeast cells containing CsWRKY31 and Csa5G551250 promoters could be visualized blue by X-Gal, while the other three control groups could not display blue, as shown in Figure 2. Figure 6 , indicating that CsWRKY31 can directly bind to the Csa5G551250 promoter.

[0042] Example 4. Regulation of Csa5G551250 Expression by CsWRKY31

[0043] In order to analyze the regulation of Csa5G551250 expression by CsWRKY31, a dual luciferase reporter experiment was performed. The promoter of Csa5G551250 was cloned into pGreenII 0800-LUC as a reporter vector. The CDS of CsWRKY31 was recombined into pRI101-GFP to construct an effector vector. After the effector vector and the reporter vector were transiently co-expressed in tobacco for 3 days, the LUC activity was detected using the "Dual Luciferase Reporter Gene Assay Kit". The co-expression of the pRI101-GFP empty vector and the reporter vector was used as a control. The results showed that CsWRKY31 (but not the GFP empty vector control) significantly promoted the expression of the LUC reporter gene driven by proCsa5G551250, see Figure 7 , In the figure, data are the mean ± SD of three biological replicates for each treatment, and significance was assessed by LSD multiple comparison ( P≤0.01).

[0044] Example 5: Effect of Csa5G551250 on Powdery Mildew Resistance in Cucumber

[0045] The CDS of Csa5G551250 was recombined into pRI101-GFP to construct a transient overexpression vector GFP:Csa5G551250. The vector, along with the empty vector control (GFP:00), was introduced into the cotyledons of 7-day-old Xintai spiny cucumber seedlings via Agrobacterium-mediated transfection. Two days after Agrobacterium infiltration, powdery mildew fungus was inoculated. Seven days after inoculation, disease resistance testing was performed. The results showed that Csa5G551250-overexpressing plants infected with powdery mildew exhibited weaker lesions compared to the control, as shown in Figure 2. Figure 8 At the same time, Coomassie Brilliant Blue staining showed that the abundance of hyphae in the leaves of Csa5G551250 overexpressing plants was significantly lower than that of the control plants. Figure 9 The above results indicate that overexpression of Csa5G551250 improves the defense ability against powdery mildew.

Claims

1. A gene regulating cucumber powdery mildew resistance, characterized in that: The gene is CsWRKY31, and its nucleotide sequence is shown in SEQ ID NO.

1.

2. The protein encoded by the gene regulating cucumber powdery mildew resistance according to claim 1, characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO.

2.

3. The mutant cswrky31 of the gene regulating cucumber powdery mildew resistance according to claim 1, characterized in that: There are two mutants cswrky31, which are respectively from the powdery mildew-resistant cucumber line N9930 and the powdery mildew-susceptible cucumber line 9930.

4. A gene regulating cucumber powdery mildew resistance, characterized in that: It is gene Csa5G551250, and its nucleotide sequence is shown in SEQ ID NO.

3.

5. The protein encoded by the gene regulating cucumber powdery mildew resistance according to claim 4, characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO.

4.

6. The recombinant expression vector and recombinant bacteria of the gene regulating cucumber powdery mildew resistance according to claim 1 or 4.

7. The use of the gene for regulating cucumber powdery mildew resistance according to claim 1 or 4, characterized in that: Used to regulate cucumber's resistance to powdery mildew.

8. The use of the gene for regulating cucumber powdery mildew resistance according to claim 7, characterized in that: The powdery mildew fungus is a biotrophic fungal pathogen, and its Latin name is Podosphaera xanthii.

9. The use of the gene for regulating cucumber powdery mildew resistance according to claim 1, characterized in that: The CsWRKY31 gene regulates the resistance of cucumber to powdery mildew by combining with the Csa5G551250 promoter to promote the expression of the Csa5G551250 gene.

Images