GhIND gene for regulating and controlling flowering and boll cracking time of cotton and application of GhIND gene

Abstract

The invention discloses a GhIND gene for regulating and controlling flowering and boll cracking time of cotton and application of the GhIND gene, and relates to the technical field of biology. The CDS sequence of the GhIND gene is as shown in SEQ ID NO. 2. The method comprises the following steps: counting and analyzing the boll opening rate of a cotton material, screening extreme boll opening morning and evening materials, taking cotton boll shells of the extreme material in different development stages for transcriptome sequencing, excavating a target gene GhIND influencing the development of the cotton boll shells according to the transcriptome sequencing, and exploring the influence of the target gene GhIND on cotton flowering and cotton boll cracking time through a VIGS technology. Results show that by inhibiting expression of the GhIND gene through a gene silencing technology, cotton flowering and cotton boll cracking time can be effectively delayed, so that technical support is provided for precise regulation and control of cotton production.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a GhIND gene for regulating the flowering and boll opening time of cotton and an application thereof. Background Art

[0002] Cotton (Gossypium hirsutum L.) is one of the important natural fiber crops. Boll cracking is a key link in the cotton growth cycle, and its timing directly affects the harvesting efficiency, fiber quality and economic benefits of cotton. Delaying the time of boll cracking helps to improve the efficiency of mechanized harvesting. By regulating the time of boll cracking, more bolls can mature in the same period of time, reducing the need for multiple pickings, reducing labor costs and improving production efficiency. Delaying the time of boll cracking can also reduce natural losses caused by premature cracking, such as fiber contamination or quality degradation caused by rain erosion. In addition, extending the development period of the bolls in the closed state may further improve fiber quality, such as increasing key indicators such as fiber length and strength.

[0003] Traditionally, the timing of cotton boll dehiscence is influenced by both genetic and environmental factors. However, with the advancement of molecular biology techniques, a growing body of research has revealed that specific genes play a crucial regulatory role in this process. In recent years, through genomic and functional genomics studies, scientists have discovered that certain genes play a core regulatory role in cotton boll development and dehiscence. This study aims to provide technical support for the precise regulation of cotton production by identifying key genes that regulate the timing of boll dehiscence. Summary of the Invention

[0004] The present invention aims to provide a GhIND gene for regulating the timing of cotton flowering and boll dehiscence, and its application, to address the aforementioned problems of the prior art. The present invention has discovered that the GhIND gene is a key gene for regulating the timing of cotton flowering and boll dehiscence. By inhibiting GhIND gene expression through gene silencing, the timing of cotton flowering and boll dehiscence can be effectively delayed, thus providing technical support for the precise regulation of cotton production.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides a GhIND gene for regulating the flowering and boll opening time of cotton. The CDS sequence of the GhIND gene is shown in SEQ ID NO.2.

[0007] The present invention also provides a biological material for inhibiting the expression of the GhIND gene. The biological material is a gene silencing vector or a recombinant microbial strain containing the gene silencing vector.

[0008] The present invention also provides the use of the GhIND gene in regulating the budding or flowering time of cotton.

[0009] Furthermore, the budding or flowering time of cotton is delayed by inhibiting the expression of the GhIND gene in cotton plants.

[0010] The present invention also provides the use of the GhIND gene in regulating the dehiscence time of cotton bolls.

[0011] Furthermore, the cotton boll opening time is delayed by inhibiting the expression of the GhIND gene in cotton plants.

[0012] The present invention also provides application of the above-mentioned biological material in delaying the budding or flowering time of cotton.

[0013] The present invention also provides application of the above-mentioned biological material in delaying the opening time of cotton bolls.

[0014] The present invention also provides a method for delaying the budding or flowering time of cotton, comprising the step of inhibiting the expression of the above-mentioned GhIND gene in cotton plants.

[0015] The present invention also provides a method for delaying the dehiscence time of cotton bolls, comprising the step of inhibiting the expression of the above-mentioned GhIND gene in cotton plants.

[0016] The present invention discloses the following technical effects:

[0017] This study statistically analyzed cotton material boll opening rates to screen for materials with extreme boll opening early and late stages. Transcriptome sequencing was then performed on boll hulls from these materials at different developmental stages. This transcriptome sequencing identified the target gene, GhIND, which influences boll hull development. Using VIGS, the gene's influence on flowering and boll opening was investigated. The results showed that inhibiting GhIND expression through gene silencing effectively delayed flowering and boll opening, providing technical support for the precise regulation of cotton production. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0019] Figure 1 For the carrier infographic;

[0020] Figure 2Statistical graph of the expression level of GhIND gene in gene silenced plants and negative control plants;

[0021] Figure 3 The following are analysis diagrams of the phenotype of the first fruit branch node of upland cotton treated with VIGS; A is the observation diagram of the phenotype of the first fruit branch node; B is the statistical diagram of the first fruit branch node; C is the statistical diagram of the height of the first fruit branch node;

[0022] Figure 4 The following are analysis diagrams of budding phenotypes of upland cotton treated with VIGS; A is an observation diagram of budding phenotypes; B is a statistical diagram of budding time;

[0023] Figure 5 The following are analysis diagrams of flowering phenotypes of upland cotton treated with VIGS; A is an observation diagram of flowering phenotypes; B is a statistical diagram of flowering time;

[0024] Figure 6 The following are analysis diagrams of the boll dehiscence phenotype of upland cotton treated with VIGS; A is an observation diagram of the boll dehiscence phenotype; B is a statistical diagram of the boll dehiscence time;

[0025] Figure 7 This is a statistical chart of cotton boll weight;

[0026] Figure 8 These are paraffin sections of cotton bolls at different developmental stages. DETAILED DESCRIPTION

[0027] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0028] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0029] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0030] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.

[0031] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0032] The nucleotide sequence of the GhIND gene involved in the present invention (SEQ ID NO.1) is as follows:

[0033] gcaaaccacttccacaagccattgaggacactttctctctctttcaccaccgaaaagaaaaaccccaaaagctgtttctctcactcactttgatggatatcaatccagcattaaagctccaaacccacacttggaatcttgaaatccccATGGATGACCATATCCTCCATGACCAACTCCCTTTGAACCCTATTTGGCCGAGCTTCCCTCTTCAAACCCCTTTCTCCACCTCAACTACTCCCACCCACCTACCTAGTGCAACACCTGTTTACTCAACTCATCACAACGACCAACTAGGTCACCTTGTTGAAGAGGGGGAAGAACCAGAAGAAGAGTTAAGCGCCATGAAAGAGATGTTGTACAAGATCGCCGCGATGCAGCCCGTCGACATCGACCCTTCCACCATTCGGAAGCCCAAGAGACGCAACGTGCGGATCAGCGACGATCCCCAGAGCGTGGCGGCTCGTCACAGGCGCGAGAGGATAAGCGAAAAGATCAGAATTCTTAAAAGACTTGTCCCGGGAGGCACTAAGATGGACACTGCATCAATGCTGGACGAAGCTATCCGATATGTCAAGTTCTTGAAGCGGCAGATTCTGGAGTTGCAAAGATCCAATGCTAACCAGCAGCCGCCACCACCACCACCACCATACCCTGTGGAGTGGCAAGTTGCACCAAATAAACCTCTGGGTTCCACCTCGGAGACACAAACAGGCCATGGATTCACTTTTGATGCCAACGGGGGAAAACCCCTTGTGCTTTAAtcatgaggtaaatttagtgattaatggcttagctatattcctgaactaatcaacatgtaatttctgtattaatgataatattatta gtgaagactattaaagagggtgtgt ; The underlined sites are the designed sites of the primers for amplifying the target gene; the wavy line indicates the designed site of the gene silencing primer.

[0034] The CDS region (SEQ ID NO.2) is:

[0035] .

[0036] Example 1

[0037] The present invention screens cotton materials with extreme boll-opening early and late stages through statistical analysis of boll-opening rates. Cotton boll husks from these extreme materials at different developmental stages are then subjected to transcriptome sequencing. Based on transcriptome sequencing, the target gene GhIND, which may affect boll husk development, is identified. VIGS technology is then used to explore its effects on the timing of cotton flowering and boll opening.

[0038] 1 Experimental materials and reagents

[0039] 1.1 Experimental Materials

[0040] The test material of the present invention is the upland cotton variety Zhongmian 113. The cotton planting method of Zhongmian 113 variety is as follows:

[0041] Mix nutrient soil and vermiculite in a 1:1 ratio and place it in a seedling cup. Soak until the soil surface is slightly moist. Select complete and plump seeds and plant them 1.5 cm below the soil. Set fixed conditions (light 16h / dark 8h, temperature 25°C, humidity 70%) to grow seedlings in an artificial climate incubator. After 2 weeks, transplant 15 plants of each variety into pots for further growth. Statistical analysis of cotton budding, flowering, and boll cracking characteristics.

[0042] Roots, stems, leaves, sepals, petals, ovaries, boll shells and cotton fibers were sampled in the 1st week, 4th to 5th week and 11th to 17th week of cotton growth, and stored in a -80℃ refrigerator for future use.

[0043] 1.2 Experimental kits and reagents

[0044] The kit used in the present invention is shown in Table 1, and the preparation of the reagents and some reagents is shown in Table 2-Table 3.

[0045] Table 1 Kit

[0046]

[0047]

[0048] Table 2 Reagents

[0049]

[0050] Table 3 Reagent preparation

[0051]

[0052] MMA resuspension (500 mL): 10 mL 0.5 M MES + 5 mL 4 mg / mL AS + 5 mL 1 M MgCl2, and add sterile ddH2O to make up to 500 mL.

[0053] 1.3 Vectors and competent cells

[0054] The pCloneEZ-TOPO cloning vector and DH10B competent E. coli cells were purchased from Sino-US Taihe Biotechnology Co., Ltd. The CLCrV vector VIGS system for gene silencing: Empty Vector (empty vector), pCLCrVB (helper vector), and CLCrV:ChlI (positive control) were donated by Associate Researcher Ma Qifeng from the Genetics and Breeding Laboratory of the Cotton Research Institute of the Chinese Academy of Agricultural Sciences. The vector structure is shown in the figure. Figure 1 As shown; GV3101 Agrobacterium competent cells were purchased from Shanghai Weidi Biotechnology Co., Ltd.

[0055] 2 Experimental methods

[0056] 2.1 Extraction of RNA from Upland Cotton

[0057] Total RNA was extracted using the ABclonal AFTSpin Complex Plant Fast RNA Extraction Kit (catalog number: RK30122) as follows:

[0058] (1) Liquid nitrogen grinding: The plant samples were quickly ground into powder in liquid nitrogen, and an appropriate amount (100–150 mg) was weighed for the experiment;

[0059] (2) Lysis: Add 500 μL of Buffer RL2 preheated at 65°C, add 50 μL of Buffer AB to each tube, vortex for 30-60 seconds, incubate at 65°C in a water bath for 5 minutes, invert several times, and centrifuge the lysate at 13,000 rpm for 10 minutes;

[0060] (3) Adsorption of gDNA and RNA: Collect the supernatant into a 1.5 mL RNase-free centrifuge tube, add 0.5 times the volume of anhydrous ethanol, mix thoroughly by pipetting, add the mixture to the gDNA adsorption column in the collection tube, centrifuge at 13,000 rpm for 2 min, and discard the filtrate;

[0061] (4) RNA elution: Place the gDNA cleanup column in a new 1.5 mL RNase-free centrifuge tube, add 500 μL of lysis buffer RL1, centrifuge at 13,000 rpm for 30 seconds, and collect the filtrate (RNA is in the filtrate);

[0062] (5) Adjust the column environment: add 0.5 times the volume of anhydrous ethanol to the filtrate and mix it with a pipette;

[0063] (6) RNA adsorption: Transfer the entire filtrate to an RNase-free adsorption column in a collection tube, centrifuge at 13,000 rpm for 2 min, and discard the filtrate;

[0064] (7) Washing RNA:

[0065] a. Protein removal: Add 700 μL of protein removal solution PR2 to the adsorption column, let it stand at room temperature for 1 minute, centrifuge at 13000 rpm for 30 seconds, and discard the filtrate;

[0066] b. Removal of salt ions: Add 500 μL of rinsing solution WB2 to the adsorption column, centrifuge at 13000 rpm for 30 seconds, and discard the filtrate;

[0067] c. Repeat b once;

[0068] d. Remove the rinse solution: Centrifuge the empty tube at 13,000 rpm for 2 minutes and discard the filtrate;

[0069] (8) Elution of RNA: Add 30-100 μL of RNase-free ddH2O to the center of the adsorption column, let it stand at room temperature for 2 minutes, and centrifuge at 13,000 rpm for 1 minute (RNA is in the filtrate).

[0070] 2.2 Reverse transcription to obtain cDNA

[0071] The kit used for reverse transcription to obtain cDNA was UnionScript First-strand cDNA Synthesis Mix for qPCR (with dsDNase) from Beijing Jinsha Biotechnology Co., Ltd. The operation steps are as follows:

[0072] Prepare the reaction mixture shown in Table 4 in an RNase-Free centrifuge tube (prepare on ice):

[0073] Table 4 Reverse transcription reaction system

[0074]

[0075] Mix gently by pipetting, centrifuge briefly, and then proceed with the reaction according to the procedure shown in Table 5.

[0076] Table 5 Reverse transcription reaction procedure

[0077]

[0078] 2.3 Real-time quantitative PCR (qRT-PCR)

[0079] Primer-BLAST (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / index.cgi) was used to generate fluorescent quantitative primers for key genes related to cotton boll dehiscence (Table 6). ABclonal fluorescent quantitative kit was used for qRT-PCR detection. For detailed experimental steps, please refer to the instructions. 96 instrument (Rochei, Switzerland). GhACTIN was used as an internal reference gene for normalization of transcription levels. -ΔΔCT The relative expression of each gene was determined using the PCR amplification method. Three technical replicates were performed to ensure accuracy and reliability. Statistical analysis was performed using SPSS 27 software (IBM, Armonk, NY, USA). P values were calculated using the LSD test to assess significance.

[0080] Table 6 Primer sequences

[0081]

[0082]

[0083] 2.4 Target gene fragment amplification and vector construction

[0084] 2.4.1 Amplification primer design

[0085] Primers GhIND-AF / GhIND-AR for amplifying the GhIND gene were designed using Primer-BLAST on the NCBI website, and silencing primers GhIND-F / GhIND-R with restriction endonuclease cleavage sites (Asc I, Spe I) were designed using SnapGene software. The primer sequences are shown in Table 6.

[0086] 2.4.2 Amplification and gel recovery of target fragments

[0087] Use cotton boll hulls from Zhongmian 113 as template and the ABclonal Taq 2×PCR Mix with Dye V2 kit according to the manufacturer's instructions. After the procedure, perform agarose gel electrophoresis to visualize the bands. If the bands are suitable, expand the system and recover the DNA using the Tiangen Agarose Gel DNA Recovery Kit. After testing the DNA concentration and purity, store it at -20°C.

[0088] 2.4.3 Target fragment ligated into cloning vector and transformed into E. coli

[0089] Remove the Sino-US Zero Background Omni TOPO Cloning Kit from the -20°C freezer, remove the vector and place it on ice to thaw. At room temperature (20-30°C), add samples to the PCR tube according to the following system (Table 7):

[0090] Table 7 PCR amplification system

[0091]

[0092] Note: The value of X is calculated based on the specific DNA fragment concentration to ensure the total volume is 10 μL.

[0093] After adding the reagents, mix gently and centrifuge briefly to concentrate the solution at the bottom of the tube. Then, use a PCR instrument to control the temperature at 25°C for 5 minutes.

[0094] After the cloning vector is connected, transform E. coli according to the following steps:

[0095] (1) Add 5 μL of ligation solution to 50 μL of freshly melted DH10B competent cells, mix gently, and incubate on ice for 30 minutes.

[0096] (2) Heat shock in a 42°C water bath for 30 seconds.

[0097] (3) Immediately place on ice and let stand for 2 minutes.

[0098] (4) Add 300 μL of sterile LB liquid medium (without antibiotics) and culture at 37°C with shaking at 200 rpm for 60 min.

[0099] (5) Pipette 150 μL of bacterial solution and smear the plate (Kan + ), and then cultured at 37°C overnight (12-16h).

[0100] (6) Use a toothpick to pick out a single round colony of appropriate size and place it into 5 mL of LB liquid medium (Kan + ) in a test tube and culture at 37°C, 200 rpm, with shaking overnight.

[0101] (7) On the second day, 2 μL of bacterial solution was taken as template and the bacterial solution was tested for PCR.

[0102] 2.4.4 Plasmid extraction

[0103] Plasmid was extracted using ABclonal's AFTSpin Plasmid Mini Kit, and the plasmid solution was stored at -20°C and sent to Shanghai Bioengineering Co., Ltd. for sequencing.

[0104] 2.5 Silencing vector construction and Agrobacterium transformation

[0105] 2.5.1 Amplification of Silencing Fragments and Construction of Silencing Vector (CLCrV:GhIND)

[0106] Using the plasmid successfully sequenced in 2.4.4 as a template, perform PCR amplification using the primers designed in 2.4.1 with added restriction endonuclease sites (Asc I, Spe I). Use NEB's Quick Dicer enzyme according to the instructions to digest the DNA fragment and CLCrV vector separately. After gel recovery, use ABclonal's T4 DNA Ligase (HighConc.) to ligate. Use the method in 2.4.3 to transform Escherichia coli. Identify the bacterial solution by PCR and plasmid double enzyme digestion. Confirm that it is suitable and send it to the company for sequencing.

[0107] 2.5.2 Transformation of Agrobacterium

[0108] (1) Take out GV3101 Agrobacterium competent cells from the -80°C refrigerator, place them on ice, wait for them to thaw, add 0.01-1 μg of the above-sequenced plasmid to 100 μL of competent cells, and mix well;

[0109] (2) Place on ice for 5 min, in liquid nitrogen for 5 min, in a 37°C water bath for 5 min, and then in an ice bath for 5 min;

[0110] (3) Add 700 μL of LB liquid medium without antibiotics to the centrifuge tube and place it in a shaker at 28°C, 220 rpm, and culture for 2 h;

[0111] (4) Take 100 μL of bacterial solution and plate (Kan + , Rif), placed in a biochemical incubator and cultured at 28°C for 2 days;

[0112] (5) After the culture was completed, single colonies were picked and placed in 5 mL of LB liquid medium (Kan + , Rif) in a test tube and placed in a shaker at 28°C, 2200 rpm, and culture for 16 h;

[0113] (6) After the culture is completed, perform PCR on the bacterial solution to confirm that the vector is positive, and preserve the bacteria with pre-sterilized 50% glycerol at a ratio of 1:1 and store at -80℃ for later use.

[0114] 2.6 Agrobacterium-mediated VIGS in upland cotton

[0115] The Agrobacterium culture obtained in 2.5.2 was activated in LB medium at a 1:10 ratio, then expanded and cultured at the same ratio. The culture was placed in a 50 mL centrifuge tube and centrifuged at 5000 rpm for 10 minutes. The cells were harvested and resuspended in the prepared resuspension buffer. After 3 hours of stagnation, the CLCrV:ChlI, empty vector, and CLCrV:GhIND strains were mixed with the helper bacteria at a 1:1 ratio. Finally, the mixed culture was injected onto the abaxial surface of the cotyledons of 7-day-old cotton plants to generate gene-silenced cotton plants, as well as negative (empty vector) and positive (CLCrV:ChlI) control plants. Before culturing under standard conditions, the cotton plants were incubated in the dark for 24 hours. Successful target gene silencing was confirmed when the leaves of the positive control plants turned yellow. These seedlings were then transplanted into pots for further culture. Young boll husks were sampled from the gene-silenced plants for subsequent qRT-PCR analysis of the expression level of the GhIND gene, a key gene for dehiscence.

[0116] 2.7 Cytological Observation

[0117] Method for making paraffin sections:

[0118] Tissue samples were collected from the dorsal suture of the boll shell at 0, 5, 10, 15, 20, and 25 days post-anthesis (DPA). The tissues were trimmed to approximately 3 mm in width and stored in FAA fixative (50% FAA fixative for young tissue at 0 and 5 DPA, and 70% FAA fixative for older tissue at 10, 15, 20, and 25 DPA). A portion of fresh tissue was also stored at -80°C. After fixation for at least 24 hours, the tissues were dehydrated with a gradient of alcohol and then immersed in wax. The wax-soaked tissues were then embedded in an embedding machine. The trimmed wax blocks were sliced on a paraffin microtome to produce 4 μm sections. The sections were flattened with 40°C warm water on the microtome, removed, and oven-dried at 60°C. The sections were stained with safranin and plant fast green, respectively, and then mounted with neutral gum. Sections were observed using a Nikon Eclipse E100 microscope (Nikon, Japan), and images were acquired using a Nikon DS-U3 imaging system.

[0119] 3 Results and Analysis

[0120] 3.1 Expression analysis of target genes in silenced cotton bolls

[0121] The present invention studied the expression changes of GhIND in gene silenced plants and negative control plants. The results showed that the expression level of the gene in the negative control plants was significantly higher than that in the silenced plants ( Figure 2 ).

[0122] 3.2 Phenotypic analysis of the target gene GhIND

[0123] To explore the function of GhIND, we used VIGS technology to introduce the recombinant viral vector CLCrV:GhIND inserted with the target gene fragment into plants through Agrobacterium infection, inhibiting the expression of the plant endogenous gene GhIND. The related phenotypic traits were statistically analyzed. The plants introduced with the CLCrV:GhIND recombinant vector were silenced plants, and the plants introduced with the empty vector were negative controls.

[0124] 3.3 Phenotypic analysis of the first fruiting branch node

[0125] The first fruiting branch node is the first node of the cotton plant fruiting branch, that is, the first fruiting branch position from bottom to top after the cotton buds appear. The height of the first fruiting branch node refers to the distance between the first fruiting branch node and the cotyledon node ( Figure 3 In the middle (A), the appearance of the first fruiting branch node marks the beginning of reproductive growth. Figure 3 In B), the negative control was 6.36 nodes, and the silenced plant was 6.64 nodes, with no significant difference between the two. Figure 3In middle C), the negative control is 13.93 cm, and the silenced plant is 16.21 cm. The silenced plant is significantly higher than the negative control by 2.28 cm.

[0126] 3.4 Analysis of budding and flowering phenotypes

[0127] Observation of the budding phenotype of upland cotton plants treated with VIGS ( Figure 4 Middle A), statistical analysis of the time of the first bud appearing ( Figure 4 In the middle (B), the budding time of the negative control was 44.5 days, and the budding time of the silenced plant was 46.86 days. The budding time of the silenced plant was significantly later than that of the negative control by 2.4 days. Figure 5 ), the flowering time of the negative control was 63.9 days, and the flowering time of the silenced plants was 71 days, which was significantly later than the negative control by 7.1 days. The results showed that silencing GhIND can delay budding and flowering in cotton.

[0128] 3.5 Analysis of cotton boll dehiscence phenotype

[0129] Further observation of the boll dehiscence phenotype ( Figure 6 ) and counted the time from sowing to the first boll opening. The boll opening time of the negative control was 109.6 days, while that of the silenced plants was 116.4 days. The boll opening time of the silenced plants was significantly later than that of the negative control by 6.8 days. The results showed that silencing the GhIND gene can delay the opening of cotton bolls.

[0130] The bolls of the silenced plants and the negative control plants were weighed respectively. The results showed that the weight of the bolls of the silenced plants was higher than that of the negative control ( Figure 7 ). It was concluded that there was no abnormality in the fiber and seed development of dehiscent bolls in silent plants.

[0131] 3.6 Cytological Observation

[0132] Paraffin sections were made from cotton bolls of silenced plants and negative controls at different developmental stages (0, 3, 5, 10, and 15 DPA) for cytological observation. Figure 8 As shown. At 3 days post-fertilization (DPA), lignified cells stained red by safranin were clearly observed. Overall observation at 3, 5, 10, and 15 days post-fertilization (DPA) revealed that the lignified area in the negative control was larger than that in the silenced plant. Lignified cells located in the endocarp between the dehiscence zone and the valve facilitated fruit dehiscence. At 15 days post-fertilization (DPA), observation of the cellular structure of the dehiscence zones in the silenced plant revealed that the dehiscence zone was narrower and contained abnormally elongated cells, rather than the normal, tightly packed, square cells. Therefore, GhIND is likely involved in the development of the dorsal suture dehiscence zone in the middle and late stages of the boll, leading to abnormal dehiscence in the silenced plant.

[0133] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A GhIND gene that regulates the timing of cotton flowering and boll opening, characterized in that: The CDS sequence of the GhIND gene is shown in SEQ ID NO.

2.

2. A biomaterial for inhibiting the expression of the GhIND gene according to claim 1, characterized in that: The biological material is a gene silencing vector or a recombinant microbial strain containing the gene silencing vector.

3. Use of the GhIND gene according to claim 1 in regulating the budding or flowering time of cotton.

4. The use according to claim 3, characterized in that The budding or flowering time of cotton is delayed by inhibiting the expression of the GhIND gene in cotton plants.

5. Use of the GhIND gene according to claim 1 in regulating the time of cotton boll dehiscence.

6. The use according to claim 5, characterized in that The cotton boll opening time is delayed by inhibiting the expression of the GhIND gene in cotton plants.

7. Use of the biomaterial according to claim 2 in delaying the budding or flowering time of cotton.

8. Use of the biomaterial according to claim 2 in delaying the opening time of cotton bolls.

9. A method for delaying the budding or flowering time of cotton, characterized in that: The method comprises the step of inhibiting the expression of the GhIND gene according to claim 1 in cotton plants.

10. A method for delaying the opening time of cotton bolls, characterized in that: The method comprises the step of inhibiting the expression of the GhIND gene according to claim 1 in cotton plants.

Images