Optimized insecticidal crystal protein Cry1Ab gene as well as related biological material and application thereof

Abstract

The invention discloses an optimized insecticidal crystal protein Cry1Ab gene as well as a related biological material and application thereof, and belongs to the technical field of genetic engineering. The technical problem to be solved by the invention is how to improve the expression quantity of coding genes of Bt protein in a receptor plant and / or improve the content of the Bt protein. To this end, the present invention provides a CryV4-Os gene having a nucleotide sequence comprising SEQ ID NO: 4 or / and a CryV4-Zm gene having a nucleotide sequence comprising SEQ ID NO: 5. The relative expression quantity of the optimized gene obtained by systematically optimizing the Bt protein coding gene through an independently developed codon optimization system in a receptor plant and the content of the coded Bt protein are obviously higher than those of a general optimization method, and an unexpected technical effect is achieved. The method has important application potential and popularization value in the field of Bt insect-resistant breeding of crops such as rice and corn.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and in particular relates to an optimized insecticidal crystal protein Cry1Ab gene and related biological materials and applications thereof. Background Art

[0002] Research has shown that Bt rice offers high resistance to pests such as the Chilo suppressalis and the rice leaf roller, reducing pesticide use by over 70%. Safety assessments have shown that Bt rice has no significant long-term effects on rhizosphere bacterial communities, with differential bacterial communities varying from year to year and not accumulating. The complexity and density of the rhizosphere network are comparable to those of non-Bt varieties, providing scientific support for its commercialization. Studies have shown that transgenic Bt corn achieves a 61.9%–97.3% control of lepidopteran pests such as the fall armyworm and corn borer. While reducing the use of chemical pesticides, Bt corn also reduces yield losses by 16.4%–21.3% and toxin levels by 85.5%–95.59%. Bt corn significantly reduces pesticide use and enhances food security. Current research shows no significant negative effects on the complexity and density of rhizosphere microbiota, demonstrating its high safety profile.

[0003] Bt proteins (such as Cry1Ab and Cry1Ac) bind to specific receptors on the midgut epithelial cells of pests, destroying the intestinal structure and causing the death of the pests. The higher the expression level, the higher the concentration of Bt protein per unit tissue, and the more significant the lethal effect on target pests (such as Lepidoptera larvae). For example, in corn, the DBN9936 variety significantly increased the expression level of Cry1Ab protein by optimizing the promoter (such as the strong pFMV promoter) and gene codon preference, and achieved a control effect of over 95% on Asian corn borer. At the same time, pest lethality requires Bt protein to reach a certain threshold concentration. If the expression level is insufficient, the pest may only suffer sublethal damage (such as delayed growth rather than death), which will accelerate the selection of resistant genotypes.

[0004] Currently, the main technical approaches to increasing expression include the following: ① Promoter optimization: Using strong constitutive promoters (such as CaMV 35S) or tissue-specific promoters (such as the green tissue-specific promoter) can enhance Bt gene expression in key locations (such as leaves and stems). For example, the green tissue-specific promoter rbcS is used in rice to efficiently express Cry proteins in leaves while reducing unnecessary accumulation in grains, thereby alleviating food safety concerns. ② Gene stacking and multivalent expression: Stacking multiple Bt genes (such as Cry1Ac + Cry2Ab) or with non-Bt insect-resistant genes (such as the cowpea trypsin inhibitor CpTI) can both increase total protein concentration and delay the development of pest resistance. ③ Post-translational modification optimization: Adjusting gene codon usage bias (codon frequency adapted to the host plant) or introducing an endoplasmic reticulum-localized signal peptide can improve the translation efficiency and stability of Bt proteins.

[0005] In organisms, 61 codons encode 20 amino acids. Each amino acid can be expressed by one or more different codons, a phenomenon known as codon degeneracy (Li Ying et al., 2016). For example, arginine, serine, and leucine are each encoded by six codons. Different codons encoding the same amino acid are called synonymous codons, and their frequencies of use during translation vary. This phenomenon is known as codon bias (Li Ying et al., 2016). Genes from different species exhibit distinct codon usage preferences. Even within the same species, genes with different functions, or within the same gene at different developmental stages, tissues, and organs, exhibit significant differences in codon usage frequency, which is positively correlated with intracellular aminoacyl-tRNA levels (Dana, A. & Tuller, T., 2014). Codon bias has profound and complex implications for the translation and efficient expression of heterologous genes across species (Gustafsson C, et al., 2004). For example, if Cry proteins from the prokaryotic bacillus thuringiensis and other heterologous proteins are directly transferred into plants without modification, their expression levels will be significantly reduced (Perlak FJ, et al., 1991). Therefore, codon optimization is a very effective method for efficient expression of foreign genes in heterologous expression systems (Quax and Claassens et al., 2015). Current analysis methods generally use the online software Codon Usage Database (http: / / www.kazusa.or.jp / codon / ) to obtain the codon usage frequency of the host genome. Alternatively, a suitable number of highly expressed genes in the host are selected, the coding region (CDS) sequences corresponding to each gene are extracted, and these CDS sequences are concatenated end-to-end to form a large sequence. The codon usage frequency of each gene is then counted using the online website (http: / / www.geneinfinity.org / sms / sms_codonusage.html), the relative frequency of synonymous codon usage (RSCU) is calculated, and the preference for synonymous codon usage is analyzed to prepare a codon usage table for the host genome. Then, referencing this table, optimize the rare codons in the transformed target gene (Pere Puigbò, et al., 2007). It should be noted that the host genome codon usage frequency obtained using the above method is obtained by calculating the ratio of the total number of a particular codon in the host genome (DNA) library (or in a moderate number of highly expressed genes) to the total number of codons in the genome (or in all moderately expressed genes). This calculation does not take into account the impact of gene expression abundance on codon usage frequency and cannot truly reflect codon usage frequency.However, for individual genes, their expression levels vary significantly in different developmental stages, tissues, and organs of the same species (Nakamura A., 2006). Summary of the Invention

[0006] The technical problem to be solved by the present invention is: how to increase the expression level of the gene encoding the Bt protein (Bacillus thuringiensis δ-endotoxin insecticidal crystal protein) in the recipient plant and / or increase the content of the Bt protein.

[0007] In order to solve this technical problem, the present invention provides the following technical solutions:

[0008] A DNA molecule, wherein the DNA molecule is a codon-optimized Bt protein encoding gene, wherein the encoding gene is a CryV4-Os gene and / or a CryV4-Zm gene, and the CryV4-Os gene is at least one of the following:

[0009] a1) a DNA molecule whose nucleotide sequence comprises SEQ ID NO: 4;

[0010] a2) a DNA molecule that has a nucleotide sequence identity of more than 70% with the nucleotide sequence shown in a1) and encodes the Bt protein;

[0011] The CryV4-Zm gene is at least one of the following:

[0012] b1) a DNA molecule whose nucleotide sequence comprises SEQ ID NO: 5;

[0013] b2) A DNA molecule that has a nucleotide sequence identity of more than 70% with that shown in b1) and encodes the Bt protein.

[0014] Furthermore, the DNA molecule described in a1) may be a DNA molecule having a nucleotide sequence of SEQ ID NO: 4.

[0015] Furthermore, the DNA molecule described in a2) does not include a DNA molecule whose nucleotide sequence is SEQ ID NO: 2.

[0016] Furthermore, the DNA molecule described in b1) may be a DNA molecule having a nucleotide sequence of SEQ ID NO: 5.

[0017] Furthermore, the DNA molecule described in b2) does not include a DNA molecule having a nucleotide sequence of SEQ ID NO: 3.

[0018] In the present invention, the amino acid sequence of the Bt protein is shown in the reference sequence number GenBank: AAG16877.1 (01-OCT-2000) from position 1 to position 615.

[0019] The present invention also provides a biological material related to the DNA molecule, wherein the biological material is selected from at least one of the following:

[0020] A1) an expression cassette and / or construct containing the DNA molecule;

[0021] A2) a recombinant vector containing the DNA molecule and / or a recombinant vector containing the expression cassette and / or construct described in A1);

[0022] A3) a recombinant microorganism containing the DNA molecule, a recombinant microorganism containing the expression cassette and / or construct described in A1), and / or a recombinant microorganism containing the recombinant vector described in A2);

[0023] A4) a recombinant cell line containing the DNA molecule, a recombinant cell line containing the expression cassette and / or construct described in A1) and / or a recombinant cell line containing the recombinant vector described in A2);

[0024] A5) transgenic plant cells containing the DNA molecule, transgenic plant cells containing the expression cassette and / or construct described in A1) and / or transgenic plant cells containing the recombinant vector described in A2);

[0025] A6) transgenic plant tissue containing the DNA molecule, transgenic plant tissue containing the expression cassette and / or construct described in A1), and / or transgenic plant tissue containing the recombinant vector described in A2);

[0026] A7) A transgenic plant organ containing the DNA molecule, a transgenic plant organ containing the expression cassette and / or construct described in A1) and / or a transgenic plant organ containing the recombinant vector described in A2).

[0027] Furthermore, the expression cassette refers to a DNA capable of expressing the coding gene in a host cell, and the DNA may include not only a promoter for initiating transcription of the coding gene, but also a terminator and / or enhancer sequence for terminating transcription of the coding gene.

[0028] The vectors described herein are well known to those skilled in the art, including but not limited to plasmids, phages (such as lambda phage or M13 filamentous phage), cosmids (ie, cosmids), Ti plasmids or viral vectors.

[0029] Existing plant expression vectors can be used to construct a recombinant expression vector containing the encoding gene. Such plant expression vectors include, but are not limited to, binary Agrobacterium vectors and vectors that can be used for plant microprojectile bombardment. The plant expression vector may also contain the 3' untranslated region of the foreign gene, i.e., a polyadenylation signal and any other DNA fragments involved in mRNA processing or gene expression. The polyadenylation signal can guide the addition of polyadenylic acid to the 3' end of the mRNA precursor. Examples include, but are not limited to, Agrobacterium crown gall-inducing (Ti) plasmid genes (such as the rouge synthase Nos gene) and the 3' transcribed untranslated region of plant genes (such as the soybean storage protein gene), all of which have similar functions.

[0030] When using the coding gene to construct a recombinant plant expression vector, any enhancing promoter or constitutive promoter can be added before its transcription initiation nucleotide, including but not limited to cauliflower mosaic virus (CAMV) 35S promoter, corn ubiquitin promoter (ubiquitin), which can be used alone or in combination with other plant promoters; In addition, when using the gene construction plant expression vector of the present invention, enhancers can also be used, including translation enhancers or transcription enhancers, and these enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be identical to the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The source of the translation control signal and the start codon is extensive, and can be natural or synthetic. The translation initiation region can be from a transcription initiation region or a structural gene.

[0031] To facilitate identification and screening of transgenic plant cells or plants, the plant expression vectors used can be modified to include, but are not limited to, genes encoding enzymes or luminescent compounds that can be expressed in plants (such as the GUS gene or luciferase gene), antibiotic resistance markers (such as gentamicin and kanamycin), or chemical resistance marker genes (such as herbicide resistance genes). For safety reasons, it is possible to omit any selectable marker genes and directly screen for transformed plants using stress.

[0032] By introducing the coding gene or a fragment of the coding gene provided by the present invention into plant cells or recipient plants using any vector capable of directing exogenous gene expression in plants, transgenic cell lines and transgenic plants with increased expression and / or content of the Bt protein coding gene can be obtained. The expression vector carrying the coding gene can be transformed into plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, and Agrobacterium-mediated transfection, and the transformed plant tissues can be cultivated into plants.

[0033] In some embodiments of the present invention, the vector may be a pUC19 vector and / or a pCNDL vector. Rice transient expression vectors pUC19-CryV2-Os and pUC19-CryV4-Os, maize transient expression vectors pUC19-CryV2-Zm and pUC19-CryV4-Zm, and rice stable expression vectors pCNDL-CryV2-Os and pCNDL-CryV4-Os were obtained, respectively.

[0034] Furthermore, in the aforementioned applications, the recombinant microorganism may specifically be yeast, bacteria, algae, and fungi. The bacteria may be from the genera Escherichia, Erwinia, Agrobacterium, Flavobacterium, Alcaligenes, Pseudomonas, and / or Bacillus. More specifically, the recombinant microorganism may be Agrobacterium tumefaciens EHA105 and / or Escherichia coli competent cells TOP10.

[0035] Furthermore, the plant tissue may be derived from roots, stems, leaves, flowers, fruits, seeds, pollen, embryos and anthers.

[0036] Furthermore, the transgenic plant organs may be roots, stems, leaves, flowers, fruits and seeds of transgenic plants.

[0037] Furthermore, the transgenic plant cell lines, transgenic plant tissues and transgenic plant organs may or may not include propagation materials.

[0038] The present invention also provides the use of the encoding gene and / or the biological material in at least one of the following:

[0039] B1) Application in increasing the expression of genes encoding Bt proteins in recipient plants;

[0040] B2) Use in the preparation of a product for increasing the expression level of a gene encoding a Bt protein in a recipient plant;

[0041] B3) Application in increasing the content of Bt protein in recipient plants;

[0042] B4) Use in the preparation of products for increasing the content of Bt protein in recipient plants;

[0043] B5) Application in improving insect resistance of recipient plants;

[0044] B6) Use in the preparation of products that improve insect resistance of recipient plants;

[0045] B7) Application in the production (preparation) of Bt protein;

[0046] B8) Use in the preparation of products for producing Bt protein;

[0047] B9) Application in plant breeding;

[0048] B10) Use in the preparation of a plant breeding product.

[0049] The plant breeding assessment index may include the expression level of the gene encoding the Bt protein, the content of the Bt protein and / or insect resistance.

[0050] The purpose of plant breeding may include cultivating target plants with improved expression of Bt protein encoding genes, Bt protein content and / or insect resistance.

[0051] Furthermore, the recipient plant is rice and / or corn.

[0052] The present invention also provides a method for preparing Bt protein, which comprises expressing the CryV4-Os gene and / or CryV4-Zm gene in biological cells to obtain the Bt protein.

[0053] The organism may be a microorganism, a plant or a non-human animal.

[0054] The present invention also provides a method for increasing the expression level of the gene encoding the Bt protein in the recipient rice, increasing the Bt protein content of the recipient rice and / or improving the insect resistance of the recipient rice, characterized in that: the method comprises introducing the CryV4-Os gene into the recipient rice to increase the expression level of the gene encoding the Bt protein in the recipient rice, increasing the Bt protein content of the recipient rice and / or improving the insect resistance of the recipient rice.

[0055] In the present invention, in the method or use of increasing the expression level of a gene encoding a Bt protein in a recipient rice plant, increasing the Bt protein content in the recipient rice plant, and / or improving the insect resistance of the recipient rice plant (hereinafter referred to as the method or use of the present invention), the increase is a comparison performed under comparable conditions. In one embodiment of the present invention, the comparable conditions are identical except that the CryV4-Os gene introduced into the recipient rice plant in the method of the present invention is replaced with the CryV2-Os gene. The coding sequence (CDS) of the CryV2-Os gene is shown in SEQ ID NO: 2.

[0056] The present invention also provides a method for increasing the expression level of the gene encoding the Bt protein of the recipient corn, increasing the Bt protein content of the recipient corn and / or improving the insect resistance of the recipient corn, characterized in that: the method includes introducing the CryV4-Zm gene into the recipient corn to increase the expression level of the gene encoding the Bt protein of the recipient corn, increase the Bt protein content of the recipient corn and / or improve the insect resistance of the recipient corn.

[0057] In the present invention, in the method or use of increasing the expression level of a gene encoding a Bt protein in recipient corn, increasing the Bt protein content in recipient corn, and / or improving insect resistance in recipient corn (hereinafter referred to as the method or use of the present invention), the increase is a comparison performed under comparable conditions. In one embodiment of the present invention, the comparable conditions are identical except that the CryV4-Zm gene introduced into the recipient corn in the method of the present invention is replaced with the CryV2-Zm gene. The coding sequence (CDS) of the CryV2-Zm gene is shown in SEQ ID NO: 3.

[0058] The present invention also provides a method for preparing target rice, which comprises introducing the CryV4-Os gene into a recipient rice to obtain the target rice, wherein the target rice has higher insect resistance than the recipient rice.

[0059] The present invention also provides a method for preparing target rice with improved insect resistance, the method comprising at least one of the following:

[0060] C1) The method comprises introducing the CryV4-Os gene into a recipient rice to obtain the target rice;

[0061] C2) genetic breeding is carried out using the target rice described in C1) as a parent.

[0062] In the present invention, the genetic breeding methods include but are not limited to: hybrid breeding, self-pollination breeding, asexual breeding, etc.

[0063] In the present invention, the hybrid breeding methods include but are not limited to: single hybridization, composite hybridization, backcrossing, etc.

[0064] The present invention also provides a method for preparing target corn, which comprises introducing the CryV4-Zm gene into a recipient corn to obtain the target corn, wherein the target corn has higher insect resistance than the recipient corn.

[0065] The present invention also provides a method for preparing corn with improved insect resistance, the method comprising at least one of the following:

[0066] D1) The method comprises introducing the CryV4-Zm gene into a recipient corn to obtain the target corn;

[0067] D2) genetic breeding is carried out using the target corn described in D1) as a parent.

[0068] In the present invention, the insect resistance may specifically be resistance to Lepidoptera, Diptera or Coleoptera insects.

[0069] Furthermore, the insect resistance may be resistance to lepidopteran, dipteran or coleopteran insect larvae.

[0070] Furthermore, the insects include but are not limited to corn borers, corn rootworms, rice stem borers, rice leaf rollers, striped stem borers, and yellow stem borers.

[0071] In the present invention, the CryV4-Os gene and / or the CryV4-Zm gene are introduced into the callus tissue of the recipient rice and / or the recipient maize in the form of a recombinant vector. Furthermore, the recombinant vector can be introduced into the callus tissue of the recipient rice and / or the recipient maize via Agrobacterium-mediated introduction.

[0072] The beneficial technical effects achieved by the present invention are as follows:

[0073] This invention utilizes a proprietary codon optimization system to systematically optimize Bt protein-encoding genes. The resulting optimized genes significantly increase the relative expression levels and encoded Bt protein content in recipient plants compared to conventional optimization methods, achieving unexpected technical results. This approach has significant application potential and promotional value in the field of Bt insect-resistant breeding for crops such as rice and corn. BRIEF DESCRIPTION OF THE DRAWINGS

[0074] Figure 1 Schematic diagram of the structure of transient expression vector pUC19-CryV4-Os;

[0075] Figure 2 Schematic diagram of the structure of transient expression vector pUC19-CryV4-Zm;

[0076] Figure 3 Schematic diagram of the structure of the plant expression vector pCNDL-CryV4-Os;

[0077] Figure 4 PCR detection of some T0 generation transgenic rice with CryV4-Os gene;

[0078] Figure 5 To detect mRNA and protein expression levels in transiently transformed protoplasts;

[0079] Figure 6 To detect the mRNA and protein expression levels of transgenic rice. DETAILED DESCRIPTION

[0080] Terms used in this invention:

[0081] Examples of resources describing many of the molecular biology-related terms used herein can be found in Alberts et al., Molecular Biology of The Cell, 5th ed., Garland Science Publishing, Inc.: New York, 2007; Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed., Springer-Verlag: New York, 1991; King et al., A Dictionary of Genetics, 6th ed., Oxford University Press: New York, 2002; and Lewin, Genes IX, Oxford University Press: New York, 2007.

[0082] Any references cited herein, including, for example, all patents, published patent applications, and non-patent publications, are hereby incorporated by reference in their entirety.

[0083] To facilitate understanding of the present invention, several terms and abbreviations used herein are defined as follows:

[0084] "Gene" refers to a nucleic acid fragment that encodes all or part of a specific protein and includes regulatory sequences preceding (5' non-coding region) and following (3' non-coding region) the coding region.

[0085] "Transformation" refers to the process of introducing exogenous nucleic acid into a host cell or organism, including Agrobacterium-mediated transformation and gene gun techniques.

[0086] "Transgenic" refers to a gene that is stably integrated into a host organism by introducing a homologous gene in the normal host organism or an exogenous artificially synthesized and modified gene through gene transfer. In the present invention, "transgenic" refers to the "target gene".

[0087] A "codon" is a set of three consecutive bases in the reading frame of a messenger RNA chain that determines the location of an amino acid. This is also known as a triplet code. The fact that the same amino acid can be encoded by different codons is called "codon degeneracy."

[0088] "Codon preference" refers to the fact that due to the degeneracy of codons, each amino acid is represented by at least one codon and up to six corresponding codons. Genetic codon usage varies significantly between species and organisms. Various organisms appear to prefer certain synonymous triplet codons. Codons that are frequently used in a species are referred to as its "preferred codons," while codons that are less frequently used are referred to as its "rare codons." In the present invention, codons with an RSCU < 0.8 are defined as "rare codons."

[0089] In the present invention, "identity" refers to the identity of an amino acid sequence or a nucleotide sequence. The identity of an amino acid sequence (or nucleotide sequence) can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, a search can be performed using blastp as the program, setting the Expect value to 10, all filters to OFF, BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values), respectively. The identity of a pair of amino acid sequences can be calculated and the identity value (%) can be obtained.

[0090] Specifically, the consistency of 70% or more may be 75% or more. Specifically, the consistency of 75% or more may be 80% or more. Specifically, the consistency of 80% or more may be 85% or more. Specifically, the consistency of 85% or more may be 90% or more. Specifically, the consistency of 90% or more may be 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more. More specifically, the 70% or greater identity may be at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity. More specifically, the 80% or greater identity may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity.

[0091] When used in a list of two or more items, the term "and / or" means that any of the listed items can be used alone or in combination with any one or more of the listed items. For example, the expression "A and / or B" is intended to mean either or both of A and B, i.e., A alone, B alone, or a combination of A and B. The expression "A, B, and / or C" means A alone, B alone, C alone, a combination of A and B, a combination of A and C, a combination of B and C, or a combination of A, B, and C.

[0092] As used herein, "plant" includes an explant, plant part, seedling, plantlet or whole plant at any stage of regeneration or development.

[0093] As used herein, "plant part" can refer to any organ or intact tissue of a plant, such as meristem, bud organ / structure (e.g., leaf, stem, or node), root, flower or flower organ / structure (e.g., flower, bract, sepal, petal, stamen, carpel, anther, and ovule), seed (e.g., embryo, endosperm, and seed coat), fruit (e.g., mature ovary), propagule, or other plant tissue (e.g., vascular tissue, dermal tissue, ground tissue, etc.), or any part thereof. The plant part of the present invention can be viable, non-viable, regenerable, and / or non-regenerable. "Propaganda" can include any plant part that can grow into a whole plant.

[0094] A plant cell is a biological cell of a plant that is taken from a plant or derived from a culture obtained by culturing cells taken from a plant. As used herein, a "transgenic plant cell" refers to any plant cell transformed with a stably integrated recombinant DNA molecule, construct, expression cassette, or sequence. Transgenic plant cells can include the original transformed plant cell, a transgenic plant cell regenerated or developed from an R0 generation transgenic plant cell, a transgenic plant cell cultured from another transgenic plant cell, or a transgenic plant cell from any progeny or subsequent generation of a transformed R0 generation plant, including cells from plant seeds or embryos, or cultured plant cells, callus cells, and the like.

[0095] As generally understood in the art, the term "promoter" generally refers to a DNA that contains an RNA polymerase binding site, a transcription start site, and / or a TATA box and assists or promotes transcription of a transcribable DNA. Promoters can be produced by artificial synthesis, altered, or derived from known or naturally occurring promoters. Promoters can also include chimeric promoters comprising a combination of two or more heterologous sequences. Therefore, promoters of the present invention can include variants of promoter sequences that are similar in composition to, but not identical to, other promoter sequences provided herein.

[0096] Promoter can be classified according to the multiple standards relevant to the expression pattern of the relevant coding or transcribable sequence or gene (including transgenic) that is operably connected to the promoter, for example, the promoter that drives expression in all or most tissues of plant such as constitutive, developmental, tissue-specific, inducible etc. is called " constitutive " promoter. The promoter that drives expression in certain period or stage of development is called " developmental " promoter. Relative to other plant tissues, the promoter that drives enhanced expression in certain tissues of plant is called " tissue-enhanced " or " tissue-preferred " promoter. Therefore, " tissue-preferred " promoter causes relatively high or preferential expression in the specific tissue of plant, but expression level is lower in other tissues of plant. The promoter that expresses in the specific tissue of plant and seldom or does not express in other plant tissues is called " tissue-specific " promoter. " Inducible " promoter is the promoter that starts transcription in response to environmental stimulus (such as cold, drought or light) or other stimulus (such as being injured or chemically applied). Promoter can also be classified according to its source, such as heterologous, homologous, chimeric, synthetic etc.

[0097] The term "transcribable DNA" refers to DNA that can be transcribed into an RNA molecule.

[0098] The term "operably linked" may refer to a functional connection between a promoter and transcribable DNA, such that the promoter functions to initiate transcription of the transcribable DNA. The term "operably linked" may also refer to a functional connection between other regulatory elements and a gene of interest to regulate the transcription and / or expression of the gene of interest.

[0099] The term "construct" refers to any recombinant DNA molecule or recombinant RNA molecule. A recombinant DNA molecule can be a plasmid, a cosmid, a virus, a phage, or a linear or circular DNA. A construct typically includes one or more expression cassettes.

[0100] As used herein, "expression cassette" refers to DNA capable of expressing the proteins described above in a host cell. The expression cassette may also include a single-stranded or double-stranded nucleic acid molecule containing all regulatory sequences necessary to express any of the aforementioned proteins. The regulatory sequences are capable of directing the expression of at least one of the aforementioned proteins from the coding sequence in a suitable host cell under compatible conditions. The regulatory sequences include, but are not limited to, a leader sequence, a polyadenylation sequence, a propeptide sequence, a promoter, a signal sequence, and a transcription terminator. At a minimum, the regulatory sequences include a promoter and termination signals for transcription and translation. The regulatory sequences may be provided with linkers to introduce specific restriction enzyme sites into the vector for ligation to the coding region of the protein-encoding nucleic acid sequence. The regulatory sequence may be a suitable promoter sequence, i.e., a nucleic acid sequence recognized by the host cell in which the nucleic acid sequence is to be expressed. The promoter sequence contains transcriptional regulatory sequences that mediate protein expression. The promoter may be any nucleic acid sequence that is transcriptionally active in the selected host cell, including mutant, truncated, and hybrid promoters, and may be derived from genes encoding extracellular or intracellular proteins that are homologous or heterologous to the host cell. A regulatory sequence may also be a suitable transcription terminator sequence, i.e., a sequence recognized by the host cell to terminate transcription. The terminator sequence may be operably linked to the 3' end of the nucleic acid sequence encoding the protein. Any terminator that is functional in the selected host cell may be used in the present invention. A regulatory sequence may also be a suitable leader sequence, i.e., an untranslated region of an mRNA that is important for translation in the host cell. The leader sequence may be operably linked to the 5' end of the nucleic acid sequence encoding the protein. Any leader sequence that is functional in the selected host cell may be used in the present invention. A regulatory sequence may also be a signal peptide coding region, which encodes an amino acid sequence attached to the amino terminus of the protein that directs the encoded protein into the cell's secretory pathway. Any signal peptide coding region that directs the expressed protein into the secretory pathway of the selected host cell may be used in the present invention. It may also be desirable to add regulatory sequences that can regulate protein expression based on the growth conditions of the host cells. Examples of regulatory sequences are those that can turn gene expression on or off in response to chemical or physical stimuli (including in the presence of regulatory compounds). Other examples of regulatory sequences are those that enable gene amplification. In these instances, the protein-encoding nucleic acid sequence should be operably linked to the regulatory sequences.

[0101] As used herein, the term "vector" means any construct that can be used for transformation purposes, i.e., to introduce heterologous DNA into a host cell, such as a plasmid, cosmid, virus, phage, or linear or circular DNA.

[0102] The technical solution provided by the present invention is:

[0103] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0104] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0105] The transient expression vector pUC19 was a product of Beijing Solebow Technology Co., Ltd., with the product number P3519.

[0106] The quantitative tests in the following examples were repeated three times unless otherwise specified, and the results were averaged.

[0107] The data in the following examples were processed using GraphPad Prism statistical software. The experimental results are expressed as mean ± standard deviation and analyzed using one-way ANOVA combined with Tukey's test. P < 0.001 (***) indicates a highly significant difference.

[0108] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0109] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0110] During the construction of the following examples, plasmid extraction, enzyme digestion, DNA recovery, and purification were performed according to the methods of molecular cloning (Sambrook and Russell 2001).

[0111] Example 1: Establishment of a novel codon optimization method

[0112] 1. Establishment of a frequency table of codon usage for highly expressed genes in rice and maize gene banks

[0113] 1) Establishment of the RICE TOP50 and TOP500 gene banks

[0114] Precision transcriptome sequencing was performed on flag leaves of the super hybrid rice restorer line Minghui 86 (MH86) at the grain filling stage, with three biological replicates. The FPKM values of each gene in the three replicate databases were calculated and averaged. Genes were sorted from highest to lowest according to their FPKM mean, and the top 50 and 500 genes, respectively, were selected as reference gene libraries for high-expression genes. Using the MSU IDs of the selected 50th and 500th highly expressed genes, the corresponding CDS sequences were extracted from the MSU7.0 database (http: / / rice.plantbiology.msu.edu / downloads_gad.shtml) to form the rice high-expression reference gene sequence libraries (RICE TOP50 and RICE TOP500).

[0115] 2) Establishment of the Maize TOP50 Gene Bank

[0116] The latest version of the RNA-seq database for the representative maize genome, B73 (Zm-B73-REFERENCE-NAM-5.0), was found from the Maize Genetics and Genomics Database (MaizeGDB) (https: / / qteller.maizegdb.org / rna_data_sources.php). Maize leaf RNA-seq data were downloaded and sorted by the mean FPKM of each gene. The top 50 genes were selected as the reference gene sequence library for highly expressed genes. Using the IDs of the 50 selected highly expressed genes, the corresponding CDS sequences of each gene were extracted from the MaiZeGDB database (https: / / staging.maizegdb.org / ) to form the maize highly expressed reference gene sequence library (MAIZE TOP50).

[0117] 3) Determination of weighted relative codon usage (RSCU) in the TOP50 and TOP500 gene pools

[0118] The number of codons for each gene in the rice TOP50, TOP500, and maize TOP50 gene libraries was obtained using the Codon Usage website (http: / / www.geneinfinity.org / sms / sms_codonusage.html). This value was then multiplied by the gene's expression level (FPKM) to determine the weighted codon count for that codon. Because the calculation of FPKM takes into account the number of transcripts and gene length, the codon usage frequency calculated using the FPKM-weighted codon count more accurately reflects the actual frequency of codon usage.

[0119] Based on this, the host codon optimization established in this application specifically includes the following steps:

[0120] S1) receiving host transcriptome sequencing data of the expression site of the target gene at a specific expression period of the host, and selecting n highly expressed genes based on the host transcriptome sequencing data, denoted as gene i, where i represents the i-th gene, n is a natural number greater than or equal to 1, and the value of i ranges from 1 to n;

[0121] S2) obtaining the RSCU of each codon in n highly expressed genes of the host according to a method comprising the following steps:

[0122] s2-1) Obtaining the number N of various codons encoding amino acid p in each of the n highly expressed genes ipj , where i represents the i-th gene, p represents the p-th amino acid, j represents the j-th codon encoding amino acid p, and the value of j is a natural number from 1 to n p , n p represents the number of synonymous codons encoding amino acid p, n p The value of is a natural number from 2 to 6;

[0123] s2-2) Multiply the number of the j-th codon encoding amino acid p in gene i by the expression value of gene i, and obtain the weight value W of the j-th codon encoding amino acid p in gene i according to formula 1 ipj ,

[0124] W ipj =N ipj *FPKM i ——Formula 1,

[0125] In formula 1, W ipj represents the weight value of the jth codon encoding amino acid p in gene i of the host, N ipj represents the number of the jth codon encoding amino acid p in gene i, FPKM i represents the expression level of gene i;

[0126] s2-3) According to formula 2, the W of all synonymous codons encoding amino acid p in the n highly expressed genes of the host is converted to ipj Add the sum and the sum is X pj ,

[0127]

[0128] In formula 2, X pj represents the sum of the weight values of the j-th codon encoding amino acid p in the host among the n highly expressed genes of the host;

[0129] s2-4) Obtain the RSCU of each codon according to formula 3,

[0130]

[0131] In formula 3, RSCU pj represents the relative synonymous codon usage frequency of the jth codon encoding amino acid p in n highly expressed genes of the host; represents the sum of the weight values of all synonymous codons encoding amino acid p in n highly expressed genes of the host;

[0132] S3) Referring to the RSCU of each codon of the host, the rare codons in the target gene are replaced with dominant synonymous codons, wherein the rare codons are codons with an RSCU of less than 0.8, and the dominant synonymous codons are codons that encode the same amino acid as the rare codons and have an RSCU greater than 1.0.

[0133] To facilitate understanding of Formula 3, the RSCU of the codon AGG corresponding to arginine (Arg) in the rice TOP50W library, which contains six synonymous codons, is calculated. The sum of the weight values of the codon AGG calculated according to Formula 2 is 690073.37. The Arg encoded by this codon also contains five other synonymous codons: AGA, CGG, CGA, CGT, and CGC. The sum of their weight values is 173495.47, 412569.20, 126900.01, 348481.50, and 900118.19, respectively. According to the above RSCU calculation formula 3, the RSCU of AGG is calculated as follows:

[0134] RSCU=690073.37 / [1 / 6*(690073.37+173495.47+412569.20+126900.01+348481.50+900118.19]=1.56.

[0135] The results are shown in Table 1 (RICE TOP 50W), Table 2 (RICE TOP 500W), and Table 3 (MAIZE TOP 50W). In addition, the present invention also used the online software Codon Usage Database to obtain the codon usage frequency of rice and maize genomes, and plotted the codon usage frequency tables of the rice and maize gene libraries (Table 4, Table 5). The present invention defines codons with an RSCU < 0.8 as rare codons. As can be seen from Tables 1 and 2, there are 32 rare codons with RSCU<0.8 in the independently developed rice RICE TOP 50W and RICE TOP 500W codon usage frequency tables, while there are only 14 rare codons in the rice gene pool codon usage frequency table drawn according to website download data (Table 4). There are 31 rare codons with RSCU<0.8 in the independently developed corn MAIZE TOP 50W codon usage frequency table (Table 3), while there are only 17 rare codons in the corn gene pool codon usage frequency table (Table 5). Therefore, by optimizing the target gene with reference to the weighted codon usage frequency tables of rice and corn developed by the present invention, the number of rare codons counted from the target gene will be greater, and after optimization, the expression level of the target gene in the host will be more potentially improved. In addition, by comparing the codon usage frequency tables of rice RICE TOP 50W and RICE TOP 500W, it was found that the number of rare codons counted using the top 50 and top 500 highly expressed genes in the transcriptome library was 32, with no difference. Therefore, in the subsequent examples, the target gene was optimized with reference to the codon usage frequency tables of RICE TOP 50W and MAIZE TOP 50W.

[0136] Table 1 Rice TOP 50W codon table

[0137]

[0138] Note: There are 32 codons with RSCU < 0.8, and 2 codons with 0.8 ≤ RSCU < 1.

[0139] Table 2 Rice TOP 500W codon table

[0140]

[0141] Note: There are 32 codons with RSCU < 0.8, and 2 codons with 0.8 ≤ RSCU < 1.

[0142] Table 3 Maize MAIZE TOP 50W codon table

[0143]

[0144] Note: There are 31 codons with RSCU < 0.8 and 2 codons with 0.8 ≤ RSCU < 1.

[0145] Table 4 Codon table of rice genome library

[0146]

[0147] Note: There are 14 codons with RSCU < 0.8, and 19 codons with 0.8 ≤ RSCU < 1.

[0148] Table 5 Codon table of the total maize genome library

[0149]

[0150] Note: There are 17 codons with RSCU < 0.8, and 18 codons with 0.8 ≤ RSCU < 1.

[0151] 2. New codon optimization methods

[0152] Based on the RSCU values of weighted codons in the rice TOP50W library and the maize TOP50W library, rare codons and preferred codons in the target gene were determined and optimized according to the following process:

[0153] 1) Send the target gene sequence to the company for general optimization based on the codon usage frequency table of the host genome library.

[0154] 2) Referring to the frequency of codon usage in the weighted codon table of the host genome, determine the preference for codon usage in the universal optimized gene, find out the rare codons in the universal optimized gene that may lead to a decrease in protein expression, and replace the rare codons with preferred codons according to the following principles formulated by the present invention. Optimization principle: All codons with a relative synonymous codon usage frequency of RSCU <0.8 are replaced with dominant synonymous codons with RSCU>1 without affecting the secondary structure of the gene. If there are multiple candidates for synonymous codons with RSCU>1, the ratio of each synonymous codon replacement is based on the RSCU ratio, and the replacement ratio of dominant codons with high RSCU values is increased accordingly. If the gene contains a large number of codons with 0.8≤RSCU<1 at the same time, the codons with 0.8≤RSCU<1 should also be replaced, leaving a small portion evenly distributed in the latter part of the sequence.

[0155] 3) Perform sequence analysis and evaluation on the deeply optimized genes to detect and eliminate secondary structures, cis-acting elements and other sequences that affect their expression.

[0156] Example 2: Codon Optimization of the Insecticidal Crystal Protein Cry1Ab Gene

[0157] The gene encoding the truncated insecticidal crystal protein is collectively referred to as the Cry1Ab gene in the present invention, and its nucleotide sequence is SEQ ID NO: 1. First, Nanjing GenScript Biotechnology Co., Ltd. (hereinafter referred to as "GenScript") was commissioned to optimize the codon usage frequency table of the rice and corn genome libraries (Tables 4 and 5). The optimization was performed using GenScript's codon optimization software OptimumGene. TM Following current methods, the optimized sequences removed restriction sites such as XmaI, KpnI, NotI, and XhoI. Motifs that could affect mRNA stability were also removed, including potential mRNA splicing sites, mRNA PolyA addition sites, repeated PolyA and PolyT sequences, and some forward or reverse repeats. The optimized sequences were named CryV2-Os (SEQ ID NO: 2) and CryV2-Zm (SEQ ID NO: 3).

[0158] Based on the universally optimized sequences described above, the present invention further optimized CryV2-Os and CryV2-Zm according to the method provided in Example 1 to obtain the deeply optimized genes CryV4-Os (SEQ ID NO: 4) and CryV4-Zm (SEQ ID NO: 5). Parameter comparisons of the deeply optimized sequences with the universally optimized sequences, as well as codon statistical analysis, are shown in Tables 6 and 7.

[0159] Table 6 Comparison of parameters between deep optimization sequence and general optimization sequence

[0160]

[0161] Note: Minimum free energy was calculated using DNAman 8.0 software; CAI, GC content, and cis-acting elements were analyzed by GenScript. Types of cis-acting elements: Splice (GGTAAG), Splice (GGTGAT), Splice (GTAAAA), Splice (GTAAGT), Splice (GTACGT), PolyA (AATAAA), PolyA (AATGAA), PolyA (AATGGA), PolyA (TATAAA), PolyA (AATAAT), Destabilizing (ATTTA), PolyT (TTTTTT), PolyA (AAAAAAA)

[0162] Table 7 Codon statistics of deep optimized sequences and universal optimized sequences

[0163]

[0164]

[0165]

[0166] Example 3: Transformation of Rice and Corn with the Optimized Cry1Ab Gene and Determination of Its Expression Level

[0167] 1. Cloning of the optimized Cry1Ab gene, construction of transient expression vector, and genetic transformation

[0168] 1. Cloning of the optimized Cry1Ab gene and construction of transient expression vector

[0169] The optimized CryV2-Os, CryV4-Os, CryV2-Zm, and CryV4-Zm genes were synthesized by GenScript. Using the synthesized plasmids as templates, the genes were amplified using the following primer pairs:

[0170] CryV2-OsF:ggacgatgacgataagttcgaaATGGATAACAATCCTAATATCAACG;

[0171] CryV2-OsR:cgaaagctctgcaggtcgacTCAGTACTCCGCCTC;

[0172] CryV4-OsF:ggacgatgacgataagttcgaaATGGACAACAACCCGAACATC;

[0173] CryV4-OsR:cgaaagctctgcaggtcgacTCAGTACTCCGCCTCG;

[0174] CryV2-ZmF:ggacgatgacgataagttcgaaATGGATAACAACCCCAATATTAACG;

[0175] CryV2-ZmR:cgaaagctctgcaggtcgacTCAGTACTCGGCC;

[0176] CryV4-ZmF:ggacgatgacgataagttcgaaATGGACAACAACCCGAACATC;

[0177] CryV4-ZmR: cgaaagctctgcaggtcgacTCAGTACTCGGCCTC.

[0178] High-fidelity PCR amplification was used in all construction processes Fast Pfu DNA Polymerase was purchased from Beijing Quanshijin Biotechnology Co., Ltd., catalog number AP221. A 50 μL amplification system was used, as follows:

[0179] Table 8 Amplification system

[0180]

[0181] The PCR amplification program was as follows: 95°C for 2 minutes; 95°C for 20 seconds, 58°C for 20 seconds, 72°C for 2 minutes, 30 cycles; and extension at 72°C for 5 minutes. The PCR products of CryV2-Os, CryV4-Os, CryV2-Zm, and CryV4-Zm genes were recovered and homologously recombined into the transient expression vector pUC19 (double digestion with BstBI and Sal) using the Uniclone One Step Seamless Cloning Kit (SC612) from Beijing Jinsha Biotechnology Co., Ltd., to obtain rice transient expression vectors pUC19-CryV2-Os and pUC19-CryV4-Os, and maize transient expression vectors pUC19-CryV2-Zm and pUC19-CryV4-Zm. Since the expression vector maps are similar, Figure 1 、 Figure 2 Only schematic diagrams of the pUC19-CryV4-Os and pUC19-CryV4-Zm expression vector structures are shown. Each CryV2-Os, CryV4-Os, CryV2-Zm, or CryV4-Zm gene is driven by the constitutively expressed CaMV 35S promoter and terminated by the E9 terminator. After sequencing confirmed the vectors to be correct, bacteria containing the vector plasmids were cultured overnight and the plasmids were then scaled up using the GoldHiEndoFree Plasmid Maxi Kit (CW2104M) produced by Beijing Kangwei Century Biotechnology Co., Ltd. for subsequent transient transformation.

[0182] 2. Genetic transformation of the optimized Cry1Ab gene and positive protoplast detection

[0183] 1) One-week-old etiolated seedlings of rice MH86 or corn B73 were cultured in 1 / 2 MS medium.

[0184] 2) Cut etiolated seedlings into 1 mm segments using a double-edged razor blade. Add 20 mL of enzymatic hydrolyzate per bottle of 50 etiolated seedlings and stir until the tissue is completely immersed in the liquid. Wrap in aluminum foil and protect from light.

[0185] 3) Vacuum for 30 minutes.

[0186] 4) Enzymatic hydrolysis at 28°C (40-60 rpm) for 4-6 hours.

[0187] 5) Filter through a layer of miracloth, squeeze, rinse with an equal volume of W5 solution, and squeeze again. Gently invert 10 times to mix. Divide one tube of tissue culture seedlings into two 50mL centrifuge tubes, rinsing each tube with 30mL of W5 solution. (Do not exceed 20mL, as this will cause excessive pressure and breakage. Alternatively, centrifuge after squeezing, remove the supernatant, and then rinse again with 20mL of W5 solution.)

[0188] 6) Centrifuge at 300g for 5 minutes.

[0189] 7) Remove the supernatant by aspiration, add 10 mL of W5 solution to suspend the suspension, and then filter through a layer of miracloth to remove broken cells.

[0190] 8) Incubate on ice for 30 min to allow the cells to enter the competent state.

[0191] 9) Centrifuge at 200g for 3 minutes and remove the supernatant.

[0192] 10) Add the appropriate volume of Mmg solution to resuspend and gently shake to mix. Calculate the volume based on the number of plasmids to be transfected: 200 μL / tube x the number of tubes.

[0193] 11) Take 200 μL of cells, add 10 μg of plasmid, and shake gently (dilute the plasmid to 1 μg / μL in advance and add 10 μL directly to each tube).

[0194] 12) Add 200 μL of 40% PEG and immediately mix gently by hand. Incubate at 28°C for 20 minutes (starting from the first sample).

[0195] 13) Add 4 mL of W5 solution and shake gently.

[0196] 14) Centrifuge at 250 g for 3 min and remove the supernatant.

[0197] 15) Resuspend in 1 mL of W5 solution and incubate at 28°C in the dark for 12-16 hours. The resulting protoplasts are grouped according to the introduced gene into CryV2-Os, CryV2-Zm, CryV4-Os, and CryV4-Zm. Use directly for microscopic examination and further testing.

[0198] Table 9 Enzyme hydrolysate formula

[0199] Final concentration 20mL 40mL 60mL 100 mM MES (pH 5.7) 1mM 2mL 4mL 6mL D-Mannitol 0.6M 2.18g 4.36g 6.54g Cellulase R-10 1.5％ 0.3g 0.6g 0.9g Macerozyme (pectinase) 0.75％ 0.15g 0.3g 0.45g BSA 0.1％ 0.02 g 0.04g 0.06g <![CDATA[1M CaCl2]]> 3.4mM 68μL 136μL 204μL 2-ME 5mM 8μL 16μL 24 μL Cephamycin (cephalosporin) 50 μg / mL 20 μL 40 μL 60μL <![CDATA[ddH2O]]> to 20mL 40mL 60mL

[0200] Note: After adding Macerozyme (pectinase), heat to 55°C for 10 minutes to dissolve, and then add subsequent reagents.

[0201] Table 10W5 solution formula

[0202] Final concentration 50mL 500mL 100 mM MES (pH 5.7) 2mM 1mL 10mL 5M NaCl 154mM 1.54mL 15.4mL <![CDATA[CaCl2(CaCl2.2H2O)]]> 125mM 0.69g(0.92g) 6.93g(9.2g) 1M KCl 5mM 0.25mL 2.5mL

[0203] Table 11Mmg solution formula

[0204]

[0205]

[0206] Table 12 40% PEG formulation

[0207] Final concentration 40mL 80mL D-Mannitol 0.2M 1.45g 2.91g <![CDATA[1M CaCl2]]> 100mM 4mL 8mL PEG4000 40％ 16g 32g <![CDATA[ddH2O]]> to 40mL to 80mL

[0208] 2. Construction of optimized Cry1Ab gene rice expression vector and genetic transformation

[0209] 1. Construction of optimized Cry1Ab gene rice expression vector

[0210] Using the optimized and synthesized plasmid as a template, the following primers were used to amplify the rice universal optimized gene CryV2-Os and the deeply optimized gene CryV4-Os:

[0211] CryV2P-OsF:tatttacaattacagcggccGCCAGATGGATAACAATCCTAATAT;

[0212] CryV2P-OsR:ccttgggtctcacctacttactCAGTCAGTACTCCGCCTCGAATG;

[0213] CryV4P-OsF:tatttacaattacagcggccGCCAGATGGACAACAACCCGAACATCAACG;

[0214] CryV4P-OsR:ccttgggtctcacctacttactCAGTCAGTACTCCGCCTCGAAGG.

[0215] High-fidelity PCR amplification was also used in the construction process Fast Pfu DNA Polymerase was purchased from Beijing Quanshijin Biotechnology Co., Ltd., catalog number AP221. A 50 μL amplification system was used, as shown in Table 8. The PCR amplification program was as follows: 95°C for 2 minutes; 95°C for 20 seconds, 58°C for 20 seconds, and 72°C for 2 minutes, for 30 cycles; and extension at 72°C for 5 minutes. PCR products of the CryV2-Os and CryV4-Os genes were recovered and seamlessly cloned using the Uniclone One Step Seamless Cloning Kit (SC612) from Beijing Jinsha Biotechnology Co., Ltd. into the PvuII restriction site of the inducible deletion vector system pCNDL, maintaining the remaining nucleotide sequences of the pCNDL vector system unchanged. The resulting plant expression vectors were named pCNDL-CryV2-Os and pCNDL-CryV4-Os, respectively. After sequencing verification, these vectors were transformed into competent Agrobacterium EHA105 cells by electroporation for rice transformation. The nucleotide sequence of the inducible deletion vector system pCNDL is shown in Table 13. This vector has a double LB element, which can effectively prevent transcriptional read-through. Positions 9384 to 10362 of the nucleotide sequence shown in Table 13 are the sequences of the Ubiquitin promoter, positions 10362 to 11372 are the first intron of the Ubiquitin enhancing element, positions 11379 to 11445 are the Ω sequence, positions 11454 to 11459 are the PvuII restriction enzyme recognition site, and positions 11474 to 11970 are the TgluB5 terminator.

[0216] Table 13 Nucleotide sequence of the inducible deletion vector system pCNDL

[0217]

[0218]

[0219]

[0220]

[0221]

[0222] 2. Agrobacterium-mediated stable genetic transformation of rice and detection of positive plants

[0223] Genetic transformation of rice was carried out according to conventional methods in the art, and the exemplary steps are as follows:

[0224] 1) The constructed plant expression vectors pCNDL-CryV2-Os and pCNDL-CryV4-Os were introduced into Agrobacterium tumefaciens EHA105 by electroporation to obtain recombinant Agrobacterium.

[0225] 2) A recombinant Agrobacterium monoclone was inoculated into 20 mL of YEB liquid medium containing 50 mg / L kanamycin and 50 mg / L rifampicin, and cultured with shaking at 28°C and 220 rpm for 12 to 16 h. The recombinant Agrobacterium monoclone was then inoculated into YEB liquid medium containing 100 μM acetosyringone at a ratio of 2% (volume percentage) and cultured with shaking at 28°C and 220 rpm until the OD600 value reached approximately 0.5. The cells were collected by centrifugation at 5,000 g for 10 min; the supernatant was discarded, and the cells were suspended in approximately 40 mL of AAM (with AS added to a final concentration of 300 μM) to an OD600 value of 0.4 to 0.5. The cells were cultured in a shaker at 28°C and 100 rpm for 30 min to obtain an Agrobacterium infection solution, which was then used to infect rice calli.

[0226] 3) Mature rice Minghui 86 seeds were shelled and threshed, placed in a 100 mL Erlenmeyer flask, and soaked in a 70% (volume percentage) ethanol aqueous solution for 30 seconds. The seeds were then placed in a 25% (volume percentage) sodium hypochlorite aqueous solution and sterilized by shaking at 120 rpm for 30 minutes. The seeds were rinsed three times with sterile water and dried with filter paper. The seeds were then placed embryo-side down on an induction medium to induce callus at 30°C in full light for 7 days. The grown callus was pinched and used for rice transformation.

[0227] 4) After completing step 3, embryogenic calli with good growth status were taken and immersed in the Agrobacterium infection solution obtained in step 2. The calli were gently shaken at 80 rpm at 28°C for 30 minutes. Then, they were placed on a co-cultivation medium covered with a layer of sterile filter paper and incubated in the dark at 25°C for 4 days.

[0228] 5) After completing step 4, the callus tissue was placed in a sterile culture dish, rinsed 2 to 3 times with sterile water containing 400 mg / L Cef, blotted dry on sterile filter paper, and then placed on pre-culture medium and cultured in the dark at 25°C for 3 to 4 days.

[0229] 6) Take the callus obtained in step 5 and place it on the screening medium. After culturing under alternating light for 2 weeks, replace the new screening medium and continue to culture under alternating light for 2 weeks. Transfer the resistant callus grown on the original callus to the screening medium and culture under alternating light for 2 weeks. The alternating light culture is alternating light culture and dark culture under the following conditions: 28°C; 14 hours of light culture / 10 hours of dark culture; the light intensity during light culture is 90 μE / m 2 / s.

[0230] 7) After completing step 6, take the vigorously growing resistant callus and transfer it to the pre-differentiation medium. After 7 to 10 days, when green spots appear on the callus, place it on the differentiation medium and culture it in alternating light (i.e., alternating light culture and dark culture, conditions: 28°C; 14 hours light culture / 10 hours dark culture; light intensity during light culture is 90 μE / m 2 / s) for 3 weeks, resistant buds differentiated from the resistant callus.

[0231] 8) After completing step 7, take the resistant buds, place them on a rooting medium, and culture them under alternating light conditions (i.e., alternating light and dark cultivation, conditions: 28°C; 14 hours of light cultivation / 10 hours of dark cultivation; light intensity during light cultivation is 90 μE / m 2 / s) to obtain resistant plants. When the resistant plants reached 6 to 10 cm in height, they were cultured in open water and, after developing new roots, transplanted into a greenhouse. The resulting T0-generation transgenic rice plants were named CryV2-Os and CryV4-Os, respectively, based on the introduced genes. Genomic DNA was then extracted from the leaves of the T0-generation transgenic rice plants using the CTAB method.

[0232] YEB medium: Add 5g tryptone, 1g yeast extract, 5g sucrose, 5g beef extract, and 0.5g MgSO₄ to every 1L of liquid medium. Adjust the pH to 7.0 with NaOH. Sterilize the medium under high temperature and high pressure (121°C, 1.034×10⁵ Pa) for 20 minutes and store at room temperature. For solid medium, add 15g / L agar powder before autoclaving.

[0233] The rice transformation medium formula is shown in Table 14.

[0234] Table 14 Rice transformation medium formula

[0235]

[0236]

[0237] 9) Molecular testing

[0238] The leaves of the T0 generation transgenic regenerated plants were taken and the genomic DNA was extracted using the DNA rapid extraction method for PCR detection. The primers used in PCR included the detection primers (HPT-F / R) HPTF: 5'-CGTGGATATGTCCTGCGGGT-3', HPTR: 5'-GGCGACCTCGTATTGGG-3' for the selection marker gene hygromycin phosphotransferase gene (HPT) and the target gene detection primers 1Abv4 F: 5'-ACAGCCGGACCTACCCGATC-3'; 1Abv4 R: 5'-CGATGTACACCTCGTTGCC-3'. The obtained PCR products were detected by 1% agarose gel electrophoresis. The detection results of some T0 generation transgenic CryV4-Os rice lines are shown in Figure 2. Figure 4 As shown, the 1047 bp band is the amplified product of the target gene CryV4-Os, and the 561 bp band is the amplified product of the hygromycin resistance gene.

[0239] 3. Optimizing gene expression level detection

[0240] 1. Transcriptional expression level detection

[0241] Take 50 μL of the overnight cultured protoplasts prepared in step 1 and centrifuge at 200 g for 3 minutes. Remove the supernatant and add 1 mL of TRIzol (Invitrogen) to extract total RNA. For the rice material stably transformed in step 2, randomly select more than 30 positive lines that are transgenic for CryV2-Os or CryV4-Os. Remove leaves from these lines at the jointing stage, grind them, and add 1 mL of TRIzol (Invitrogen) to extract total RNA. Genomic DNA was removed using RQ1 RNase-free DNase (Promega, M6101) and reverse-transcribed to cDNA using the Oligo(dT)15 primer in the GoScript™ Reverse Transcription System (Promega, A5001). Transcription levels of the optimized genes were detected by qPCR using the following primers:

[0242] Universal primer pair for detecting CryV2-Os and CryV4-Os genes in transgenic rice:

[0243] CryV2 / V4rel-OsF:CAACCTCCAGTTCCAACCTCCATC;

[0244] CryV2 / V4rel-OsR:CCTGAAGGAGCCCGACTGCAG.

[0245] Universal primer pair for detecting CryV2-Zm and CryV4-Zm genes in transgenic maize:

[0246] CryV2 / V4rel-ZmF:AACGAGTGCATCCCGTACAAC;

[0247] CryV2 / V4rel-ZmR:TCCCACTGGCTCGGGCC.

[0248] The rice internal reference gene primers are:

[0249] OsActinrealF:GACCCAGATCATGTTTGAGACC;

[0250] OsActinrealR:CATCACCAGAGTCCAACACAATAC.

[0251] The primers for the maize internal reference gene are

[0252] ZmrealF:ATGGTCAAGGCCGGTTTCG;

[0253] ZmrealR:TCAGGATGCCTCTCTTGGCC.

[0254] The results showed that the relative expression levels of the deep optimized genes CryV4-Os and CryV4-Zm mRNA in the transformed protoplasts were 1.93 times and 3.49 times the relative expression levels of the common optimized genes CryV2-Os and CryV2-Zm mRNA, respectively. Figure 5 The q-PCR average value of the deep optimized gene CryV4-Os in the T0 generation of stably transformed rice was 0.90, and the qPCR average value of the universal optimized gene CryV2-Os was 0.19. The relative expression of the deep optimized gene rice mRNA was 4.74 times that of the universal optimized gene rice mRNA ( Figure 6 ).

[0255] 2. Protein expression level detection

[0256] Take 300 μL of overnight cultured protoplast cells prepared in step 1, centrifuge at 200g for 3 minutes, remove the supernatant and add 400 μL of plant protein extract (Lot01386, Kangwei Century) to extract total protein. The material for extracting total plant protein from the stably transformed rice obtained in step 2 is the same as the material for extracting total RNA. After adding the plant protein extract to the above materials, shake vigorously on an oscillator for 60 seconds, quickly place on ice, and let stand for 30 minutes. Centrifuge at 4°C, 12,000rpm for 10 minutes. Transfer the supernatant to a 1.5mL Eppendorf tube and repeat the above operation. The obtained extract is placed on ice for standby use.

[0257] Refer to the instructions of the BCA protein quantification kit (CW2341) of Beijing Kangwei Century Co., Ltd. for total protein quantification. First, dilute the BSA standard protein (2000ng / μL) into different concentration gradients such as 1000ng / μL, 500ng / μL, 250ng / μL, 125ng / μL, 62.5ng / μL, and 31.25ng / μL. Select the three leftmost columns of test wells on a marked 96-well plate for preparing a standard curve. Repeat each standard three times, and add 25μL of the first and last rows of test wells respectively. BSA standard protein and HO were added to the middle wells, with 25 μL of BSA standard protein diluents (1000 ng / μL, 500 ng / μL, 250 ng / μL, 125 ng / μL, 62.5 ng / μL, and 31.25 ng / μL) added sequentially from top to bottom. 25 μL of a 10-fold diluted protein sample was added to each sample well. Each sample was repeated three times. Then, 200 μL of BCA working solution (reagent A and reagent B were mixed at a 50:1 ratio, depending on the number of BSA standard proteins and sample to be tested) was added to each well. After thorough mixing, the 96-well plate was covered and incubated at 37°C for 30 min, followed by cooling to room temperature. Absorbance was measured at 562 nm using an MD SpectraMax 190 full-wavelength microplate reader. The absorbance OD562 was recorded and a standard curve was plotted. The concentration of the protein sample was then calculated based on the standard curve.

[0258] Protein expression level detection was performed using the Cry1Ab / Ac enzyme-linked immunosorbent assay kit (Cat. No. AA0341) from Shanghai Youlong Biotechnology Co., Ltd. The specific steps are as follows:

[0259] 1) Take out the required reagents from the refrigerated environment and place them at room temperature (20-25℃) for more than 30 minutes. Note that each liquid reagent must be shaken before use.

[0260] 2) Take out the required number of microplates, place the unused microplates in a ziplock bag, and store at 2-8°C.

[0261] 3) The washing working fluid also needs to be warmed up before use.

[0262] 4) Numbering: Number the corresponding microwells of the samples and standards in sequence. Make two parallel wells for each sample and standard, and record the positions of the standard wells and sample wells.

[0263] 5) Add standard / sample: Add 100 μL of sample extract (blank control) / standard / sample to the corresponding microwells, gently shake to mix, and react at 25°C in a dark environment for 45 minutes.

[0264] 6) Washing the plate: Shake off the liquid in the wells and wash thoroughly with 250 μL / well of washing solution 4-5 times, with an interval of 10 seconds between each wash. Pat dry with absorbent paper (air bubbles that are not removed after patting dry can be punctured with a clean pipette tip).

[0265] 7) Add enzyme labeling working solution: Add 100 μL / well of enzyme labeling working solution, gently shake to mix, incubate at 25°C in a dark environment for 30 minutes, remove the plate and repeat step 6.

[0266] 8) Color development: Add 100 μL / well of color developer and incubate at 25°C in a dark environment for 15 min.

[0267] 9) Assay: Add 100 μL / well of stop solution, gently shake to mix, set the microplate reader at 450 nm (dual wavelength 450 / 630 nm detection is recommended, and the data should be read within 5 minutes), and measure the OD value of each well.

[0268] 10) Draw a standard curve with the absorbance of the standard as the y-axis and the concentration (ppb) of the Cry1Ab / Ac standard as the x-axis. Substitute the absorbance of the sample into the standard curve and read the corresponding concentration of the sample from the standard curve.

[0269] The test results showed that the relative expression levels of the deeply optimized genes CryV4-Os and CryV4-Zm were 3.06 and 3.29 times the relative expression levels of the commonly optimized genes CryV2-Os and CryV2-Zm, respectively. Figure 5 The mean ELISA value of the deeply optimized rice gene in the T0 generation of stably transformed rice was 1.09, while the mean ELISA value of the universally optimized gene was 0.53; the relative expression level of the rice protein of the deeply optimized gene CryV4-Os was 2.06 times that of the rice protein of the universally optimized gene CryV2-Os ( Figure 6 The above results show that the protein levels of the deeply optimized genes optimized by the novel codon optimization method independently developed by the present invention are significantly higher than those of the commonly optimized genes in rice and corn.

[0270] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, the present invention is intended to include any changes, uses or improvements to the present invention, including changes that depart from the disclosed scope of the present invention and are made using conventional techniques known in the art.

Claims

1. A DNA molecule characterized by: The DNA molecule is a codon-optimized Bt protein encoding gene, the encoding gene is the CryV4-Os gene and / or the CryV4-Zm gene, the CryV4-Os gene is a DNA molecule whose nucleotide sequence includes SEQ ID NO: 4; the CryV4-Zm gene is a DNA molecule whose nucleotide sequence includes SEQ ID NO:

5.

2. A biological material associated with the DNA molecule according to claim 1, wherein the biological material is selected from at least one of the following: A1) an expression cassette and / or construct containing the DNA molecule according to claim 1; A2) a recombinant vector containing the DNA molecule according to claim 1 and / or a recombinant vector containing the expression cassette and / or construct according to A1); A3) a recombinant microorganism containing the DNA molecule according to claim 1, a recombinant microorganism containing the expression cassette and / or construct according to A1) and / or a recombinant microorganism containing the recombinant vector according to A2); A4) a recombinant cell line containing the DNA molecule of claim 1, a recombinant cell line containing the expression cassette and / or construct of A1) and / or a recombinant cell line containing the recombinant vector of A2); A5) a transgenic plant cell containing the DNA molecule of claim 1, a transgenic plant cell containing the expression cassette and / or construct of A1) and / or a transgenic plant cell containing the recombinant vector of A2); A6) transgenic plant tissue containing the DNA molecule of claim 1, transgenic plant tissue containing the expression cassette and / or construct of A1), and / or transgenic plant tissue containing the recombinant vector of A2); A7) A transgenic plant organ containing the DNA molecule of claim 1, a transgenic plant organ containing the expression cassette and / or construct of A1) and / or a transgenic plant organ containing the recombinant vector of A2).

3. Use of the encoding gene according to claim 1 or / and the biomaterial according to claim 2 in at least one of the following: B1) Application in increasing the expression of genes encoding Bt proteins in recipient plants; B2) Use in the preparation of a product for increasing the expression level of a gene encoding a Bt protein in a recipient plant; B3) Application in increasing the content of Bt protein in recipient plants; B4) Use in the preparation of products for increasing the content of Bt protein in recipient plants; B5) Application in improving insect resistance of recipient plants; B6) Use in the preparation of products that improve insect resistance of recipient plants; B7) Use in the preparation of Bt protein; B8) Application in the preparation of Bt protein preparations; B9) Application in plant breeding; B10) Use in the preparation of a plant breeding product.

4. A method for preparing Bt protein, characterized in that: The method comprises expressing the CryV4-Os gene and / or the CryV4-Zm gene described in claim 1 in biological cells to obtain Bt protein.

5. A method for increasing the expression of a gene encoding a Bt protein in a recipient rice plant, increasing the Bt protein content in the recipient rice plant, and / or improving the insect resistance of the recipient rice plant, characterized in that: The method comprises introducing the CryV4-Os gene of claim 1 into a recipient rice to increase the expression level of the Bt protein encoding gene of the recipient rice, increase the Bt protein content of the recipient rice and / or improve the insect resistance of the recipient rice.

6. A method for increasing the expression level of a gene encoding a Bt protein in a recipient corn, increasing the Bt protein content in the recipient corn, and / or improving the insect resistance of the recipient corn, characterized by: The method comprises introducing the CryV4-Zm gene of claim 1 into a recipient corn to increase the expression level of the gene encoding the Bt protein of the recipient corn, increase the Bt protein content of the recipient corn and / or improve the insect resistance of the recipient corn.

7. A method for preparing target rice, characterized in that: The method comprises introducing the CryV4-Os gene of claim 1 into a recipient rice to obtain a target rice, wherein the target rice has higher insect resistance than that of the recipient rice.

8. A method for preparing rice with improved insect resistance, characterized in that: The method comprises at least one of the following: C1) The method comprises introducing the CryV4-Os gene of claim 1 into a recipient rice to obtain the target rice; C2) genetic breeding is carried out using the target rice described in C1) as a parent.

9. A method for preparing target corn, characterized in that: The method comprises introducing the CryV4-Zm gene of claim 1 into a recipient corn to obtain target corn, wherein the target corn has higher insect resistance than the recipient corn.

10. A method for preparing corn with improved insect resistance, characterized in that: The method comprises at least one of the following: D1) The method comprises introducing the CryV4-Zm gene of claim 1 into a recipient corn to obtain the target corn; D2) genetic breeding is carried out using the target corn described in D1) as a parent.

Images