Medicago sativa MsCEPR1 gene, protein and application of medicago sativa MsCEPR1 gene in improvement of phosphorus stress resistance of plants
By cloning and expressing the MsCEPR1 gene of alfalfa, overexpression vector was constructed and transferred to alfalfa, the limitations of the molecular mechanism of alfalfa phosphorus absorption were solved, the growth and phosphorus absorption efficiency under low phosphorus stress was improved, and the stability of root growth and photosynthetic system was promoted.
Patent Information
- Application Number
- CN202510623093.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-15
- Publication Date
- 2025-08-15
- Estimated Expiration
- 2045-05-15
AI Technical Summary
In the prior art, there are limitations in the study of the molecular mechanism of alfalfa phosphorus absorption, the functional differentiation of key genes has not been systematically elucidated, and the relationship between root morphological characteristics and phosphorus absorption related genes has not been clarified, which affects its growth and phosphorus absorption efficiency under low phosphorus stress.
The MsCEPR1 gene of alfalfa was cloned and expressed, and the overexpression vector pCAMBIA3301-MsCEPR1 was constructed. It was transferred to alfalfa through Agrobacterium-mediated infection method, overexpressing the MsCEPR1 protein, regulating the expression of genes related to phosphorus absorption and promoting phosphorus absorption and transport.
It improves the growth performance of alfalfa under low phosphorus stress, enhances the phosphorus absorption efficiency, alleviates the inhibition of low phosphorus on the growth of the above ground, promotes root growth, and maintains the stability of the photosynthetic system.
Smart Images

Figure CN120485231A_ABST
Abstract
Description
Technical Field
[0001] The present application belongs to the technical field of plant genetic engineering, and in particular relates to an alfalfa MsCEPR1 gene and protein and their application in improving the plant's resistance to phosphorus stress. Background Art
[0002] Phosphorus, a core structural element of key biomacromolecules in soil, plays a crucial role in plant growth and development. Previous studies have found a close link between plant phosphorus uptake and root morphology, and that phosphorus deficiency can also drive root morphological remodeling. However, current research has largely focused on comparing and selecting root architectures that are highly efficient in phosphorus uptake, while the core regulatory elements influencing phosphorus uptake remain largely unidentified.
[0003] Plant C-terminally encoded peptides (CEPs) are mature peptides with unique biological activities, formed by hydrolysis of precursor peptides. They represent a novel class of plant peptide hormones with similar functions to traditional plant hormones. C-terminally encoded peptide receptor kinases (CEPRs), first identified in Arabidopsis thaliana, have been shown to regulate plant root growth and development, nitrogen uptake, and responses to abiotic stresses. While the roles of CEPs and CEPRs in nitrogen uptake are largely understood, their roles in phosphorus absorption are still at an early stage.
[0004] Alfalfa is an excellent legume forage, and its root types are divided into rhizome type, taproot type (or axis root type), root-tiller type and lateral root type. The phosphorus absorption capacity of alfalfa is closely related to the root morphology. Studies have shown that there are differences in the ability of alfalfa with different root morphologies to tolerate low phosphorus stress, and the root-tiller type alfalfa has a stronger tolerance to low phosphorus than the taproot and rhizome types. Current research focuses on screening root phenotypes with efficient phosphorus absorption, and there is a lack of systematic analysis of the molecular regulatory mechanisms regulating the root morphology of alfalfa. Although genes such as WOX and LBD have been confirmed to regulate lateral root development in Arabidopsis, the functional conservation and species specificity of these key genes in alfalfa still need further verification. In addition, the complex root architecture of alfalfa (such as multi-level branching and root-tiller structure) significantly increases the difficulty of studying its morphological molecular network. At the same time, there are still limitations in the research on the molecular mechanism of phosphorus absorption in alfalfa. For example, the functional differentiation of the core regulatory elements of phosphorus signaling has not been systematically elucidated, and the relationship between root morphological characteristics and phosphorus absorption-related genes has not been clarified. Summary of the Invention
[0005] To overcome the above-mentioned defects in the prior art, the present application provides an alfalfa MsCEPR1 gene, protein and its application in improving the plant's resistance to phosphorus stress. By exploring the function of CEPR1 in phosphorus absorption, its regulatory effect on phosphorus absorption-related genes is preliminarily revealed, providing a basis for constructing a molecular network for CEPR1 to regulate phosphorus absorption.
[0006] In order to achieve the above-mentioned invention objectives, this application provides the following technical solutions:
[0007] In one aspect, the present application provides an alfalfa MsCEPR1 gene, the nucleotide sequence of the alfalfa MsCEPR1 gene is shown in SEQ ID NO.1.
[0008] In a second aspect, the present application provides an alfalfa MsCEPR1 protein, wherein the alfalfa MsCEPR1 protein is encoded by the aforementioned alfalfa MsCEPR1 gene, and the amino acid sequence of the alfalfa MsCEPR1 protein is shown in SEQ ID NO.2.
[0009] In a third aspect, the present application provides an expression vector, a genetically engineered bacterium or a transgenic cell line comprising the aforementioned alfalfa MsCEPR1 gene.
[0010] In a fourth aspect, the present application provides the use of the aforementioned alfalfa MsCEPR1 gene or alfalfa MsCEPR1 protein in improving the resistance of plants to phosphorus stress.
[0011] Optionally, the improving the plant's resistance to phosphorus stress includes promoting the growth of the plant's aerial parts and root system under low phosphorus stress, and promoting phosphorus absorption and transport in the plant under low phosphorus stress.
[0012] Optionally, the plant comprises alfalfa.
[0013] Optionally, the growth condition of the low phosphorus stress is: using 50 μmol·L -1 The KH2PO4 is treated with low phosphorus.
[0014] Optionally, the promoting of phosphorus absorption and transport in plants under low phosphorus stress is achieved by up-regulating the expression of PHO1, PHR2 and PHT1 genes.
[0015] In a fifth aspect, the present application provides a method for improving plant resistance to phosphorus stress, comprising the following steps:
[0016] (1) PCR amplification of the aforementioned alfalfa MsCEPR1 gene and gel cutting to recover the target fragment;
[0017] (2) Construction of recombinant plasmid pTOPO-TA-MsCEPR1;
[0018] (3) Construction of the overexpression vector pCAMBIA3301-MsCEPR1;
[0019] (4) transferring the overexpression vector pCAMBIA3301-MsCEPR1 into the target plant to obtain a transgenic plant;
[0020] The plants include alfalfa.
[0021] Optionally, in step (1), the upstream and downstream primer sequences for PCR amplification are shown as SEQ ID NO.3 and SEQ ID NO.4, respectively.
[0022] Optionally, in step (2), the method for constructing the recombinant plasmid pTOPO-TA-MsCEPR1 comprises:
[0023] The target fragment of the alfalfa MsCEPR1 gene obtained in step (1) was connected to the pTOPO-TA vector, transformed into Escherichia coli, and positive clones were screened and sequenced to obtain the recombinant plasmid pTOPO-TA-MsCEPR1.
[0024] Optionally, the ligation reaction system is: ddH2O 1.8-2.2 μL, MsCEPR1 gene fragment 1.8-2.2 μL, 10× Enhancer 0.4-0.6 μL, pTOPO-TA vector 0.4-0.6 μL;
[0025] The reaction conditions for the connection are: 35-37° C., 10-15 min.
[0026] Preferably, the ligation reaction system is: ddH2O 2 μL, MsCEPR1 gene fragment 2 μL, 10× Enhancer 0.5 μL, pTOPO-TA vector 0.5 μL;
[0027] The reaction conditions for the connection are: 37° C., 15 min.
[0028] Optionally, in step (3), the method for constructing the overexpression vector pCAMBIA3301-MsCEPR1 comprises:
[0029] S1. Using the recombinant plasmid pTOPO-TA-MsCEPR1 obtained in step (2) as a template, upstream and downstream primers were designed to amplify the MsCEPR1 fragment containing the NcoⅠ restriction site, i.e., p3301-MsCEPR1;
[0030] S2. Use NcoⅠ enzyme to digest the pCAMBIA3301 vector;
[0031] S3. The pCAMBIA3301 vector after enzyme digestion was connected with the p3301-MsCEPR1 by seamless cloning, and Escherichia coli was transformed. Positive clones were screened and sequenced for verification to obtain the overexpression vector pCAMBIA3301-MsCEPR1.
[0032] Optionally, in step S1, the sequences of the upstream and downstream primers are shown as SEQ ID NO.5 and SEQ ID NO.6, respectively.
[0033] Optionally, in step S2, the enzyme digestion reaction system is: ddH2O 35-35.2 μL, pCAMBIA33018-9 μL, 10× Buffer 4-6 μL, NcoⅠ enzyme 0.8-1.2 μL;
[0034] The reaction conditions of the enzyme digestion are: 35-37° C., 1.5-2.5 h.
[0035] Preferably, in step S2, the enzyme digestion reaction system is: ddH2O 35.1 μL, pCAMBIA33018.9 μL, 10× Buffer 5 μL, NcoⅠ enzyme 1 μL;
[0036] The reaction conditions of the enzyme digestion are: 37° C., 2 h.
[0037] Optionally, in step S3, the seamless cloning and ligation reaction system is ddH2O 3-5 μL, pCAMBIA3301 after enzyme digestion 11.8-2.2 μL, 2×Seamless Master Mix 2.8-3.2 μL, and p3301-MsCEPR10.8-1.2 μL;
[0038] The reaction conditions for the seamless cloning and ligation are: 48-52° C., 28-32 min.
[0039] Preferably, in step S3, the seamless cloning and ligation reaction system is 4 μL of ddH2O, 2 μL of pCAMBIA3301 after enzyme digestion, 3 μL of 2×Seamless Master Mix, and 11 μL of p3301-MsCEPR.
[0040] The reaction conditions for the seamless cloning and ligation are: 50° C., 30 min.
[0041] Optionally, in step (4), the transfer method includes Agrobacterium-mediated leaf disc transformation.
[0042] Compared with the prior art, this application has the following beneficial effects:
[0043] (1) This application successfully cloned the full-length sequence of the MsCEPR1 gene and its encoded protein from alfalfa "Zhongmu No. 4". The basic characteristics of MsCEPR1 were analyzed by bioinformatics methods. It has a typical extracellular LRR domain, transmembrane helix and intracellular serine / threonine kinase domain, which is consistent with the molecular characteristics of leucine-rich receptor kinase (LRR-RLK). The results of promoter cis-acting element prediction showed that the promoter region of the MsCEPR1 gene is enriched with adversity response elements, suggesting that it may be involved in adversity response. Real-time fluorescence quantitative analysis showed that the expression of the MsCEPR1 gene in different tissues at different stages is different. The research results revealed the molecular characteristics and expression patterns of MsCEPR1, providing a molecular biological basis for further research on its biological function mechanism.
[0044] (2) This application successfully constructed the overexpression vector pCAMBIA3301-MsCEPR1 based on homologous recombination. The overexpression vector was introduced into alfalfa using Agrobacterium-mediated infection. PCR verification using specific primers yielded alfalfa plants overexpressing MsCEPR1. This provides a key experimental system for studying the gene's function in root growth and development and phosphorus absorption, and enhances the available germplasm resources for molecular breeding of alfalfa.
[0045] (3) This application uses the wild type (WT) of alfalfa and strains (OE1, OE13) with different multiples of MsCEPR1 gene as materials, and sets two culture conditions of normal phosphorus (NP) and low phosphorus (LP) to compare the changes in growth parameters (plant height, root length, aboveground and root fresh weight), total phosphorus content and chlorophyll content of different strains. The experimental results show that low phosphorus stress significantly affects the growth of alfalfa: the aboveground growth of all strains is inhibited, while the root biomass shows compensatory growth. The MsCEPR1 overexpression strains show stronger tolerance to low phosphorus. Compared with the changes in plant height and aboveground part of WT plants under low phosphorus conditions, the inhibition amplitude of the overexpression strains is significantly reduced, indicating that the overexpression of the MsCEPR1 gene can effectively alleviate the inhibition of low phosphorus on aboveground growth and promote the growth of the root system. Total phosphorus content measurements also revealed that the overexpressing strains exhibited enhanced phosphorus absorption and transport efficiency. Expression levels of phosphorus-related genes further confirmed that MsCEPR1 promotes phosphorus absorption and transport by boosting the expression of these genes. Furthermore, chlorophyll content in older leaves of the overexpressing strains was significantly higher than that of the wild-type strain, suggesting a better ability to maintain photosynthetic system stability. Taken together, these results suggest that MsCEPR1 overexpression alleviates the growth inhibition of aboveground parts induced by phosphorus deficiency, promotes root growth, and regulates phosphorus absorption and transport in alfalfa by upregulating phosphorus-related genes. BRIEF DESCRIPTION OF THE DRAWINGS
[0046] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the following is a brief introduction to the drawings required for use in the embodiments. It should be understood that the following drawings only show certain embodiments of the present application and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without creative work.
[0047] Figure 1 The transmembrane structure of MsCEPR1 in this application;
[0048] Figure 2 Prediction of phosphorylation sites of MsCEPR1 for this application;
[0049] Figure 3 The protein secondary structure of MsCEPR1 in this application;
[0050] Figure 4 This is the conserved domain of MsCEPR1 in this application;
[0051] Figure 5 Diagram of the subcellular localization of MsCEPR1 protein in the cytoplasm for this application (Note: (a) shows the fluorescence signal distribution of p35S:MsCEPR1-GFP (green fluorescence) in tobacco protoplasts. The chloroplast channel is marked in red, and the merged image shows that the GFP signal is localized in the cytoplasm. Scale bar: 10 μm; (b) shows the negative control: the signal distribution of p35S-GFP (green fluorescence) in the same tissue, with no specific localization);
[0052] Figure 6 The expression patterns of MsCEPR1 in different tissues of ten-day-old seedlings and four-week-old seedlings in this application (Note: (a) shows the expression pattern of MsCEPR1 in different tissues of ten-day-old seedlings; (b) shows the expression pattern of MsCEPR1 in different tissues of four-week-old seedlings. Different letters indicate significant differences at the P < 0.05 level);
[0053] Figure 7 Genetic transformation and identification of alfalfa overexpressing the MsCEPR1 gene in this application (Note: (a) represents the map of the vector overexpressing the MsCEPR1 gene; (b)-(i) represent the tissue culture process of alfalfa transformed with the vector overexpressing the MsCEPR1 gene; (j) represents PCR identification of plants overexpressing the MsCEPR1 gene: "-" negative control (WT), "+" positive control (pCAMBIA3301-MsCEPR1); (k) represents the relative expression level of alfalfa-positive plants overexpressing the MsCEPR1 gene, OE1-OE13 represent alfalfa lines with different fold increases in MsCEPR1 expression, and different letters indicate significant differences between different lines at the P < 0.05 level);
[0054] Figure 8 Phenotypic analysis of alfalfa under low-phosphorus treatment in this application (Note: (a) represents the phenotype of alfalfa (WT, OE1, OE13) under normal phosphorus (NP) growth conditions; (b) represents the phenotype of alfalfa (WT, OE1, OE13) under low-phosphorus (LP) growth conditions; (c)-(f) represent the analysis of plant height (cm), root length (cm), aboveground fresh weight (g), and root fresh weight (g) of alfalfa (WT, OE1, OE13) under NP and LP; different letters indicate significant differences between different treatments at the P < 0.05 level);
[0055] Figure 9 This is the analysis of total phosphorus content in alfalfa under low phosphorus treatment (Note: different letters indicate significant differences between different treatments at the P < 0.05 level);
[0056] Figure 10 Analysis of chlorophyll content in old leaves of alfalfa under low-phosphorus treatment for this application (Note: (a) shows the phenotype of old leaves (3rd-4th leaves from the base) of alfalfa (WT, OE1, OE13) under normal phosphorus (NP) and low-phosphorus (LP) growth conditions; (b) shows the analysis of total chlorophyll content in old leaves of alfalfa (WT, OE1, OE13) under NP and LP; different letters in the figure indicate significant differences between different treatments at the P < 0.05 level);
[0057] Figure 11 The expression analysis of the phosphorus absorption and transport related genes in alfalfa of the present application is shown in Figure 2 (Note: (a) represents the relative expression of the phosphorus absorption and transport related gene PHO1 in leaves of different plant materials under normal phosphorus (NP) and low phosphorus (LP) conditions; (b) represents the relative expression of the phosphorus absorption and transport related gene PHR2 in leaves of different plant materials under normal phosphorus (NP) and low phosphorus (LP) conditions; (c) represents the relative expression of the phosphorus absorption and transport related gene PHT1 in leaves of different plant materials under normal phosphorus (NP) and low phosphorus (LP) conditions; different letters in the figure represent significant differences between different treatments at the P < 0.05 level). DETAILED DESCRIPTION
[0058] The present application will be further described below in conjunction with specific embodiments. The following description is merely a few embodiments of the present application and does not limit the present application in any form. Although the present application discloses the preferred embodiments below, it is not intended to limit the present application. Any person skilled in the art who, without departing from the scope of the technical solution of the present application, makes slight changes or modifications using the above disclosed technical content is equivalent to an equivalent implementation case and falls within the scope of the technical solution.
[0059] Unless otherwise specified, the raw materials in the examples of this application were purchased from commercial channels and used directly without any special treatment.
[0060] Unless otherwise specified, the analytical methods in the examples all adopt conventional settings and conventional analytical methods of instruments or equipment.
[0061] Example 1
[0062] 1. Analysis of MsCEPR1 Molecular Characteristics and Expression Patterns
[0063] (1) Materials and methods
[0064] 1. Test materials
[0065] Alfalfa "Zhongmu No. 4" and Nicotiana benthamiana were used as plant materials. Alfalfa "Zhongmu No. 4" was propagated and preserved by our laboratory, and Nicotiana benthamiana seed materials were purchased from Beijing Coolaibo Technology Co., Ltd.
[0066] 2. The test instruments, test reagents and culture medium formulas used are shown in Table 1, Table 2 and Table 3 respectively.
[0067] Table 1 Test instruments
[0068]
[0069]
[0070] Table 2 Test reagents
[0071]
[0072]
[0073] Table 3 LB medium formula
[0074] Reagents Dosage Yeast Extract 5g Tryptone 10g NaCl 10g agar powder 15g <![CDATA[ddH2O]]> To1L
[0075] 3. Cloning of the MsCEPR1 gene
[0076] (1) MsCEPR1 gene amplification
[0077] Total RNA was extracted from mature leaves of four-week-old alfalfa cultivar "Zhongmu 4" and converted to cDNA. The CDS sequence of the genomic MsCEPR1 gene (Msa.H.0177440) was used as a reference sequence, and Primer 5 was used to design and amplify MsCEPR1-F / R (wherein the sequence of MsCEPR1-F is shown in SEQ ID NO. 3: CAACACTTCAAATTCTTCTCTC; the sequence of MsCEPR1-R is shown in SEQ ID NO. 4: GAGACTGCTTATGTTCTTAGTTG). Using the converted cDNA as a template, the MsCEPR1 gene was amplified using Extaq enzyme. The reaction system is shown in Table 4.
[0078] Table 4 MsCEPR1 gene PCR amplification system
[0079] Reagents Reaction system ExTaq 0.3μL dNTPMix 4 μL 10×ExTaqBuffer 5μL MsCEPR1-F 2μL MsCEPR1-R 2μL cDNA 2μL <![CDATA[ddH2O]]> 34.7μL
[0080] The PCR amplification program was as follows: 95°C for 5 min, 95°C for 30 s, 52°C for 30 s, 72°C for 3 min 15 s, 29 cycles, and 72°C for 5 min. The PCR product was electrophoresed on a 1% agarose gel for 10 min to obtain an electrophoretic band for MsCEPR1.
[0081] (2) PCR product gel excision and recovery
[0082] Cut the target band into a clean centrifuge tube, weigh it, and add 3 volumes of GSB lysis buffer (provided with the kit). Transfer the entire liquid to the nucleic acid adsorption column. After standing at room temperature for 60 seconds, centrifuge at 10,000 × g for 60 seconds and completely remove the filtrate.
[0083] Inject 650 μL of WB wash buffer (provided with the kit) into the column and centrifuge at the same parameters (10,000 × g / 1 min). Repeat this step once for a total of two washes.
[0084] Spin the column for 2 minutes (10,000 × g) to ensure complete evaporation of any residual ethanol. Transfer the column to a new collection tube and dry it in an open, air-dried tube at room temperature for 5 minutes.
[0085] Accurately add 30 μL of preheated (65°C) sterile ultrapure water to the center of the adsorption membrane. Allow to permeate for 60 seconds. Then, collect the purified product by high-speed centrifugation (10,000 × g / 1 min). Determine the concentration using a spectrophotometer and store at -20°C for subsequent experiments.
[0086] (3) Ligation and transformation of cloning vector pTOPO-TA-MsCEPR1
[0087] Cloning vector ligation, ligation reaction: 37°C, 15 min, ligation system as shown in Table 5.
[0088] Table 5 pTOPO-TA-MsCEPR1 ligation system
[0089] Reagents Reaction system <![CDATA[ddH2O]]> 2μL MsCEPR1 2μL 10×Enhancer 0.5μL pTOPO-TA 0.5μL Total 5μL
[0090] After the ligation is completed, the ligation product is transformed into the colon competent cells. The operation method is as follows:
[0091] Add 5 μL of the ligation product to a 1.5 mL centrifuge tube containing 50 μL of freshly thawed E. coli competent cells and gently flick the tube to mix. Incubate on ice for 30 minutes, then heat shock in a 42°C water bath for 60 seconds. Immediately transfer to an ice bath for 3 minutes.
[0092] Add 500 μL of LB liquid to the clean bench and place in a constant temperature shaker at 37°C and 200 rpm for 1 h to restore cell activity;
[0093] Centrifuge at 4000 rpm for 1 min, remove part of the supernatant and keep 200 μL of the suspension, then evenly spread it on the surface of LB solid culture medium containing 100 mg / L ampicillin (Amp), and culture inverted at 37°C for 12-16 hours until single colonies are formed.
[0094] (4) Bacterial liquid identification and sequencing
[0095] The resuspended liquid of a single colony was used as a PCR template, and PCR identification was performed using the universal primers M13F (sequence shown in SEQ ID NO. 7: TGTAAAACGACGGCCAGT) and M13R (sequence shown in SEQ ID NO. 8: CAGGAAACAGCTATGACC) on the vector. The reaction system is shown in Table 6.
[0096] Table 6 pTOPO-TA-MsCEPR1 bacterial solution PCR reaction system
[0097] Reagents Reaction system <![CDATA[ddH2O]]> 3μL pTOPO-TA-MsCEPR1 bacterial suspension 1 μL 2×PCRMix 5μL M13F 0.5μL M13R 0.5μL Total 10 μL
[0098] The PCR amplification program was as follows: 95°C for 5 min; 95°C for 30 s; 52°C for 30 s; 72°C for 3 min 15 s; 34 cycles; and 72°C for 5 min. PCR products were analyzed by 1% high-resolution agarose gel electrophoresis at 120 V for 10 min. Positive clones whose band size matched the expected insert were selected and submitted to Qingke Bio for bidirectional sequencing to obtain the MsCEPR1 reference sequence.
[0099] 4. Bioinformatics analysis of MsCEPR1 gene
[0100] Protein characteristics, including amino acid number, isoelectric point, molecular weight, instability coefficient, adipic acid coefficient, and protein hydrophilicity, were analyzed using EXPASY software (https: / / www.expasy.org / ) (DUVAUD et al., 2021). Transmembrane topology was predicted using TMHMM Server v2.0 (https: / / services.healthtech.dtu.dk / services / TMHMM-2.0 / ), which is based on the Hidden Markov Model algorithm. Transmembrane domains were predicted using the online website TMHMM-2.0 (https: / / services.healthtech.dtu.dk / services / TMHMM-2.0 / ), phosphorylation sites were analyzed using the online analysis website (https: / / npsa.lyon.inserm.fr / ) (COMBET et al., 2000), and protein secondary structure was predicted using the online website (https: / / web.expasy.org / protscale / ) (GASTEIGER et al., 2003). Promoter cis-acting elements were predicted using PlantCARE (http: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ) (ROMBAUTS et al., 1999). The results were organized and simplified according to different promoter categories (light-responsive elements, hormone and stress-related elements, and growth and development-related elements) before statistical analysis. Conserved domains were predicted using the online analysis software SMART (https: / / smart.embl.de / ) (LETUNIC et al., 2021).
[0101] 5. Subcellular localization of MsCEPR1 protein
[0102] (1) Expression vector construction
[0103] S1, vector digestion
[0104] The enzyme digestion system is shown in Table 7.
[0105] Table 7p35S: GFP vector enzyme digestion system
[0106] Reagents Reaction system Nuclease-free Water 13μL 10×Buffer 2μL BsaI / Eco31I 1 μL p35S:GFP 4 μL Total 20 μL
[0107] After reacting at 37°C for 1 hour, the vector enzyme digestion product was purified using a PCR purification kit and labeled as p35S:GFP-Cut for the next recombination reaction.
[0108] The specific steps for PCR product purification are as follows:
[0109] Add 3 times the volume of GSB dissolution buffer (provided in the kit) based on the measured mass;
[0110] Transfer all the liquid to the nucleic acid adsorption column, let it stand at room temperature for 60 seconds, and then centrifuge it at 10,000 × g for 60 seconds to completely remove the filtrate;
[0111] Inject 650 μL of WB wash buffer (specific to the kit) into the adsorption column and centrifuge at the same parameters (10,000 × g) for washing. Repeat this step once for a total of two washing processes.
[0112] Spin the column for 2 minutes (10,000 × g) to ensure that the residual ethanol is completely evaporated. Transfer the adsorption column to a new collection tube and dry it under ventilation at room temperature for 5 minutes with the lid open.
[0113] Accurately add 30 μL of preheated (constant temperature at 65°C) sterile ultrapure water to the center of the adsorption membrane. After standing for 60 seconds, the purified product was collected by high-speed centrifugation (10,000×g). The concentration was measured using a spectrophotometer and stored at -20°C for subsequent experiments.
[0114] S2. Recombination reaction
[0115] The reaction system is shown in Table 8.
[0116] Table 8p35S:MsCEPR1-GFP connection system
[0117] Reagents Reaction system Nuclease-free Water 0μL Biorun2×EasyCloneMix 10 μL MsCEPR1 5μL p35S:GFP-Cut 5μL Total 20 μL
[0118] After reacting at 37°C for 30 minutes, the ligation product p35S:MsCEPR1-GFP was transformed into colon competent cells using the same procedure as described above.
[0119] S3, p35S:GFP-MsCEPR1 colony PCR identification
[0120] Ten plaques were selected and re-inoculated into 1.5 mL centrifuge tubes for PCR identification. The primers used were p35S:MsCEPR1-GFP-F / R (wherein the sequence of p35S:MsCEPR1-GFP-F is shown in SEQ ID NO. 9: TTCATTTGGAGAGAACACGGGGGAC; and the sequence of p35S:MsCEPR1-GFP-R is shown in SEQ ID NO. 10: GGATGGTGGAATTTGACCATG). The reaction system is shown in Table 9.
[0121] Table 9p35S:MsCEPR1-GFP bacterial solution PCR identification reaction system
[0122] Reagents Reaction system Nuclease-free Water 9.5 μL BiorunMagicPCRMix 12.5μL p35S:MsCEPR1-GFP-F 1 μL p35S:MsCEPR1-GFP-R 1 μL Template 1 μL Total volume 25 μL
[0123] PCR amplification protocol: 94°C for 5 minutes; 94°C for 30 seconds; 50°C for 45 seconds; 72°C for 174 seconds; 34 cycles; 72°C for 10 minutes; 16°C for 30 minutes. After PCR, the target band was confirmed to be a fragment of approximately 662 bp using 1% agarose gel electrophoresis. 200 μL of the bacterial solution corresponding to the positive band was sent to the company for sequencing, and the remaining solution was temporarily stored in a refrigerator at 4°C. After confirming the correct sequence, the corresponding bacterial solution was stored in 40% glycerol and re-inoculated into 50 mL of LB medium containing 50 mg / L Kan resistance. The culture was shaken at 37°C for approximately 8 hours. After that, the plasmid was extracted and named p35S:MsCEPR1-GFP.
[0124] The plasmid extraction method is as follows:
[0125] S1. Transfer the bacterial suspension to a 50 mL centrifuge tube and centrifuge at maximum speed for 10 min. Remove the supernatant.
[0126] S2. Inject 250 μL of pre-cooled Solution I (stored at 4°C) into the bacterial pellet and vortex vigorously for 20 seconds to ensure that the bacteria are completely resuspended.
[0127] S3. Slowly add 250 μL Solution II and mix gently for 5 times (avoid violent shaking). Stop when the solution becomes transparent and viscous. The whole process should be completed within 5 minutes.
[0128] S4. Immediately inject 350 μL of Solution III and quickly invert the tube 7 times to mix until a flocculent precipitate appears.
[0129] S5. Place the reaction system at room temperature and centrifuge at 10,000×g for 10 minutes.
[0130] S6. Carefully pipette the supernatant into an adsorption column (equipped with a 2 mL collection tube) and centrifuge at 10,000 × g for 1 minute.
[0131] S7. After the adsorption column is reset, add 500 μL of HB Buffer and centrifuge at 10,000 × g for 1 minute to remove impurities.
[0132] S8. Inject 700 μL of WB washing solution and centrifuge at 10,000 × g for 1 minute. Repeat twice.
[0133] S9. Centrifuge the adsorption column at 13,000 × g for 2 minutes to ensure that the ethanol residue on the membrane surface is completely evaporated.
[0134] S10. Transfer the purification column to a sterile 1.5 mL centrifuge tube, add 40 μL of preheated (65°C) sterile water, let it stand for 2 minutes, and then centrifuge at 10,000×g for 1 minute to elute.
[0135] S11. The collected plasmid deoxyribonucleic acid (DNA) solution was immediately subjected to concentration determination and aliquoted for long-term storage at -20°C.
[0136] (2) Transient transfection of tobacco protoplasts
[0137] S1. Plant material cultivation
[0138] Take Nicotiana benthamiana seedlings grown in a constant temperature incubator at 25°C for 20 days, and pick healthy expanded leaves for later use.
[0139] S2. Protoplast release
[0140] Place leaf tissue in 10 mL of enzymatic hydrolysis solution (1.5% Cellulase R10, 0.4% Macerozyme R10, 0.4 M Mannitol, 20 mM KCl, 10 mM MES, adjust pH to 5.8, heat at 55°C for 10 min, invert three times to mix, cool to room temperature, add 10 mM CaCl2, 0.1% BSA, add ddH2O to 10 mL, and filter sterilize with a 0.22 μm filter), ensuring the tissue is completely immersed. Incubate at 24°C in the dark for 4 hours.
[0141] S3. Protoplast purification
[0142] After enzymatic hydrolysis, the mixture was filtered through a 40 μm sterile cell sieve, transferred to a 15 mL centrifuge tube, and centrifuged at 300 rpm for 3 min to retain the precipitated protoplasts.
[0143] S4. Washing and resuspension
[0144] Add 10 mL of pre-cooled W5 solution (154 mM NaCl, 125 mM CaCl2, 2 mM KH2PO4, 2 mM MES, 5 mM Glucose, adjust pH to 5.8, add ddH2O to 100 ml, sterilize at 110 ° C, and store at 4 ° C), resuspend and centrifuge at 300 rpm for 3 minutes (centrifugation temperature 4-25 ° C), and repeat washing twice. According to experimental requirements, add 2 mL of MMG solution (0.4 M Mannitol, 15 mM MgCl2 6H2O, 4 mM MES, adjust pH to 5.8, add ddH2O to 10 ml) to resuspend the protoplasts and adjust the final concentration to 2 × 10 5 Microscopic examination confirmed that the protoplasts were intact (round and full, with a rupture rate of <5%).
[0145] S5. Preparation of DNA-protoplast complex
[0146] Mix 100 μL of protoplast suspension with 10 μL of plasmid DNA (p35S:MsCEPR1-GFP / p35S-GFP). Add an equal volume of 40% PEG 4000 solution (0.2 M Mannitol, 100 mM CaCl2, 40% PEG 4000, adjust pH to 5.8, and add ddH2O to 10 ml). Gently vortex to mix, and let stand at room temperature for 10-15 minutes.
[0147] S6. Transformation termination and cultivation
[0148] Terminate the reaction by adding 1 mL of pre-chilled W5 solution, collect the protoplasts by centrifugation at 300 rpm for 3 minutes, and discard the supernatant. Wash twice with 1 mL of W5 solution, and finally resuspend in 1 mL of W5 solution. Incubate in the dark at 25°C for 24 hours.
[0149] S7. Fluorescence detection
[0150] After incubation, the supernatant was removed by centrifugation, and about 100 μL of the protoplast suspension was retained and dropped onto a glass slide. The green fluorescent protein (GFP) signal was immediately observed under a fluorescence microscope or a laser confocal microscope (GFP excitation wavelength 488 nm, emission wavelength 510 nm; chloroplast excitation light 640 nm, emission light 675 nm).
[0151] (3) Analysis of the expression pattern of MsCEPR1 gene
[0152] Heatmaps of gene expression patterns were created using the heatmap program. RNA was extracted using the Eastep Super total RNA extraction kit (Promega Biotechnology, Shanghai) and reverse-transcribed into complementary deoxyribonucleic acid (cDNA) using HiScript III All-in-one RT SuperMixPerfect for qPCR (Novagen, Nanjing). The relative expression of MsCEPR1 was determined by real-time fluorescence quantitative analysis using primers qMsCEPR1-F / R (where qMsCEPR1-F is represented by SEQ ID NO. 11: GTTTTGCAAGCAAGAGGTGGA; qMsCEPR1-R is represented by SEQ ID NO. 12: TCAATTGGCTTCCTCCCAGT). The experiment was performed using a Bio-Rad CFX96 fluorescence quantitative PCR instrument. The reaction system consisted of 10 μL Taq Pro Universal SYBR qPCR Master Mix, 0.4 μL forward primer, 0.4 μL reverse primer, 2 μL cDNA, and 7.2 μL sterile water. The reaction program was 95°C for 2 min; 95°C for 5 s, 60°C for 30 s, and 40 cycles. A melting curve was set at the end of the reaction to confirm the specificity of the product. Each treatment group contained three independent biological replicates. Based on the original Ct value of real-time quantitative PCR, 2 -ΔΔCt The relative gene expression was calculated by the method.
[0153] (2) Results and Analysis
[0154] 1. MsCEPR1 gene sequence
[0155]
[0156] 2. Molecular characteristics of MsCEPR1 protein
[0157] In order to understand the basic characteristics of MsCEPR1 protein, the molecular characteristics of MsCEPR1 protein were predicted. The prediction results showed that the molecular formula of MsCEPR1 protein is C 4849 H 7654 N 1254 O 1410 S 40 , with a molecular weight of 107362.07Da and an isoelectric point of 8.33. The amino acid composition has the highest proportion of leucine (Leu) (13.6%), followed by serine (Ser) (11.5%). The total number of negatively charged amino acid residues is 88, and the total number of positively charged amino acid residues is 94. The instability coefficient is 36.70, and the fat index is 99.64, predicting that the MsCEPR1 protein is unstable. The hydrophilicity map shows that the MsCEPR1 protein exhibits typical hydrophilic characteristics, with an average hydrophobicity index of -0.015. The transmembrane structure predicts that the MsCEPR1 protein has two transmembrane helices, indicating that MsCEPR1 is a membrane-bound protein kinase ( Figure 1 ). Phosphorylation site prediction identified 93 potential phosphorylation sites, including 65 serine phosphorylation sites, 19 threonine phosphorylation sites, and 9 tyrosine phosphorylation sites ( Figure 2 The secondary structure analysis of MsCEPR1 protein showed that it is mainly composed of three parts, including 33.26% (321 amino acids) of alpha helix, 55.23% (533 amino acids) of random coil, and 11.50% (111 amino acids) of extended strand (Extended strand) ( Figure 3 ).
[0158] 3. Analysis of conserved domains of MsCEPR1 protein
[0159] To further predict the function of MsCEPR1 protein, the conserved domain of the protein was further analyzed. The results showed that ( Figure 4), the protein has 7 leucine-rich repeats (LRRs), located at 94aa-117aa, 164aa-190aa, 238aa-263aa, 287aa-311aa, 335aa-359aa, 479aa-502aa, 503aa-527aa, 1 protein kinase domain (S-TKc) (592aa-611aa), and 2 transmembrane domains (654aa-934aa), which basically meet the structural characteristics of leucine-rich receptor protein kinases.
[0160] 4. Subcellular localization of MsCEPR1 protein
[0161] To obtain the localization information of MsCEPR1 protein in cells, the p35S:MsCEPR1-GFP vector was transiently expressed in tobacco protoplasts to observe the localization of the protein. Microscopic observation showed that the GFP fluorescence signal was mainly distributed in the cytoplasm, showing obvious granular aggregation ( Figure 5 (a)). Compared with the fluorescence distribution of the empty GFP control group ( Figure 5 In (b), the specific localization pattern of p35S:MsCEPR1-GFP suggests that it may be involved in the reception and transmission of extracellular signals.
[0162] 5. MsCEPR1 gene promoter cis-acting element
[0163] To further analyze the possible biological functions of MsCEPR1 gene, the cis-acting elements in the promoter region of this gene were analyzed. It was found that its promoter region was enriched with a variety of hormone response and adversity-related regulatory modules: including (1) stress response elements - defense and stress response elements (TC-rich repeats), drought response elements (MBS); (2) plant hormone response elements - abscisic acid response element (ABRE), gibberellin response elements (P-box, TATC-box), methyl jasmonate response element (CGTCA-motif, TGACG-motif); (3) light response elements (Box 4, G-Box, 3-AF1 binding site), etc. (see Table 10), indicating that this gene may be involved in some abiotic stress responses.
[0164] Table 10 Analysis of cis-acting elements in MsCEPR1 promoter
[0165]
[0166]
[0167] 6. MsCEPR1 gene expression pattern
[0168] To explore the expression pattern of MsCEPR1 gene in different tissues of alfalfa at different growth stages, the relative expression levels of MsCEPR1 gene in different tissues of ten-day-old seedlings and four-week-old seedlings were specifically analyzed. The specific results are as follows: (1) In ten-day-old seedlings, the expression level of MsCEPR1 gene was lowest in true leaves, and the expression level in epicotyl was highest, which was 4.12 times that of true leaves, followed by hypocotyl, root tip and cotyledon, which were 3.61 times, 2.92 times and 2.41 times that of true leaves, respectively ( Figure 6 (a) in the figure suggests that it may play an important role in hypocotyl elongation and primary vascular tissue development; (2) At the four-week-old seedling stage, the expression pattern of MsCEPR1 gene changed, with the highest expression level in mature leaves, which was 2.38 times that of young leaves, stems and lateral roots, followed by the main root (1.89 times) ( Figure 6 (b)), this expression pattern may be related to its participation in root symbiotic signal transduction.
[0169] 2. Obtaining genetic material overexpressing MsCEPR1
[0170] (1) Materials and methods
[0171] 1. Test materials and treatment
[0172] Alfalfa variety "Zhongmu No. 4" was used as the plant material and was provided by the laboratory. Alfalfa disinfection and culture: Place the seeds in a 50mL centrifuge tube, add 40mL of ddH2O, and vortex for 2 minutes × 3 times. Then, disinfect with 75% ethanol for 5 minutes, rinse again with ddH2O 3 times, transfer to 30% sodium hypochlorite for 10 minutes, and finally rinse with ddH2O 3 times. After disinfection, spread the seeds flat on sterilized filter paper, remove the surface moisture, and transfer to MSO solid medium for dark culture (wrapped in tin foil and placed in a 4°C refrigerator for 3 days). After dark culture, transfer to a light incubator for 3 days. At this time, the seedling hypocotyl is about 2 cm long. Infection is performed after two cotyledons have grown but the seed coat has not completely fallen off.
[0173] 2. The reagents and culture medium formulas used in the experiments are shown in Tables 11 to 15 respectively.
[0174] Table 11 Test Reagents
[0175]
[0176]
[0177] Table 12 YEB formula
[0178] Reagents Dosage / L yeast extract 1g <![CDATA[MgSO4·7H2O]]> 1g sucrose 5g Tryptone 10g <![CDATA[ddH2O]]> to1L
[0179] Table 13SH3a formulation
[0180]
[0181]
[0182] Table 14MSBK formula
[0183] Reagents Dosage / L MSbasalmedium 4.43g sucrose 30g Kinetin 1mL (1mg / mL) 6-BA 500 μL (1 mg / mL) <![CDATA[ddH2O]]> to1L
[0184] Table 15SH9a formulation
[0185] Reagents Dosage / L S&H Modified basal medium 13.2g sucrose 10g Iron salts 1mL(1000×) vitamin 1mL(1000×) Myo-insitol 2mL (50mg / mL) <![CDATA[ddH2O]]> to1L
[0186] 3. Construction of MsCEPR1 overexpression gene expression vector
[0187] (1) Gene cloning
[0188] Using the previously constructed pTOPO-TA-MsCEPR1 recombinant plasmid as a template and p3301-MsCEPR1-F / R as primers (wherein the sequence of p3301-MsCEPR1-F is shown in SEQ ID NO.5: GAACACGGGGGACTCTTGACCATGAACCATCATCAACCATT; the sequence of p3301-MsCEPR1-R is shown in SEQ ID NO.6: AGAAATTTACCCTCAGATCTACCATTAACTCAAATGGTTTCT), the MsCEPR1 gene fragment containing the NcoⅠ restriction site was amplified and named p3301-MsCEPR1. The PCR product was recovered and purified.
[0189] (2) Enzyme digestion of pCAMBIA3301 vector
[0190] The enzyme digestion system is shown in Table 16.
[0191] Table 16 pCAMBIA3301 vector enzyme digestion system
[0192] Reagent name Reaction system <![CDATA[ddH2O]]> 35.1μL pCAMBIA3301 8.9μL 10×Buffer 5μL NcoⅠ enzyme 1 μL Total 50 μL
[0193] Enzyme digestion reaction conditions: 37°C, 2h.
[0194] (3) Recombination reaction
[0195] The recombination reaction system is shown in Table 17.
[0196] Table 17p3301-MsCEPR1 recombination reaction
[0197] Reagent name Reaction system <![CDATA[ddH2O]]> 4 μL pCAMBIA3301 2μL 2 × SeamlessMasterMix 3μL p3301-MsCEPR1 1 μL Total 10 μL
[0198] Ligation reaction conditions: 50°C, 30 min. After ligation, the competent cells were transformed and plated in LB medium containing 50 mg / L Kan, as described above.
[0199] (4) PCR identification and sequencing of bacterial liquid
[0200] Single clones were picked and identified by PCR using p3301-MsCEPR1-F (sequence shown in SEQ ID NO.5: GAACACGGGGGACTCTTGACCATGAACCATCATCAACCATT) and GUS-R primer (sequence shown in SEQ ID NO.29: AGTTTTTTGATTTCACGGGTTGGGG). Positive single clones were sent to Qingke Biotechnology Company for sequencing. The correct clones were named pCAMBIA3301-MsCEPR1 according to the sequencing results. The bacterial solution was preserved in a ratio of 1:1 (bacterial solution: glycerol) using 40% glycerol and placed in a -80°C refrigerator.
[0201] 4. Transform the expression vector into Agrobacterium
[0202] Extract the pCAMBIA3301-MsCEPR1 plasmid and transform it into Agrobacterium EHA105. The specific operation method is as follows:
[0203] (1) Place 50 μL of EHA105 competent cells on the surface of an ice box and thaw at low temperature.
[0204] (2) Use a micropipette to introduce the target plasmid DNA (1-5 μL) into the thawed competent cell suspension and gently pipette to mix.
[0205] (3) Ice bath for 10 minutes, quick freeze in liquid nitrogen for 5 minutes, water bath at 37°C for 5 minutes, and ice bath for 5 minutes.
[0206] (4) Inject 700 μL of non-resistant YEB liquid and resuscitate and culture at 28°C in a constant temperature shaker at 200 rpm for 2 hours.
[0207] (5) Centrifuge at 4000 rpm for 1 min, remove part of the supernatant, and apply the remaining 200 μL to double-resistance YEB solid culture medium (50 mg / L R-Ref + 50 mg / L Kan), and culture inverted in a dark incubator at 28°C for 48 hours.
[0208] (6) A single clone with a diameter of 2-3 mm was selected and inoculated into 1 mL YEB liquid culture medium (50 mg / L R-Lif + 50 mg / L Kan), and cultured with shaking at 28°C for 12 h.
[0209] (7) PCR identification was performed using primers p3301-MsCEPR1-F and GUS-R. After confirming the positive bacterial solution, the bacteria were preserved and placed in a -80°C refrigerator for later use.
[0210] 5. Genetic transformation and tissue culture methods
[0211] Agrobacterium tumefaciens-mediated leaf disc transformation:
[0212] Bacterial solution preparation:
[0213] (1) Take the frozen EHA105 engineered strain of pCAMBIA3301-MsCEPR1 and inoculate it into 20 mL of YEB liquid medium containing 50 mg / L R-Ref + 50 mg / L Kan and shake culture at 28 °C (200 rpm) until the OD 600 ≈0.8.
[0214] (2) Take the bacterial solution from the previous step for secondary activation, activate it in 50mL YEB selective culture medium (containing Rif 50mg / L + Kan 50mg / L), and culture it at 28℃ with shaking (200rpm) until the OD 600 ≈0.8.
[0215] Explant preparation:
[0216] (1) Select young leaves of alfalfa "Zhongmu No. 4", shake them with 10% NaClO solution for 10 minutes, and rinse them with sterile ddH2O 5 times (1 minute each time).
[0217] (2) Immerse the sterilized leaves in SH3a culture medium and ultrasonicate until the leaf margins turn dark green.
[0218] Vacuum co-culture:
[0219] (1) Incubate the bacterial suspension with the pretreated leaves and place them in a vacuum infiltration system for 10 minutes.
[0220] (2) Incubate at room temperature in the dark with low-speed shaking (70 rpm) for 15 min.
[0221] (3) Use sterile filter paper to absorb the surface moisture and apply the back of the leaf to SH3a solid culture medium.
[0222] (4) Pre-cultivation in dark conditions for 24 hours.
[0223] Selective regeneration culture:
[0224] (1) The leaves from the previous step were washed 3-5 times with water containing 2 mg / L cefotaxime (Cef) and then applied to SH3a solid medium containing resistance (2 mg / L Cef + 2 mg / LPPT or 5 mg / L HygB), and subcultured every 14 days.
[0225] (2) After callus growth, the formed callus tissue was transferred to MSBK differentiation medium (2 mg / L Cef + 2 mg / LPPT or 5 mg / L HygB) for light culture.
[0226] (3) When the callus tissue differentiated into buds with green buds, transfer them to SH9a rooting medium (2 mg / L Cef + 2 mg / L PPT or 5 mg / L HygB).
[0227] (4) After the callus tissue has completed rooting and the seedlings have initially formed, the seedlings are transferred to vermiculite and hardened. When the seedlings are in good condition, leaves are taken for positive seedling identification.
[0228] 6. Identification of alfalfa plants overexpressing the MsCEPR1 gene
[0229] Alfalfa leaves were collected for DNA and RNA identification. DNA identification was performed using 35S-F (sequence shown in SEQ ID NO. 30: GCACAATCCCACTATCCTTCG) and MsCEPR1-MR primers (sequence shown in SEQ ID NO. 31: AAAATATAAAAGTTTACCTCCTTGACAGACATGTTCTGGCAAAG). RNA identification used internal reference gene primers MsActin-F / R (wherein, the sequence of MsActin-F is shown in SEQ ID NO. 32: CAAAAGATGGCAGATGCTGAGGAT; the sequence of MsActin-R is shown in SEQ ID NO. 33: CATGCACCAGTATGACGAGGTCG). The MsCEPR1 quantitative primer was qMsCEPR1-F / R. The specific method was the same as described above.
[0230] (2) Results and Analysis
[0231] Obtaining alfalfa materials overexpressing MsCEPR1 gene:
[0232] To analyze gene function, the expression vector pCAMBIA3301-MsCEPR1 ( Figure 7 (a) in the figure). Using Agrobacterium-mediated leaf disc transformation, the vector overexpressing the MsCEPR1 gene was transferred into alfalfa and transgenic alfalfa plants were obtained by tissue culture ( Figure 7 (b)-(i) in the figure). The transformed strains were tested using the vector pCAMBIA3301-MsCEPR1 specific primers to confirm that the target bands were amplified in the transformed strains. The statistical positive rates were approximately 92.8% ( Figure 7(j) in the figure). Some lines were selected for real-time fluorescence quantitative analysis. The results showed that the expression of MsCEPR1 gene in transgenic alfalfa lines was upregulated to varying degrees ( Figure 7 (k)). The expression of MsCEPR1 in the transgenic lines was upregulated to varying degrees (1.93-13.02 times) compared with the wild type, indicating that the MsCEPR1 gene was successfully overexpressed.
[0233] MsCEPR1 regulates phosphorus absorption
[0234] (1) Materials and methods
[0235] 1. Plant materials and processing
[0236] Alfalfa "Zhongmu No. 4" and the above-mentioned MsCEPR1 overexpressing alfalfa lines (OE1 and OE13) were used as plant materials and cultured in the laboratory. Low phosphorus treatment was performed using alfalfa with the same growth state that had been hydroponically cultivated with Hoagland's nutrient solution for three weeks. Normal phosphorus growth conditions (NP, 1000 μmol·L) were set. -1 KH2PO4) and low phosphorus growth conditions (LP, 50 μmol·L - 1 KH2PO4) groups, and the phenotypes were observed and determined after 14 days of growth.
[0237] 2. The reagents used are shown in Table 18.
[0238] Table 18 Test Reagents Used
[0239] Test reagents brand supplier 500×Low-Phosphorus Improved Hoagland Nutrient Solution Chinook Wuhan Liborui Biotechnology Co., Ltd. sulfuric acid Southern Examination Nanjing Chemical Reagent Co., Ltd. hydrogen peroxide Southern Examination Nanjing Chemical Reagent Co., Ltd. Potassium antimony tartrate Southern Examination Nanjing Chemical Reagent Co., Ltd. Ammonium molybdate Southern Examination Nanjing Chemical Reagent Co., Ltd. ascorbic acid Maclean Shanghai MacLean Biochemical Technology Co., Ltd. Dinitrophenol indicator Southern Examination Nanjing Chemical Reagent Co., Ltd. sodium carbonate Southern Examination Nanjing Chemical Reagent Co., Ltd.
[0240] 3. Chlorophyll content determination
[0241] Weigh 0.15g of alfalfa leaves (the 3rd to 5th leaves from the root) and chop them into 10mL of 95% ethanol. Cover with tin foil and keep in the dark for 48h until the leaves are completely decolorized. Shake well after decolorization. Use a spectrophotometer to measure the OD values at 665nm and 649nm, record A665 and A649 respectively, and use 95% ethanol as a blank control. After the measurement is completed, use formula (1), formula (2), and formula (3) to calculate the chlorophyll a concentration, chlorophyll b concentration, and total chlorophyll concentration, and finally use formula (4) to calculate the chlorophyll content (mg / g). The calculation formula is as follows:
[0242] Chlorophyll a concentration (Chl a):
[0243] C Chla (mg / L)=12.21×A 665 -2.81×A 649 Formula (1)
[0244] Chlorophyll b concentration (Chl b):
[0245] C Chlb (mg / L)=24.96×A 649 -7.32×A 665 Formula (2)
[0246] Total Chlorophyll Concentration (Total Chl):
[0247] C TotalChl (mg / L) = C Chla +C Chlb Formula (3)
[0248] Chlorophyll content (mg / g):
[0249] Chlorophyll content (mg / g) = C Total Chl (mg / L)×0.01L / 0.15g Formula (4)
[0250] 4. Determination of total phosphorus content
[0251] Refer to NY / T 2017-2011 and use sulfuric acid digestion-molybdenum antimony colorimetry to determine total phosphorus content. The specific operation method is as follows:
[0252] (1) Sample pretreatment and digestion
[0253] Accurately weigh 0.2000g of dried alfalfa (ground and passed through a 40-mesh sieve) into a 100mL digestion tube. Add 1mL of deionized water to moisten the sample. Add 5mL of concentrated sulfuric acid (super-pure). Vortex to mix thoroughly, then slowly inject 2mL of 30% hydrogen peroxide solution into the tube in two separate injections. Allow the mixture to stand between each addition until the reaction ceases.
[0254] Cover the glass funnel and place it in a temperature-controlled digestion device. Gradually increase the temperature to 380°C for digestion. Observe the state of the digestion solution: when the solid is completely dissolved, the solution turns brown, and white sulfuric acid smoke is obvious, stop heating. After the digestion tube cools to room temperature, add hydrogen peroxide solution dropwise (the total amount should be controlled within 6-10 mL). Repeat the digestion until the solution is clear and transparent. Continue heating for 5 minutes to decompose the residual oxidant.
[0255] After cooling, the digestion solution was transferred to a 100 mL volumetric flask, fixed to volume, and filtered through medium-speed quantitative filter paper to obtain the test solution A (a blank control solution was prepared simultaneously).
[0256] (2) Standard curve configuration
[0257] Transfer 0, 2, 4, 6, 8, and 10 mL of the 5 mg / L phosphorus standard stock solution to six 50 mL volumetric flasks. Add an equal amount of blank digestion solution to each flask as to the sample. Add 1 to 2 drops of 0.2% dinitrophenol indicator. Adjust the pH to a slightly yellowish color by gradually adding 240 g / L sodium carbonate solution. Back-titrate with 2 mol / L sulfuric acid until colorless.
[0258] Quantitatively add 5 mL of molybdenum antimony anti-mixing color developing reagent, adjust to volume, and incubate in the dark for 30 min (ambient temperature ≥ 15°C). Measure the absorbance at 700 nm using a UV-visible spectrophotometer, adjust the zero value using a blank solution, and establish a standard curve of phosphorus concentration (0-1.0 mg / L)-absorbance.
[0259] (3) Sample color development and determination
[0260] Pipette an appropriate amount of test solution A into a 50mL volumetric flask, dilute to 30mL, and add 2-3 drops of dinitrophenol indicator. Adjust the solution with 10% sodium carbonate and 5% sulfuric acid until the indicator changes color (slightly yellow to colorless). Accurately add 5mL of molybdenum antimony anti-colorimetric reagent, dilute to volume, and develop the color at room temperature in the dark for 30 minutes.
[0261] The absorbance of the sample was measured at a wavelength of 700 nm using a 1 cm optical path quartz cuvette, and the phosphorus content was calculated based on the standard curve.
[0262] (4) Data correction and calculation, using formula (5)
[0263] Phosphorus content calculation:
[0264] P(%)=(C×V×D) / (m×10^6)×100 Formula (5)
[0265] Where C represents the concentration corresponding to the standard curve (mg / L), V represents the volume of the colorimetric solution (mL), D represents the aliquot multiple (total fixed volume / colorimetric aliquot volume), and m represents the sample mass (g).
[0266] 5. Determination of expression levels of genes related to phosphorus transport and absorption
[0267] RNA was extracted from leaves of wild-type (WT) and MsCEPR1-overexpressing (OE1, OE13) plants treated with phosphorus deficiency for 14 days, and the expression levels of phosphorus transport and uptake-related genes (PHO1, PHR2, and PHT1) were determined using real-time fluorescence quantitative analysis. The primers used are as follows:
[0268] qMsPHO1-F: GGTTGGGTCAATGGGTTGTGC (SEQ ID NO. 34);
[0269] qMsPHO1-R: GCACAACCATTGACCCAACC (SEQ ID NO. 35);
[0270] qMsPHR2-F: AGACCCAGGTTTCACAGCAG (SEQ ID NO. 36);
[0271] qMsPHR2-R: AAGTTCTGGAGTCCAACGCA (SEQ ID NO. 37);
[0272] qMsPHT1-F: CATGCTTTTAAGGCTCCGCC (SEQ ID NO. 38);
[0273] qMsPHT1-R: GCGCTGCTTGTTTTTGCATTC (SEQ ID NO. 39).
[0274] 6. Data statistics and analysis
[0275] SPSS23 software was used to perform one-way analysis of variance (ANOVA) and the least significant difference method (LSD, P < 0.05) was used to analyze the significant differences. Graphpad Prism 9 was used to draw the bar graphs.
[0276] (2) Results and Analysis
[0277] 1. MsCEPR1 overexpression alleviates the inhibitory effect of low phosphorus stress on alfalfa growth
[0278] To study the effect of overexpression of MsCEPR1 on phosphorus absorption in alfalfa, this study compared the growth parameters (plant height, root length, and fresh weight of aboveground and root parts) of different strains by setting normal phosphorus (NP) and low phosphorus (LP) culture conditions ( Figure 8 (a) and (b)). Under NP conditions, there were no significant differences in plant height, root length, and aboveground and root fresh weight between the wild-type (WT) and overexpressing strains (OE1 and OE13), indicating that MsCEPR1 overexpression did not affect basal growth. After 14 days of low-P treatment, all strains exhibited a P-stress response pattern, with suppressed aboveground growth and development, a significant decrease in plant height, a significant decrease in aboveground fresh weight, and an increase in root fresh weight.
[0279] Low phosphorus stress inhibited the growth of all strains, but overexpression strains OE1 and OE13 showed stronger tolerance. In terms of plant height, under low phosphorus treatment, the plant height of WT was 29.33 cm, a decrease of 20.21% compared with NP, while the plant heights of OE1 and OE13 were 32.58 cm and 31.30 cm, respectively, a decrease of 13.13% and 16.87% compared with normal conditions ( Figure 8 (c)). In addition, the change trend of the aboveground fresh weight was more significant. The aboveground fresh weight of WT was 1.242 g, which was 20.84% lower than that of NP, while that of OE1 and OE13 were 1.41 g and 1.40 g, respectively, which were 12.67% and 11.24% lower than those under normal conditions, indicating that the growth and development of the overexpression lines OE1 and OE13 were less inhibited under low phosphorus conditions ( Figure 8 (e)). Under low phosphorus stress, the root lengths of WT, OE1, and OE13 showed no significant difference compared to normal conditions ( Figure 8 (d) in the figure), but the fresh weight of the roots increased significantly, and the increase in OE1 and OE13 was greater than that in the wild type. The fresh weight of the roots of WT increased by 17.93% (0.36g), while that of OE1 and OE13 increased by 27.05% (0.41g) and 29.29% (0.42g), respectively ( Figure 8 These results suggest that MsCEPR1 overexpression may improve the plant's ability to adapt to phosphorus stress by affecting root morphology.
[0280] 2. MsCEPR1 overexpression enhances phosphorus accumulation in the aboveground parts of alfalfa
[0281] After 14 days of low phosphorus stress, the leaves turned yellow. To explore the changes in aboveground phosphorus content in different strains under low phosphorus stress, the total phosphorus content was determined and it was found that under normal phosphorus supply conditions, there was no significant difference in aboveground phosphorus content between WT and OE1 and OE13 (WT: 0.150 mg / g; OE1: 0.146 mg / g; OE13: 0.152 mg / g), indicating that MsCEPR1 overexpression did not affect phosphorus absorption in alfalfa under normal growth conditions. Low phosphorus stress significantly affected aboveground phosphorus accumulation in alfalfa (a decrease of 60.73%), but the decrease in phosphorus in the MsCEPR1 overexpressing strains (OE1, OE13) was smaller (a decrease of 23.97%-26.97%) (see Figure 9 ).
[0282] 3. MsCEPR1 overexpression alleviates chloroplast damage under low phosphorus stress
[0283] After 14 days of low phosphorus stress treatment, the old leaves of WT showed obvious yellowing, while the old leaves of OE1 and OE13 did not show obvious yellowing ( Figure 10(a) in the figure). To explore the changes in chlorophyll content in leaves, the chlorophyll content in old leaves was measured. The chlorophyll determination results showed that under normal conditions, there was no significant difference in chlorophyll content in old leaves of different alfalfa strains (WT, OE1, OE13). After low phosphorus treatment, the chlorophyll content in old leaves of WT, OE1, and OE13 showed significant differences ( Figure 10 Under low-P treatment, the total chlorophyll content (Total Chl) in old leaves of WT was 0.32 mg / g, a decrease of 90.14% compared with that under normal P supply. The total chlorophyll content in old leaves of OE1 and OE13 was 2.67 mg / g and 2.19 mg / g, respectively, with decreases of 20.67% and 36.86%, respectively. These decreases were significantly lower than those in WT, indicating that MsCEPR1 overexpression alleviates chloroplast damage under low-P stress.
[0284] 4. MsCEPR1 promotes the expression of phosphorus absorption and transport genes
[0285] To further investigate how MsCEPR1 regulates aboveground phosphorus absorption, this study used qRT-PCR to examine the expression patterns of phosphorus absorption and transport-related genes (PHO1, PHR2, and PHT1) in leaves of WT, OE1, and OE13 strains under normal phosphorus (NP) and low phosphorus (LP) conditions (using NP-WT as a benchmark). Under NP conditions, the expression levels of PHO1, PHR2, and PHT1 in OE1 and OE13 strains were upregulated by 1.04-3.01 times compared with WT (PHO1: 3.13 times and 2.00 times; PHR2: 1.67 times and 1.04 times; PHT1: 3.01 times and 1.16 times) (see Figure 11 ), indicating that MsCEPR1 overexpression affects the basal expression levels of phosphorus absorption and transport genes. Furthermore, LP treatment induced the expression of phosphorus absorption and transport-related genes in all strains (up 1.41-7.91-fold compared to NP-WT). Furthermore, under LP conditions, the expression levels of these genes in OE1 and OE13 were significantly higher than those in WT. Combined with the results that aboveground phosphorus content in OE1 and OE13 was higher than that in WT, this suggests that MsCEPR1 may promote the expression of phosphorus absorption and transport-related genes, thereby enhancing aboveground phosphorus absorption.
[0286] In summary, this application uses alfalfa wild type (WT) and MsCEPR1 overexpression lines (OE1, OE13) as materials, and sets two culture conditions of normal phosphorus (NP) and low phosphorus (LP) to compare the changes in growth parameters (plant height, root length, aboveground and root fresh weight), total phosphorus content and chlorophyll content of different lines. The experimental results show that low phosphorus stress significantly affects the growth of alfalfa: the aboveground growth of all lines is inhibited, while the root biomass shows compensatory growth. The MsCEPR1 overexpression line showed stronger tolerance to low phosphorus. Compared with the changes in plant height and aboveground part of WT plants under low phosphorus conditions, the inhibition amplitude of the overexpression line was significantly reduced, indicating that MsCEPR1 gene overexpression can effectively alleviate the inhibition of low phosphorus on aboveground growth and promote root growth. Total phosphorus content measurements also revealed that the overexpressing strains exhibited enhanced phosphorus absorption and transport efficiency. Expression levels of phosphorus-related genes further confirmed that MsCEPR1 promotes phosphorus absorption and transport by boosting the expression of these genes. Furthermore, chlorophyll content in older leaves of the overexpressing strains was significantly higher than that of the wild-type strain, suggesting a better ability to maintain photosynthetic system stability. Taken together, these results suggest that MsCEPR1 overexpression alleviates the growth inhibition of aboveground parts induced by phosphorus deficiency, promotes root growth, and regulates phosphorus absorption and transport in alfalfa by upregulating phosphorus-related genes.
[0287] The above descriptions are merely a few embodiments of the present application and do not constitute any form of limitation to the present application. Although the present application discloses the preferred embodiments as above, they are not intended to limit the present application. Any technical personnel familiar with the present profession, without departing from the scope of the technical solution of the present application, using the technical content disclosed above to make slight changes or modifications are equivalent to equivalent implementation cases and fall within the scope of the technical solution.
Claims
1. An alfalfa MsCEPR1 gene, characterized in that: The nucleotide sequence of the alfalfa MsCEPR1 gene is shown in SEQ ID NO.
1.
2. An alfalfa MsCEPR1 protein, characterized in that The alfalfa MsCEPR1 protein is encoded by the alfalfa MsCEPR1 gene according to claim 1, and the amino acid sequence of the alfalfa MsCEPR1 protein is shown in SEQ ID NO.
2.
3. An expression vector, genetically engineered bacteria or transgenic cell line comprising the alfalfa MsCEPR1 gene according to claim 1.
4. Use of the alfalfa MsCEPR1 gene according to claim 1 or the alfalfa MsCEPR1 protein according to claim 2 in improving the resistance of plants to phosphorus stress.
5. The use according to claim 4, characterized in that The improving the plant's resistance to phosphorus stress includes promoting the growth of the plant's aerial parts and root system under low phosphorus stress, and promoting the plant's phosphorus absorption and transport under low phosphorus stress; Preferably, the plant comprises alfalfa; Preferably, the growth condition of the low phosphorus stress is: using 50 μmol·L -1 of KH2PO4 for low phosphorus treatment; Preferably, the promotion of phosphorus absorption and transport in plants under low phosphorus stress is achieved by upregulating the expression of PHO1, PHR2 and PHT1 genes.
6. A method for improving plant resistance to phosphorus stress, characterized in that: The steps include: (1) PCR amplifying the alfalfa MsCEPR1 gene according to claim 1 and excising the gel to recover the target fragment; (2) Construction of recombinant plasmid pTOPO-TA-MsCEPR1; (3) Construction of the overexpression vector pCAMBIA3301-MsCEPR1; (4) transferring the overexpression vector pCAMBIA3301-MsCEPR1 into the target plant to obtain a transgenic plant; The plants include alfalfa.
7. The method according to claim 6, characterized in that In step (1), the upstream and downstream primer sequences for PCR amplification are shown as SEQ ID NO.3 and SEQ ID NO.4, respectively.
8. The method according to claim 6, characterized in that In step (2), the method for constructing the recombinant plasmid pTOPO-TA-MsCEPR1 comprises: The target fragment of the alfalfa MsCEPR1 gene obtained in step (1) was connected to the pTOPO-TA vector, transformed into Escherichia coli, and positive clones were screened and sequenced to obtain the recombinant plasmid pTOPO-TA-MsCEPR1; Preferably, the ligation reaction system is: ddH2O 1.8-2.2 μL, MsCEPR1 gene fragment 1.8-2.2 μL, 10× Enhancer 0.4-0.6 μL, pTOPO-TA vector 0.4-0.6 μL; The reaction conditions for the connection are: 35-37° C., 10-15 min.
9. The method according to claim 6, characterized in that In step (3), the method for constructing the overexpression vector pCAMBIA3301-MsCEPR1 includes: S1. Using the recombinant plasmid pTOPO-TA-MsCEPR1 obtained in step (2) as a template, upstream and downstream primers were designed to amplify the MsCEPR1 fragment containing the NcoⅠ restriction site, i.e., p3301-MsCEPR1; S2. Use NcoⅠ enzyme to digest the pCAMBIA3301 vector; S3, the pCAMBIA3301 vector after enzyme digestion was connected with the p3301-MsCEPR1 by seamless cloning, and transformed into Escherichia coli, and positive clones were screened and sequenced to obtain the overexpression vector pCAMBIA3301-MsCEPR1; Preferably, in step S1, the sequences of the upstream and downstream primers are shown as SEQ ID NO.5 and SEQ ID NO.6 respectively; Preferably, in step S2, the enzyme digestion reaction system is: ddH2O 35-35.2 μL, pCAMBIA33018-9 μL, 10×Buffer 4-6 μL, NcoⅠ enzyme 0.8-1.2 μL; The reaction conditions of the enzyme digestion are: 35-37°C, 1.5-2.5h; Preferably, in step S3, the seamless cloning and ligation reaction system is ddH2O 3-5 μL, pCAMBIA3301 after enzyme digestion 11.8-2.2 μL, 2×Seamless Master Mix 2.8-3.2 μL, and p3301-MsCEPR10.8-1.2 μL; The reaction conditions for the seamless cloning and ligation are: 48-52° C., 28-32 min.
10. The method according to claim 6, characterized in that In step (4), the method of transformation includes Agrobacterium-mediated leaf disc transformation.
Citation Information
Patent Citations
Method for speeding up plant growth and improving yield by introducing phosphatases in transgenic plant
CN102257146A
Medicago sativa calmodulin CML16 gene and application thereof
CN117511955A
Medicago sativa calmodulin CML44 gene and application thereof
CN118028302A
Medicago sativa drought-resistant gene MsERF1B and application thereof
CN118406692A
Application of alfalfa NACsa3 protein in cultivation of salt-tolerant plants
CN119874866A