Method for improving actinomycete information storage capability

Abstract

The invention discloses a method for improving actinomycete information storage capacity, and belongs to the technical field of gene engineering. The method comprises the following steps: performing simulated acetylation mutation or simulated deacetylation mutation on DasR protein of actinomycetes; the simulated acetylation mutation is that lysine at the 78th site of the DasR protein is mutated into glutamine; the simulated deacetylation mutation is that lysine at the 78th site of the DasR protein is mutated into arginine. According to the invention, acetylation mutation and deacetylation mutation are carried out on a specific site of a wide-area regulatory factor protein, and the spore production capability of a strain is observed by measuring the growth condition of the modified saccharopolyspora erythraea, so that the condition that the spore growth capability and growth condition of the saccharopolyspora erythraea can be optimized by utilizing genetic engineering modification is proved; a new microbial resource is provided for preparation of an information storage carrier, and a research basis is provided for promotion of a DNA data storage technology.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and in particular to a method for improving the information storage capacity of actinomycetes. Background Art

[0002] The amount of digital data generated in modern life is rapidly increasing. Currently, traditional information storage technologies primarily rely on magnetic, optical, and solid-state devices, such as hard drives and magnetic tapes. However, with the advancement of science and technology and the widespread adoption of information technology, the amount of data generated in daily life continues to increase. It is estimated that by 2040, the amount of data generated by the human network will reach 5000ZB. At this point, traditional devices used to store information will face challenges in terms of storage density, long-term cost, and durability. Therefore, the development of new technologies and methods with improved storage performance has become urgent.

[0003] DNA is an ancient storage medium, storing vast amounts of genetic information from billions of life forms, from microorganisms to humans. Since the 1960s, the feasibility of DNA as a storage medium has been discussed due to its potential advantages, including high storage density, low energy consumption, long lifespan, and resistance to wear. In recent years, with breakthroughs in DNA synthesis and next-generation sequencing technologies, DNA data storage has become a hot topic in global data storage technology research.

[0004] Saccharopolyspora erythraea is a Gram-positive actinomycete. The onset of secondary metabolism in actinomycetes is often associated with morphological differentiation. This morphological change includes the development of a vegetative mycelium, which is responsible for nutrient growth. When nutrients are insufficient, the mycelium then differentiates into spores. Through sporulation, the aerial structures of actinomycetes of various species are maintained and propagated. The genome of Saccharopolyspora erythraea contains 8,212,805 base pairs, encoding 7,264 genes. In 2007, researchers at the University of Cambridge completed the complete genome sequencing of a wild strain of Saccharopolyspora erythraea (S. erythraea NRRL 23338), enabling more targeted molecular engineering of this important industrial actinomycete.

[0005] The advantage of Saccharopolyspora erythrae as an information storage chassis lies in its Gram-positive bacterium with a spore structure that is highly resistant to stress. Currently, most bacteria used for information storage chassis are from the genus Bacillus subtilis, and little is known about the research on Actinomycetes. Summary of the Invention

[0006] The purpose of the present invention is to provide a method for improving the information storage capacity of actinomycetes to solve the problems existing in the above-mentioned prior art. The present invention screens the acetylation sites of broad-range regulatory factors and performs acetylation and deacetylation mutations on specific sites. By measuring the growth of the modified Saccharopolyspora erythraea and observing the spore production capacity of the strain, it is confirmed that genetic engineering can be used to optimize the spore growth capacity and growth conditions of Saccharopolyspora erythraea. This provides a new microbial resource for the preparation of information storage carriers and provides a research foundation for the promotion of DNA data storage technology.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] The present invention provides a method for improving the information storage capacity of actinomycetes, the method comprising the steps of simulating acetylation mutation or simulating deacetylation mutation of the DasR protein of the actinomycetes;

[0009] The simulated acetylation mutation is to mutate the lysine at position 78 of the DasR protein to glutamine;

[0010] The simulated deacetylation mutation is to mutate the lysine at position 78 of the DasR protein to arginine.

[0011] Furthermore, the method comprises the following steps:

[0012] By site-directed mutagenesis, a recombinant vector containing a simulated acetylation mutation sequence or a simulated deacetylation mutation sequence is constructed;

[0013] The recombinant vector is transduced into actinomycetes, so that the actinomycetes express the DasR protein and the DasR mutant protein.

[0014] Furthermore, the simulated acetylation mutation sequence is amplified by primers as shown in SEQ ID NO.6 and SEQ ID NO.7;

[0015] The simulated deacetylation mutation sequence is amplified using primers such as SEQ ID NO.4 and SEQ ID NO.5.

[0016] Furthermore, the improvement of the information storage capacity of actinomycetes is specifically to improve the spore production capacity and morphological differentiation speed of actinomycetes.

[0017] Furthermore, the improving the spore production ability of actinomycetes specifically means increasing the spore production amount of actinomycetes and shortening the spore production cycle.

[0018] Optionally, the actinomycetes include Saccharopolyspora erythraea.

[0019] The present invention also provides actinomycetes constructed by applying the above method.

[0020] The present invention also provides the use of the above-mentioned actinomycetes in preparing information storage carriers.

[0021] The present invention discloses the following technical effects:

[0022] The present invention has found that Saccharopolyspora erythrae is a Gram-positive bacterium with excellent resistance to extreme conditions, and its spore structure gives it a natural advantage as an information storage chassis. The present invention screens the acetylation sites of wide-area regulatory factors, performs acetylation mutations and deacetylation mutations on specific sites, measures the growth of the modified Saccharopolyspora erythrae, and observes the spore production ability of the strain. It is confirmed that genetic engineering can be used to optimize the spore growth ability and growth conditions of Saccharopolyspora erythrae. Among them, simulating deacetylation to transform the strain can greatly improve the spore production ability and differentiation rate of Saccharopolyspora erythrae. The method of the present invention provides a new microbial resource for the preparation of information storage carriers and provides a research basis for the promotion of DNA data storage technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0024] Figure 1 The colony forming unit test results of Saccharopolyspora erythraea and Bacillus subtilis; A is under the environmental condition of pH = 8; B is under the environmental condition of pH = 8.5; C is under the environmental condition of pH = 9; D is under the environmental condition of pH = 9.5;

[0025] Figure 2 The results of DasR acetylation site determination are shown in Figure 2. A represents in vitro AcP-dependent acetylation; B represents in vitro enzyme-catalyzed acetylation.

[0026] Figure 3 Schematic diagram of mass spectrometry identification of acetylation site K78;

[0027] Figure 4 The results of mass spectrometry identification of different acetylation sites of DasR protein;

[0028] Figure 5 This is the sequence alignment of DasR proteins in different actinomycetes;

[0029] Figure 6The results of acetylation determination in Saccharopolyspora erythraea; A is the EMSA image showing that acetylation at K78 affects the binding activity of DasR to disA; B is the cross-linking image showing that acetylation at K78 weakens DasR dimerization;

[0030] Figure 7 The spore production of Saccharopolyspora erythrorhizium; A is the spore production of Saccharopolyspora erythrorhizium OdasR on R2YE plate K78Q and OdasR K78R B is the phenotype of Saccharopolyspora erythrocytes OdasR observed by field emission electron microscopy K78Q and OdasR K78R phenotype. DETAILED DESCRIPTION

[0031] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0032] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0033] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0034] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0035] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0036] Preliminary studies of the present invention have found that the stress resistance of the carrier is highly correlated with its ability to store information. Previous experimental studies have shown that Bacillus subtilis is an excellent carrier for information storage. It has strong stress resistance to acid, alkali and oxidizing conditions, mainly because it has the ability to produce spores. Spores have strong resistance to heat, chemicals and ultraviolet rays. Taking Saccharopolyspora erythrae as an example, the present invention explores its stress resistance advantages under alkaline conditions and screens out transformation targets related to metabolic engineering that can enhance the spore production ability of Saccharopolyspora erythrae. It has been proven that the genetic engineering strategy of using metabolic regulation to enhance the spore production ability of cells can help achieve the purpose of using actinomycete chassis as an information storage medium.

[0037] The research process and ideas of the present invention are as follows:

[0038] First, the present invention measured the OD of the growth of Saccharopolyspora erythraea and Bacillus subtilis under different pH conditions through phenotypic experiments. 600 The results showed that under alkaline pH=9.5, Saccharopolyspora erythrae had better stress resistance than Bacillus subtilis, and it was determined that Saccharopolyspora erythrae was a suitable chassis for information storage in an alkaline environment. Then, by overexpressing the broad regulatory factor protein DasR in Saccharopolyspora erythrae and simulating acetylation and deacetylation mutations at the K78 amino acid site, it was found that overexpression of simulated acetylated DasR in vivo could effectively inhibit the growth of the spores. K78Q Transformed strains and DasR mimicking deacetylation mutations K78R Compared with the wild type, it promotes sporulation and accelerates morphological differentiation, mimicking the deacetylation mutation of DasR K78R The strain has a stronger spore production ability and a faster morphological differentiation speed. In addition, the present invention conducted mass spectrometry analysis on different acetylation sites of DasR protein and found that only acetylation at the K78 site could be detected in vivo.

[0039] Example 1

[0040] 1. Culture of Saccharopolyspora erythraea

[0041] Take 50 μL of the preserved red sugar polyspora (S.erythraea NRRL2338) bacterial solution and inoculate it into a 5 mL TSB liquid test tube. Glass beads were added to the test tube in advance and cultured at 30 ° C, 220 rpm on a shaker for 48 hours. Take 500 μL of the cultured bacterial solution in the test tube and inoculate it into 50 mL TSB liquid medium. Glass beads were added to the shake flask in advance and cultured at 30 ° C, 220 rpm on a shaker for 48 hours. Finally, take 0.5-1 mL of the above seed solution and inoculate it into a 500 mL triangular flask containing 50 mL TSB medium to make the initial OD 600 The concentration was 0.05, and the cells were cultured at 30°C and 220 rpm in a shaker.

[0042] 2. Bacillus subtilis culture

[0043] Take 50 μL of the preserved Bacillus subtilis subsp. subtilis 168 bacterial solution and inoculate it into a 5 mL LB liquid test tube. Incubate at 37°C and 220 rpm in a shaking incubator for 12 hours until the OD 600 The OD value is about 0.6-0.8. Take 500 μL of cultured bacterial liquid and inoculate it into 50 mL of LB liquid culture medium. Culture it at 37°C and 220 rpm in a shaking platform.

[0044] 3. Comparison of colony forming units

[0045] After Bacillus subtilis and Saccharopolyspora erythrorhizon were inoculated into liquid culture medium under different pH conditions, the OD of Bacillus subtilis was measured every 0.5 to 1.5 hours. 600 The OD of Saccharopolyspora erythraea was measured every 12 hours. 600 The OD values ​​of Bacillus subtilis and Saccharopolyspora erythraea were then calculated. 600 And the colony forming unit conversion formula is used to convert it into colony forming units.

[0046] The results are as follows Figure 1 As shown in the figure, it can be seen that in alkaline environments with different pH values, Saccharopolyspora erythrae has stronger growth ability and stress resistance than Bacillus subtilis. Specifically, at pH = 9.5, the growth of Bacillus subtilis is significantly inhibited, while the growth of Saccharopolyspora erythrae is not affected. These results indicate that compared to Bacillus subtilis, Saccharopolyspora erythrae has a better ability to adapt to alkaline environments and can survive for a long time in environments with higher pH values.

[0047] 4. Overexpression plasmid construction

[0048] 4.1 Obtaining the DasR Gene: After finding the sequence of the desired gene, SACE_0435, in the NCBI database, primers were designed using snapgene and inserted into the homologous recombination fragment. The target gene was amplified by PCR using S. erythraea NRRL2338 genomic DNA as a template. The PCR reaction system consisted of 25 μL buffer, 1 μL dNTPs, 2 μL upstream primer, 2 μL downstream primer, 1 μL template, 1 μL high-fidelity DNA polymerase, and 18 μL ddH2O. The PCR protocol was as follows: pre-denaturation at 95°C for 10 minutes, denaturation at 95°C for 15 seconds, annealing at 56°C for 15 seconds, and extension at 72°C for 30 seconds / 1000 bp. This denaturation-extension process was repeated 34 times, followed by extension at 72°C for 8 minutes, followed by cooling to 12°C. After agarose gel electrophoresis, the PCR product was aligned with a marker and, if the size was correct, purified using a gel recovery kit to obtain the target fragment, DasR.

[0049] The primer sequences are:

[0050] dasR-F(5'-3'): AGCAAATGGGTCGCGGATCCCTCGAAACATCGGTGCCAAG (SEQ ID NO. 1);

[0051] dasR-R(5'-3'):CGAGTGCGGCCGCAAGCTTGGGCGGGCGGGTGAGG (SEQ ID NO. 2).

[0052] The nucleotide sequence of the DasR gene is shown in SEQ ID NO.3:

[0053] .

[0054] 4.2 Site-directed mutagenesis: A rapid point mutagenesis kit produced by Beijing Quanshijin Biotechnology Co., Ltd. was used to perform site-directed mutagenesis experiments. The required steps include:

[0055] (1) Primer design:

[0056] K78R-F: cgcgtccagggcaGgggcaccttcgc (SEQ ID NO. 4);

[0057] K78R-R: gccctggacgcgcagcagcc (SEQ ID NO.5);

[0058] K78Q-F: cgcgtccagggcCagggcaccttcgc (SEQ ID NO. 6);

[0059] K78Q-R: gccctggacgcgcagcagcc (SEQ ID NO. 7).

[0060] (2) PCR amplification:

[0061] PCR amplification was performed using the primers in (1) and the DasR gene as a template. The following PCR system was added: SControl Plasmid 1-5 ng, 5×TransStart FastPfu buffer 10 μL, SControl Primers 1 μL, 5×TransStart FastPfu DNA Polymerase 1 μL, 10 mM dNTPs 1 μL, and ddH2O was added to 50 μL. After the above system was mixed, PCR amplification was performed according to the above PCR amplification procedure. After adding 1 μL of DMTase to the PCR product and mixing, the mixture was incubated at 37°C for 1 hour, and then the target fragment DasR was recovered. K78Q and DasR K78R ;

[0062] (3) Obtaining the pIB-139 plasmid backbone:

[0063] PCR amplification was performed using the pIB-139 vector as a template to obtain the target gene. The primer sequences were:

[0064] pIB139-F (5'-3'): gacagcaaatgggtcgcggatccgaattc (SEQ ID NO. 8);

[0065] pIB139-R(5'-3'): gctcgagtgcggccgcaagctt (SEQ ID NO. 9).

[0066] The PCR reaction system consisted of 25 μL buffer, 1 μL dNTPs, 2 μL upstream primer, 2 μL downstream primer, 1 μL template, 1 μL high-fidelity DNA polymerase, and 18 μL ddH₂O. The PCR procedure was the same as above. After agarose gel electrophoresis, the PCR product was aligned with a marker to obtain the plasmid backbone pIB139.

[0067] The obtained plasmid backbone pIB139 was respectively combined with the target fragments DasR and DasR K78Q 、DasR K78R The multi-fragment homologous recombination enzyme was used for ligation. The recombination reaction conditions were as follows: 6 μL homologous recombinase, 4 μL target fragment, and 2 μL enzyme-digested plasmid were mixed and placed in a water bath at 50°C for 30 minutes. After placing on ice for 5 minutes, the entire system was added to the DH5α competent medium and gently mixed. After placing on ice for 30 minutes, heat shock was performed in a water bath at 42°C for 90 seconds. After placing on ice for 3 minutes, 750 μL LB culture medium was added and activated in a shaker at 37°C and 220 rpm for 45 minutes. The activated bacterial solution was spread on an LB solid culture medium plate containing 50 μg / mL apramycin and cultured at 37°C overnight. Single clones were picked for sequencing. After alignment with the designed sequence, the single clones with correct sequencing were retained to obtain the clones containing pIB139-PermE-his-DasR-his, pIB139-PermE-his-DasR K78Q -his and pIB139-PermE-his-DasR K78R -his plasmid bacterial solution.

[0068] (4) Obtaining the pET28a plasmid backbone:

[0069] PCR amplification was performed using the pIB-139 vector as a template to obtain the target gene. The primer sequences were:

[0070] pET28a-F: CATCATCATCATCATCACTGATGAG (SEQ ID NO. 10);

[0071] pET28a-R: CATATGGCTGCCGCGGCAC (SEQ ID NO. 11).

[0072] The PCR reaction system consisted of 25 μL buffer, 1 μL dNTPs, 2 μL upstream primer, 2 μL downstream primer, 1 μL template, 1 μL high-fidelity DNA polymerase, and 18 μL ddH₂O. The PCR procedure was the same as above. After agarose gel electrophoresis, the PCR product was aligned with a marker to obtain the plasmid backbone pET28a.

[0073] The obtained plasmid backbone pET28a was respectively combined with the target fragments DasR and DasR K78Q 、DasR K78RThe multi-fragment homologous recombination enzyme was used for ligation. The recombination reaction conditions were as follows: 6 μL homologous recombinase, 4 μL target fragment, and 2 μL enzyme-digested plasmid were mixed and placed in a water bath at 50°C for 30 minutes. After placing on ice for 5 minutes, the entire system was added to the DH5α competent medium and gently mixed. After placing on ice for 30 minutes, heat shock was performed in a water bath at 42°C for 90 seconds. After placing on ice for 3 minutes, 750 μL LB culture medium was added and activated in a shaker at 37°C and 220 rpm for 45 minutes. The activated bacterial solution was spread on an LB solid culture medium plate containing 50 μg / mL kanamycin and cultured at 37°C overnight. Single clones were picked for sequencing. After alignment with the designed sequence, the single clones with correct sequencing were retained to obtain E. coli DH5α-pET28a-his-DasR-his, E. coli DH5α-pET28a-his-DasR K78Q -his and E.coliDH5α-pET28a-his-DasR K78R -his plasmid, and the successfully transformed positive plasmid was extracted using a plasmid extraction kit (TransGen Biotech) to obtain pET28a-his-DasR-his, pET28a-his-DasR K78Q -his and pET28a-his-DasR K78R -his plasmid, take 1 μL of the extracted plasmid and transfer it into E. coli BL21 competent cells according to the same method as above to obtain E. coli BL21-pET28a-his-DasR-his, E. coli BL21-pET28a-his-DasR K78Q -his and E.coli BL21-pET28a-his-DasR K78R -his strain.

[0074] 5. Transformation of overexpression plasmid into Saccharopolyspora erythraea

[0075] 50 μL of DH5α Escherichia coli culture containing the overexpression plasmid was added to a 5 mL LB liquid culture medium test tube and cultured in a shaking incubator at 37°C and 220 rpm for 24 hours. The plasmid was extracted and purified using a plasmid extraction kit.

[0076] On ice, 50 μL of pIB139-PermE-his-DasR-his, pIB139-PermE-his-DasR K78Q -his and pIB139-PermE-his-DasR K78R-his plasmid was added to 50 μL of erythrosine protoplasts, and then 200 μL of PEG-T was added and gently mixed. After mixing, all the liquid was spread on a non-resistant R3M solid culture medium plate and cultured at 30°C for 24 hours. 1 mL of 125 μg / mL apramycin liquid was evenly spread on the plate and cultured at 30°C for 3-5 days. After culture, the monoclonal bodies grown on the plate were spread on a non-resistant R3M solid culture medium plate pre-coated with 1 mL of 125 μg / mL apramycin liquid and cultured at 30°C for 2-3 days. The grown bacteria were picked and added to a 5 mL TSB liquid culture medium test tube containing 50 μg / mL apramycin, and cultured at 30°C and 220 rpm for 48 hours. The normally grown bacterial liquid was aspirated for sequencing, amplified using M13F / R primers, and compared with the designed sequence. The bacterial liquid with the correct sequencing was retained to obtain the transformant strain OdasR containing the overexpression plasmid. OdasR K78R and OdasR K78Q .

[0077] M13F (5'-3'): GTGCTGCAAGGCGATTAAGTT (SEQ ID NO. 12);

[0078] M13R(5'-3'): TTATGCTTCCGGCTCGTATGT (SEQ ID NO. 13).

[0079] 6. Protein induction and purification

[0080] (1) E. coli culture: Take 50 μL of the stored BL21-pET28a-his-DasR-his, BL21-pET28a-his-DasR K78Q -his and BL21-pET28a-his-DasR K78R -his bacterial solution, inoculate it into a 5 mL LB liquid test tube, and culture at 37°C, 220 rpm shaking for 8 to 12 hours until the OD 600 The OD value is about 0.6-0.8. Take 50 μL of bacterial solution again and add it to 5 mL of LB liquid medium. Incubate at 37°C and 220 rpm in a shaking incubator for 8-12 hours until the OD value is 600 The cultured bacteria in the test tube were inoculated into 100 mL of LB liquid medium and cultured at 37°C and 220 rpm for 2 hours until the OD 600 The pH value was about 0.6, 100 μL of 96 mg / mL IPTG solution was added, and the mixture was cultured at 20°C and 220 rpm in a shaking incubator for 12-14 hours.

[0081] (2) Collection and disruption of bacterial cells: 100 mL of BL21-pET28a-his-DasR-his, BL21-pET28a-his-DasR K78Q -his and BL21-pET28a-his-DasR K78R Collect the 50 mL centrifuge tube containing the 5-his bacterial suspension, wash with PBS, and redissolve in 40 mL of PBS. Disrupt the suspension using a cell disruptor at 45% power (3 seconds on, 5 seconds off) for approximately 20 minutes until the solution is relatively clear. Collect 50 μL of the disrupted solution as the total protein solution, centrifuge it at 8000 rpm for 10 minutes, and collect 50 μL of the disrupted solution as the supernatant.

[0082] (3) Nickel column affinity purification

[0083] a. Filter the supernatant obtained after crushing and centrifugation using a 0.45 μm aqueous filter membrane;

[0084] b. Use 20-30 mL of imidazole-10 to wash the NiNTABeads column;

[0085] c. Add the filtered supernatant to the column and let it pass through the column automatically by gravity;

[0086] d. After all the supernatant has passed through the column, add 20-30 mL of imidazole-20 to the column to wash away nonspecifically bound substances;

[0087] e. After washing, use 3-5 mL of imidazole-250 to elute the target protein and save the effluent;

[0088] f. Wash the column with 20 mL of 0.5 M sodium hydroxide. After washing, add 20-30 mL of imidazole-10 to wash the column. Reserve some imidazole-10 to preserve the column and place it in a 4°C refrigerator for later use.

[0089] g. Use SDS-PAGE to verify the size of the two samples reserved in the previous step and the final effluent.

[0090] (4) Protein preservation and quantification

[0091] a. The purified protein solution was ultrafiltered to remove NaCl and imidazole, and the protein storage liquid was replaced with the buffer required for the experiment;

[0092] b. Determine the protein concentration after ultrafiltration using the BCA method;

[0093] c. Add an appropriate amount of glycerol to the protein solution that is not needed immediately and freeze it in a -80℃ refrigerator. If the protein cannot be stored for a long time, it needs to be used immediately.

[0094] 7. Transformant strain performance verification method

[0095] 7.1 Electron retardation assay (EMSA)

[0096] (1) Probe design: Using the S. erythraea NRRL2338 (wild-type WT) genome as a template, EMSA probe primers were designed and biotin-labeled at the 5' end. The probe primer sequences are shown in Table 1.

[0097] Table 1 Probe primer sequences

[0098]

[0099] (2) Binding reaction:

[0100] Set up the EMSA binding reaction according to Table 2:

[0101] Table 2 EMSA binding reaction

[0102]

[0103] Add various reagents in the order mentioned above, mix well before adding the probe, and let it stand at room temperature for 10 minutes to eliminate possible nonspecific binding reactions. Finally, add the probe, mix well, and incubate at 18°C ​​for 30 minutes.

[0104] (3) Pre-electrophoresis: This operation is generally performed before the binding reaction. Use 5×TBE as the mother liquor to prepare 1L of 0.5×TBE electrophoresis buffer. To avoid disruption of the binding reaction, pre-electrophoresis and subsequent electrophoresis and transfer operations must be performed in a low-temperature environment. Adjust the voltage to 160V and pre-electrophoresis for 70 minutes. The comb needs to be removed during pre-electrophoresis.

[0105] (4) Electrophoresis: After incubation, add 1 μL of 10× EMSA loading buffer (colorless) to each sample, mix well, and load immediately. Set the voltage to 100 V. Run for 30 minutes after the blue buffer line runs out of the gel. If the probe sequence is less than 100 bp, the electrophoresis can be stopped when the buffer line runs to the bottom. During the electrophoresis, ensure that the electrophoresis is kept in a low temperature environment and replace the ice pack every 20 minutes. If the temperature continues to rise, the voltage needs to be appropriately reduced.

[0106] (5) Transfer: After electrophoresis, scrape off the non-denaturing gel and soak it in the transfer buffer, which is also 0.5×TBE buffer. Prepare two pieces of filter paper and soak them in the transfer buffer. At the same time, cut a NC membrane of appropriate size and soak it in the transfer buffer. Take the EMSA sandwich board and spread it out. Place the soaked black sponge, filter paper, NC membrane, EMSA gel, filter paper, and black sponge on the transparent surface in sequence. Be careful not to leave bubbles between them, otherwise it will affect the transfer effect. When placing it in the transfer tank, try not to touch the middle of the sandwich board. Hold the two sides and place it carefully. At a constant current of 380mA, transfer the membrane at low temperature for about 45 minutes, and replace the ice pack every 20 minutes.

[0107] (6) Cross-linking: Before the transfer is almost complete, prepare a piece of plastic wrap to cover the plate, and dissolve the blocking solution and washing solution (5×) in a 40°C water bath. After the transfer is completed, carefully remove the NC membrane with tweezers and attach it to the plastic wrap. Immediately perform UV cross-linking using a UV-light cross-linker with a UV wavelength of 254 nm and a power of 120 mJ / cm 2 Cross-link for 90 seconds.

[0108] (7) Blocking and antibody incubation: Add 20 mL of blocking solution to the plate, then quickly place the cross-linked NC membrane into the plate, and shake it on a horizontal shaker at room temperature and low speed for 30 minutes. Pour out the blocking solution, add 20 mL of new blocking solution to the plate, add 2 μL of Streptavidin-HRP Conjugate to the blocking solution, and incubate the antibody on a horizontal shaker at room temperature and low speed for 35 minutes.

[0109] (8) Washing: Take a clean beaker, add 12 mL of washing solution (5×) and 48 mL of ddH2O, mix well to make 60 mL of 1× washing solution. Discard the blocking solution, add 20 mL of washing solution, and wash slowly on a horizontal shaker for 10 min. Replace the washing solution and repeat the washing process twice.

[0110] (9) Imaging: Remove the NC membrane from the washing solution and keep the NC membrane wet. Mix equal volumes of P-ECLA and P-ECLB working solutions (Yazyme), prepare chemiluminescent solution, evenly drop the chemiluminescent solution onto the membrane, and use an imager to take pictures. Adjust the exposure time as needed. If the detected protein signal is very high, place the NC membrane with the working solution on a low-speed shaker for 1 to 2 minutes to balance the working solution and avoid local excessive consumption of reactants, which affects the linear range of the detection signal.

[0111] 7.2 Acetylation reaction

[0112] Set up different acetylation reactions according to Table 3 and Table 4:

[0113] Table 3 AcP catalyzed acetylation reaction

[0114]

[0115] Table 4 Enzyme-catalyzed acetylation reactions

[0116]

[0117] Keep all reagents on ice to avoid degradation caused by repeated freeze-thaw cycles. A control group must be included throughout the experiment. After the reaction is complete, add 20 μL of 6× Protein Loading Buffer to 100 μL of the system to quench the reaction for subsequent Western blot verification.

[0118] 7.3 Western Blot

[0119] (1) Take 20 μL of each sample that has been acetylated for different times and add 5 μL of 5× Protein Loading Buffer to mix thoroughly. Place it in a PCR instrument and denature it at 99°C for 10 minutes. Place the short end of the protein gel plate inward and clamp it with a splint. Add electrophoresis buffer to the protein gel plate and place it on a clean table for 2 minutes to check for leaks. If there is leakage, readjust the position of the splint. After leak detection, add samples one by one, apply Protein Marker to both ends, add 5 μL of sample, and add samples in sequence with a sample volume of 20 μL. Prepare two sets of the same samples. After adding the samples, make sure that the electrodes are placed opposite each other. If they are placed upside down, the sample will flow back, causing sample loss. The voltage program is 80V for the upper layer of concentrated gel for 30 minutes and 120V for the lower layer of separation gel. Stop when the buffer line runs to about 1 / 7 of the bottom of the gel. After electrophoresis is completed, remove the gel and cut off the colored upper layer of gel. Select one of the groups, gently scrape off the lower layer of gel with a scraper and place it in an incubation box. Add Coomassie Brilliant Blue staining solution and stain for about 30 minutes. After staining, recover the staining solution, add tap water, heat on medium heat in a microwave for 2-3 minutes, wash and decolorize, and preliminarily check the protein purification effect.

[0120] (2) After completing SDS-PAGE, scrape off the protein gel from the other set of samples and soak them in the transfer solution. At the same time, prepare two pieces of filter paper and soak them in the transfer solution. Cut the PVDF membrane to a suitable size and soak it in methanol for 5 minutes to fully activate it. Take the sandwich board and spread it out. Place the soaked black sponge, filter paper, PVDF membrane, protein gel, filter paper, and black sponge on the transparent surface in sequence. When placing it in the transfer tank, try not to touch the middle of the sandwich board. Hold the two sides and place it carefully. Under a constant current of 380mA, transfer the membrane at low temperature for about 30 minutes. Pay attention to the black electrodes facing black and the current flowing from the negative electrode to the positive electrode, otherwise the transfer will be reversed. If the protein marker is on the PVDF membrane after transfer, it can be verified that the transfer is successful.

[0121] (3) Blocking: After transfer, carefully remove the membrane and place it in an incubator. Add 10 mL of blocking solution containing 5% BSA and block for 2 hours to remove nonspecific adsorption. BSA powder should be stored in a refrigerator at 4°C.

[0122] (4) Antibody incubation: After blocking, pour out half of the blocking solution and add 2 μL of primary antibody directly to the incubation box containing about 5 mL of blocking solution. First, shake slowly on a low-speed horizontal shaker for 10 minutes to completely dilute the primary antibody, and then place it in a 4°C refrigerator for overnight incubation. The next day, recover the primary antibody and wash it three times with 10 mL of TBST at room temperature, each for 10 minutes. At the end of the third wash, add the corresponding secondary antibody and incubate at room temperature for 1 hour. After the incubation, wash it three times with 10 mL of TBST at room temperature, each for 10 minutes.

[0123] (5) Development: Remove the PVDF membrane from the TBST washing solution and place it on a plate, keeping the PVDF membrane wet. Mix equal volumes of P-ECLA and P-ECL B working solutions (Yazyme), prepare chemiluminescent solution, and evenly drop the chemiluminescent solution onto the membrane. Use an imager to take pictures, and adjust the exposure time as needed.

[0124] 7.4 Mass spectrometry analysis of acetyl sites

[0125] (1) Add 30 μL of SDT buffer solution (4% SDS, 100 mM DTT, 150 mM Tris-HCl, pH 8.0) to 20 μg of protein, and then dissolve it at 90°C for 5 minutes.

[0126] (2) Repeated ultrafiltration was performed using 200 μL of UA buffer solution (8 M Urea, 150 mM Tris-HCl, pH 8.0) to remove residual detergent, DTT, and other low molecular weight components.

[0127] (3) Add 100 μL of 0.05 M iodoacetamide to the UA buffer solution to block the reduced cysteine ​​residues, and incubate the sample in the dark for 20 min.

[0128] (4) The filter was washed three times with 100 μL UA buffer solution and then washed twice with 100 μL 25 mM NH4HCO3.

[0129] (5) Resuspend the protein in 40 μL of 25 mM NH4HCO3 containing 2 μg of trypsin and digest at 37°C.

[0130] (6) The protein after trypsin digestion was subjected to solid phase extraction, and then the acetylation sites of the protein were analyzed by mlC-MS / MS method using a mass spectrometer (Thermo Finnigan, San Jose, CA). The peptide fragments were first chromatographically analyzed by HPLC before mass spectrometry analysis. The chromatographic column was a quartz glass tube (0.15 mm OD; 150 mm ID) sealed with an Agilent peptide seal (Zorbax 300SB-C18). The HPLC mobile phase A was 0.1% (v / v) formic acid in water, and B was 0.1% (v / v) formic acid in acetonitrile (84% v / v) solution, with a flow rate of 1 ml / min. It took at least 50 min to go from 4% (v / v) B to 50% (v / v) B; it took at least 4 min to go from 50% (v / v) B to 100% B; and then it was maintained at 100% (v / v) B for at least 6 min. The peptide fragments eluted by HPLC were subjected to subsequent MS / MS analysis.

[0131] (7) MS / MS analysis was performed using the Mascot search engine (Matrix Science, London, UK; version 2.2) against the Saccharopolyspora_NRRL23338 database. Protein identification settings were as follows: peptide mass tolerance = 20 ppm; MS / MS tolerance = 0.1 Da; enzyme = trypsin; uncleaved = 2; fixed modification: carbamidomethyl (C); variable modifications: oxidation (M), acetylation (K, N-terminus); and decoy database mode = reverse. All data were obtained with a false positive rate (FDR) of no more than 1% and a 99% confidence level.

[0132] 7.5 Cross-linking experiment

[0133] DSS, also known as disuccinimidyl suberate, is a membrane-permeable crosslinker soluble in the organic solvent DMSO. Its mechanism of action is as follows: DSS has an amine-reactive N-hydroxysuccinimide (NHS) ester at each end of the carbon atom spacer arm. NHS esters react with primary amines at pH 7-9 to form stable amide bonds. The side chains of lysine (K) residues in proteins contain several primary amines, which serve as targets for crosslinking with NHS ester crosslinkers.

[0134] (1) Sample preparation: The target protein was ultrafiltered into a cross-linking buffer containing 20 mM (pH 8.0) bicine, 150 mM NaCl, 10 mM MgCl2, 0.2% N-octylglucoside, and 8% glycerol.

[0135] (2) The cross-linking system is shown in Table 5.

[0136] Table 5 Cross-linking system

[0137]

[0138] Western blot verification: After the reaction is completed, add 10 μL of 6× Protein Loading Buffer for quenching, and then perform Western blot and development verification.

[0139] 7.6 Field Emission Scanning Electron Microscope

[0140] (1) In a clean bench, take out a portion of the cultured bacterial solution and evenly spread it on an R2YE plate. After it is blown dry, insert a sterilized mica sheet (10 mm × 10 mm) obliquely into the plate, seal the plate, and place it upside down in a 30°C incubator for incubation.

[0141] (2) After 144 h of incubation, remove the plate and carefully remove the mica sheet using sterilized tweezers, with the surface covered with bacteria facing upwards;

[0142] (3) Add an appropriate amount of electron microscopy sample fixative (Solabo) on the mica sheet to completely cover the bacteria on the surface, and place it in a 4°C refrigerator for incubation for 1 hour;

[0143] (4) After fixation, carefully remove the fixative and cover the surface with a small amount of ultrapure water to wash away the fixative and residual culture medium. Then carefully remove the washing water and repeat 2-3 times.

[0144] (5) After washing, add 10% ethanol dropwise onto the mica sheet and let it stand at 4°C for 15 min. Then, carefully remove the ethanol and repeat this process with 30%, 50%, 70%, 90%, and 100% ethanol, respectively. This step is to dehydrate the sample in a gradient manner.

[0145] (6) After dehydration, add 100% ethanol to cover the mica sheet and place the sample face up in a freeze dryer for freeze drying;

[0146] (7) Fix the sample on the stage. Cover the sterile area with conductive glue. Use a surface ion sputtering instrument to spray platinum on the sample surface. After spraying, place it in a field emission scanning electron microscope and select the appropriate field of view and magnification for shooting.

[0147] 8. Transformant strain performance verification results

[0148] 8.1 Acetylation of DasR K78 is mediated by AcP

[0149] Western Blot results showed that AcP-dependent acetylation of DasR modification was time-dependent, and the acetylation level gradually increased with the increase of reaction time ( Figure 2 AcuA does not have the ability to acetylate DasR ( Figure 2 B). Under in vitro reaction conditions, AcP can acetylate K21, K78, K84, and K86 sites of DasR, but in vivo, only K78 acetylation of DasR was detected ( Figure 3 Comparing the structure of DasR, we found that the K78 site is located in the HTH structure at the N-terminus, which is responsible for binding to DNA ( Figure 4 To explore whether the K78 site is conserved in actinomycetes, we conducted homology analysis with DasR from other actinomycetes and found that the key acetylation site K78 is highly conserved ( Figure 5 In summary, the acetylation of DasRK78 is mediated by AcP, and this site is highly conserved in actinomycetes.

[0150] 8.2K78 acetylation affects DasR binding to DNA

[0151] After K78 was mutated to Q, DasR lost its ability to bind to the disA probe, while the protein mutated to K78R showed similar results to the WT, indicating that acetylation at the K78 site inhibits the binding of DasR to DNA, while deacetylation has little effect on the binding of DasR to DNA ( Figure 6 Chemical cross-linking experiments further demonstrated that acetylation at K78 significantly affected the formation of DasR dimers ( Figure 6 B).

[0152] 8.3 Modification of DasR acetylation sites can enhance the sporulation ability of Saccharopolyspora erythraea

[0153] In order to further understand the relationship between DasR acetylation regulation of c-di-AMP levels and the spore production ability of Saccharopolyspora erythraea, the differentiation process of Saccharopolyspora erythraea was observed by R2YE plate observation and field emission electron microscopy. K78R In comparison, OdasR K78Q The differentiation rate of Saccharopolyspora erythraea was significantly slowed down, indicating that K78 acetylation would inhibit the sporulation process of Saccharopolyspora erythraea ( Figure 7 A). Field emission electron microscopy experiments further confirmed this result ( Figure 7 Based on this acetylation mechanism, mutating the K78 site of DasR to arginine can effectively increase the differentiation rate of actinomycetes and enhance their stress resistance.

[0154] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A method for improving the information storage capacity of actinomycetes, characterized in that: The method comprises the steps of simulating acetylation mutation or deacetylation mutation of the DasR protein of actinomycetes; The simulated acetylation mutation is to mutate the lysine at position 78 of the DasR protein to glutamine; The simulated deacetylation mutation is to mutate the lysine at position 78 of the DasR protein to arginine.

2. The method according to claim 1, characterized in that The method comprises the following steps: By site-directed mutagenesis, a recombinant vector containing a simulated acetylation mutation sequence or a simulated deacetylation mutation sequence is constructed; The recombinant vector is transduced into actinomycetes, so that the actinomycetes express the DasR protein and the DasR mutant protein.

3. The method according to claim 2, characterized in that The simulated acetylation mutation sequence is amplified by primers as shown in SEQ ID NO.6 and SEQ ID NO.7; The simulated deacetylation mutation sequence is amplified using primers such as SEQ ID NO.4 and SEQ ID NO.

5.

4. The method according to claim 1, wherein The improvement of the information storage capacity of actinomycetes specifically refers to improving the spore production capacity and morphological differentiation speed of actinomycetes.

5. The method according to claim 4, characterized in that The improving the spore production ability of actinomycetes specifically means increasing the spore production amount of actinomycetes and shortening the spore production cycle.

6. The method according to any one of claims 1 to 5, characterized in that The actinomycetes include Saccharopolyspora erythraea.

7. Actinomycetes constructed using the method according to any one of claims 1 to 6.

8. Use of the actinomycetes according to claim 7 in the preparation of information storage media.

Images