Application of gene GmPMEI156 in improvement of low phosphorus stress tolerance of plants

By cloning and overexpressing the soybean gene GmPMEI156, the problem of difficulty in absorbing and utilizing phosphorus by plants is solved, significantly improving the plant's ability to tolerate low phosphorus stress, and enhancing root growth and phosphorus absorption capacity.

CN120485246AActive Publication Date: 2025-08-15SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510605234.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-12
Publication Date
2025-08-15
Estimated Expiration
2045-05-12

AI Technical Summary

Technical Problem

Soybean production and benefits in South China are limited by soil phosphorus deficiency, and the existing technology is difficult to effectively improve the plant's ability to absorb and utilize phosphorus.

Method used

By cloning the soybean gene GmPMEI156 and overexpressing or introducing the gene in the plant, the plants can improve their ability to tolerate low phosphorus stress. The specific steps include extracting soybean root tip RNA, reverse transcription into cDNA, PCR amplification, vector ligation and heterologous transformation of Arabidopsis to verify gene function.

Benefits of technology

It significantly enhances the plants' ability to tolerate low phosphorus stress, which is manifested as an increase in root length, fresh weight and lateral root number, and improves the plants' adaptability to low phosphorus environment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120485246A_ABST
    Figure CN120485246A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of gene engineering, discloses a cloning method of a soybean gene GmPMEI156 and an application of the soybean gene GmPMEI156 in low-phosphorus resistance regulation and control, and belongs to the technical field of gene engineering. According to the invention, the soybean GmPMEI156 gene is cloned and analyzed, the verification of the gene on low phosphorus tolerance is realized by heterologous transformation of arabidopsis thaliana, and the result shows that the expression quantity of the GmPMEI156 gene under low phosphorus stress is obviously increased, so that the arabidopsis thaliana can effectively resist low phosphorus stress. The invention provides a resistance gene for soybean molecular breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and particularly relates to application of gene GmPMEI156 in improving the ability of plants to tolerate low-phosphorus stress. Background Art

[0002] Soybean seeds are rich in plant protein and are one of the main sources of high-quality protein. Soybeans play a crucial role in agricultural production and food processing. In agriculture, soybeans are an important rotation crop, improving soil fertility through nitrogen fixation. In food processing, soybeans are widely used in the production of soy products, vegetable oils, and plant protein products. In the feed industry, soybean meal is the primary protein source for livestock and poultry feed.

[0003] Phosphorus (P) is an essential element for plant growth and development. As a fundamental component of plant cells, it plays a vital role in cell growth and proliferation. It is also involved in numerous physiological and biochemical processes in plants, including photosynthesis, respiration, energy storage and transfer, and cell division. Furthermore, P promotes root growth and development, improves drought and cold tolerance, and thus increases plant yield. Therefore, P is crucial for plant growth and development.

[0004] South China's soils are primarily acidic, with low pH values. Phosphorus is easily oxidized and fixed by metal ions like iron (Fe) and aluminum (Al) in acidic soils, while it is easily precipitated by calcium (Ca) in alkaline soils. Consequently, crops have difficulty absorbing phosphorus from the soil, resulting in low soybean yields and economic benefits. Soil phosphorus deficiency is a major limiting factor in increasing soybean yields and profitability in South China.

[0005] Therefore, using relevant biological knowledge, analyzing the molecular mechanism of genes in low-phosphorus tolerance, exploring genes, realizing efficient absorption and utilization of phosphorus by soybeans, and cultivating new phosphorus-efficient soybean varieties have important practical significance and application value for improving and increasing soybean yields in South China. Summary of the Invention

[0006] In order to solve the problems in the above-mentioned background technology, the first object of the present invention is to provide an application of gene GmPMEI156 in improving the tolerance of plants to low phosphorus stress, wherein the nucleotide sequence of the CDS region of the gene GmPMEI156 is shown as SEQ ID NO.1, or the gene GmPMEI156 encodes the amino acid sequence shown as SEQ ID NO.2.

[0007] The present application introduces the gene GmPMEI156 into the plant body, thereby improving the plant's ability to tolerate low-phosphorus stress.

[0008] Furthermore, the plant is Arabidopsis thaliana or soybean.

[0009] The second object of the present invention is to provide a method for improving the tolerance of plants to low phosphorus stress, the method comprising increasing the expression level of the amino acid sequence shown in SEQ ID NO.2 in a recipient plant; the specific steps comprising: introducing the gene GmPMEI156 shown in SEQ ID NO.1 into a recipient plant to obtain a transgenic plant, wherein the transgenic plant has a higher tolerance to low phosphorus stress than the recipient plant; or overexpressing the amino acid sequence shown in SEQ ID NO.2 in the recipient plant.

[0010] Furthermore, the improvement in the plant's tolerance to low phosphorus stress is reflected in an increase in its root length, fresh weight or number of lateral roots.

[0011] The third object of the present invention is to provide a recombinant plasmid, a recombinant vector, and a transgenic plant cell line of the gene GmPMEI156 for use in improving the tolerance of plants to low phosphorus stress, wherein the nucleotide sequence of the gene GmPMEI156 is shown in SEQ ID NO.1; or the gene GmPMEI156 encodes the amino acid sequence shown in SEQ ID NO.2.

[0012] The fourth object of the present invention is to provide the use of gene GmPMEI156 in cultivating plants tolerant to low phosphorus stress, wherein the nucleotide sequence of gene GmPMEI156 is shown in SEQ ID NO.1; or the gene GmPMEI156 encodes the amino acid sequence shown in SEQ ID NO.2.

[0013] To achieve the above objectives, this application is implemented through the following technical solutions:

[0014] S1, extract soybean root tip RNA and reverse transcribe it into cDNA, then clone the coding DNA sequence (CDS) of the GmPMEI156 gene by PCR amplification

[0015] S2, the cloned CDS was sequenced and the sequencing results were compared with the reference sequence of the GmPMEI156 gene (the known sequence of this gene in the NCBI database). The sequence of the CDS was consistent with the reference sequence;

[0016] S3, the CDS was vector-ligated and transformed into Agrobacterium. The function and role of the gene GmPMEI156 in tolerance to low phosphorus stress were studied by heterologous transformation of Arabidopsis thaliana and hairy roots. The specific steps are as follows:

[0017] First, the GmPMEI156 gene was inserted into an overexpression vector to construct a recombinant plasmid, which was then transformed into Agrobacterium. The CDS was then transferred into the recipient wild-type Arabidopsis thaliana using the anther infection method. Functional overexpression plants were screened and propagated to the T5 generation.

[0018] Subsequently, three strains with the highest expression levels were selected through fluorescence quantification for low-phosphorus tolerance phenotype experiments in wild-type Arabidopsis and transgenic Arabidopsis.

[0019] In summary, the beneficial effects of the present invention are as follows: through cloning and analysis of the soybean gene GmPMEI156 and functional verification of the gene by heterologous transformation of wild-type Arabidopsis thaliana, the present invention found that the low-phosphorus tolerance of plants overexpressing GmPMEI156 was significantly enhanced, which can lay the foundation for molecular breeding of soybeans with low-phosphorus tolerance.

[0020] The above description is only an overview of the technical solution of the present invention. In order to more clearly understand the technical means of the present invention, it can be implemented in accordance with the contents of the specification. In order to make the above and other purposes, features and advantages of the present invention more obvious and easy to understand, the following preferred embodiments are specifically cited and described in detail with reference to the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Phylogenetic tree analysis of some PMEI family genes in soybean and Arabidopsis;

[0022] Figure 2 The quantitative PCR results of GmPMEI156 gene under different phosphorus conditions;

[0023] Figure 3 The target fragment of soybean GmPMEI156 gene was cloned (a) and connected to the pLB vector to identify the bacterial solution (b).

[0024] Figure 4 The results of subcellular localization of soybean GmPMEI156 gene protein;

[0025] Figure 5 Verification of soybean GmPMEI156 gene self-activation in yeast and its interaction with candidate proteins; Part a is the verification of GmPMEI156 gene self-activation, and Part b is the verification of GmPMEI156 gene interaction with candidate proteins;

[0026] Figure 6 Analysis of phosphorus expression patterns of two candidate proteins of soybean GmPMEI156 gene;

[0027] Figure 7 The results of the soybean hairy root experiment with the soybean GmPMEI156 gene and the analysis of plant biomass;

[0028] Figure 8Genetic transformation and generation of Arabidopsis thaliana with soybean GmPMEI156 gene;

[0029] Figure 9 Phenotypes of transgenic soybean Arabidopsis and wild-type Arabidopsis (Col-0) after 14 days of treatment under normal and low-P conditions. DETAILED DESCRIPTION

[0030] To further illustrate the technical means employed in the present invention, the following specific examples are provided to further illustrate the technical solutions of the present invention. The equipment and raw materials used in the present invention are commercially available or commonly used in the art; the soybeans used were provided by the Guangdong Branch of the National Soybean Improvement Center.

[0031] It should be understood that the implementation of the present invention is not limited to the following examples, and unless otherwise specified, all of the above are conventional methods in the art.

[0032] The nucleotide sequence of the CDS region of the GmPMEI156 gene is shown in SEQ ID NO.1:

[0033]

[0034] The full-length CDS of the GmPMEI15 gene in this example is 1689 bp, and the protein consists of 562 amino acid residues.

[0035] The amino acid sequence encoded by the GmPMEI156 gene is shown in SEQ ID NO.2:

[0036] *

[0037] The protein encoded by the gene GmPMEI156 in this example consists of 562 amino acid residues with an isoelectric point PI = 8.29. Protein domain predictions from SMART and NCBI websites show that the GmPMEI156 protein contains a PLN02713 domain located in the 1st to 562nd amino acid region ( Figure 1 ), belonging to the PMEI family. This domain inhibits pectin methylesterase and invertase by forming a non-covalent 1:1 complex; it is involved in the regulation of fruit development, carbohydrate metabolism, and cell wall elongation.

[0038] Example 1: Analysis of the expression pattern of the GmPMEI156 gene at different phosphorus levels.

[0039] 1. Soybean material processing

[0040] S1. Prepare Brazilian soybean No. 13 seeds and disinfect their surfaces with alcohol. Sow the disinfected seeds in moist vermiculite and place them in an incubator (temperature: 26°C, 16h light / 8h dark) for germination. When true leaves emerge, seedlings of similar growth potential are grouped and transferred to normal phosphorus (NP, 500μM KH2PO4) and low phosphorus (LP, 5μM KH2PO4) culture solutions. Samples are collected at 0 h, 3 h, 6 h, 12 h, 24 h, 36 h, 2 d, 7 d, and 14 d after germination. The seeds are immediately snap-frozen with liquid nitrogen and stored in a -80°C freezer.

[0041] Table 1 Low phosphorus culture medium formula

[0042]

[0043]

[0044] When preparing the solution, the P concentration should be adjusted according to the corresponding experiment; if KH2PO4 is used for P treatment, K2SO4 should be used for supplementation.

[0045] S2. Extract RNA from soybean root samples preserved after treatment with different phosphorus concentrations, and reverse transcribe the RNA into cDNA.

[0046] S3, real-time fluorescence quantitative PCR was performed using cDNA as a template, and quantitative primers were designed using NCBI Primer BLAST to obtain qGmPMEI156-F and qGmPMEI156-R.

[0047] qGmPMEI156-F (SEQ ID NO.3):5'-GCTGGGTTACGTATAATATGAGCAAA-3';

[0048] qGmPMEI156-R (SEQ ID NO. 4): 5'-ACAATATAGAGTGGCAGTGCAT-3'.

[0049] Soybean internal reference gene Actin3-F (SEQ ID NO. 5): 5'-GCACCACCGGAGAGAAAATA-3'; Actin3-R (SEQ ID NO. 6): 5'-GTGCACAATTGATGGACCAG-3'.

[0050] qRT-PCR was performed using a fluorescence quantitative kit (Nanjing Novizan Biotechnology Co., Ltd., product model: Q312). The fluorescence quantitative system is shown in Table 2, the reaction procedure is shown in Table 3, and the data obtained are calculated according to Formula 2 ^-△△CT Processing calculations.

[0051] Table 2 Fluorescence quantitative system

[0052] Reagents Volume (μL) cDNA 1 qGmPMEI156-F 0.4 qGmPMEI156-R 0.4 2×NovoStartSYBRqPCRSuperMixPlus 10 RNaseFreeWater 8.2

[0053] Table 3 qPCR reaction procedure

[0054]

[0055] The expression levels of GmPMEI156 gene under normal and low phosphorus levels are as follows Figure 2 As shown, the experiment showed that the expression of GmPMEI156 gene was induced by low phosphorus stress in soybean roots.

[0056] Example 2: Cloning and analysis of the target fragment of the GmPMEI156 gene

[0057] S1: Huachun 6 soybeans were planted, and root samples were collected and immediately snap-frozen in liquid nitrogen. Total RNA was extracted from the soybean root samples using an RNA extraction kit (Nanjing Novezan Biotechnology Co., Ltd.). Subsequently, RNA was reverse-transcribed into cDNA using a reverse transcription kit (Nanjing Novezan Biotechnology Co., Ltd., product model: R333-C1) for subsequent gene expression analysis.

[0058] S2, specific primers were designed using NCBI Primer BLAST.

[0059] The specific primer sequences are:

[0060] GmPMEI156-F (SEQ ID NO.7): 5'-TAAACCTCATGCATTCCCATACA-3';

[0061] GmPMEI156-R (SEQ ID NO. 8): 5'-CACGTGCACCAGCATTAAAAG-3'.

[0062] Using cDNA as a template, the target fragment of the GmPMEI156 gene was cloned and amplified according to the reaction system in Table 4; the reaction procedure was as follows: initial denaturation at 95°C for 3 min; 34 cycles (denaturation at 95°C for 15 s; annealing at 55°C for 15 s; extension at 72°C for 1 min / kb); and final extension at 72°C for 5 min. The target fragment clone product was obtained and stored in a refrigerator at 12°C.

[0063] Table 4 Gene target fragment amplification system

[0064]

[0065] like Figure 3 As shown in part a of FIG, the clone length is 1842 bp.

[0066] S3, purify the target fragment clone product, and then connect the purified target fragment clone product to the pLB vector (Tiangen Biochemical Technology Co., Ltd., product model: VT205) to obtain the connection product, and transform the connection product into Escherichia coli DH5α competent cells by heat shock method, then pick a single colony for bacterial liquid PCR verification, screen positive clones, and send the positive clones to a sequencing company for sequencing. The strains with correct sequencing are respectively subjected to plasmid extraction and glycerol storage, and the resulting plasmid is named pLB-GmPMEI156. The PCR primer synthesis and gene sequencing work in the above steps were completed by Sangon Biosynthesis (Shanghai) Co., Ltd. The identification diagram of the bacterial liquid connected to the GmPMEI156 gene and the pLB vector is shown in the figure below. Figure 3 As shown in part b of the figure, M is DNA ladder marker 2000, lane 1 is a water negative control, and lanes 2-6 are identification bands of single colonies of pLB-GmPMEI156.

[0067] Example 3: Protein subcellular localization of GmPMEI156

[0068] ① Amplify the target fragment: Use pLB-GmPMEI156 as the template cDNA and design the recombination cloning primers using CE design V1.03.

[0069] p1300-GmPMEI156-F(SEQ ID NO.9):5'-ccaaatcgactctagtctagaATGGCTTTCAAGAACTTGTCCG-3'

[0070] p1300-GmPMEI156-R (SEQ ID NO.10):5'-catggtaccggatccactagtTATCAATCCACTAATGTATGGAACTCC-3';

[0071] The full-length CDS sequence of the GmPMEI156 gene was amplified by PCR. The PCR amplification method and conditions were the same as above. The amplified product was subjected to gel electrophoresis and then purified using a product purification kit (Nanjing Novizan Biotechnology Co., Ltd., product model: DC301).

[0072] ② Linearized vector: Double-digest the pCAMBIA1300 empty plasmid with XbaI and SpeI restriction endonucleases.

[0073] ③ Ligation: Ligate the target fragment, GFP fragment and pCAMBIA1300, and transform the ligation product into DH5α E. coli. Then pick colonies for bacterial liquid identification and sequencing. After the sequencing is correct, extract the plasmid and save the remaining strains to obtain the pCAMBIA1300-GmPMEI156-GFP vector for subsequent experiments.

[0074] For plasmid extraction, refer to the instructions for the Novozymes Plasmid Extraction Kit DC201. The detailed steps are as follows:

[0075] (1) Add bacterial suspension to a 2 mL centrifuge tube and centrifuge at 12,000 rpm for 1 min. Discard the filtrate. Repeat three times to collect the bacterial cells.

[0076] (2) Add 250 μL of Buffer P1 and place on a vortex oscillator to suspend all the bacteria;

[0077] (3) Add 250 μL of Buffer P2 and gently invert the tube eight times;

[0078] (4) Add 350 μL of Buffer P3 and gently invert the tube eight times. Place the tube in a centrifuge and centrifuge at a speed of 12,000 rpm for 10 min.

[0079] (5) Install the adsorption column on a clean centrifuge tube, transfer 600 μL of supernatant to the adsorption column, and then centrifuge (12000 rpm, 1 min); discard the waste liquid;

[0080] (6) Add 600 μL of Buffer PW2 to the adsorption column and centrifuge (12,000 rpm, 1 min); discard the waste liquid;

[0081] (7) Repeat step (6);

[0082] (8) Place the tube in a centrifuge again and centrifuge (12000 rpm, 2 min);

[0083] (9) Place the adsorption column on the collection tube, add 25 μL of ddH2O, and let it stand at room temperature for 2 minutes. Then centrifuge it at 12,000 rpm for 1 minute. Repeat this step to increase the quality of the plasmid. Store the product in a refrigerator at -20°C.

[0084] Preserve the strain: Mix the bacterial solution and 50% glycerol in a 1:1 ratio in a 2 mL sterile centrifuge tube and store in a -80°C freezer.

[0085] ④ Transient Transformation of Nicotiana benthamiana: Prepare the pCAMBIA1300-GPF plasmid and transform the pCAMBIA1300-GPF and pCAMBIA1300-GmPMEI156-GFP plasmids into Agrobacterium tumefaciens GV3101 (P19) strain, respectively. Shake the cells to an OD600 of 0.6-0.8, then centrifuge (5000 rpm for 5 minutes). Resuspend the cells in tobacco suspension solution. Prepare the tobacco suspension solution according to Table 5 and use immediately.

[0086] Transform Agrobacterium. Refer to the GV3101 transformation instructions of Weidi Company. The detailed steps are as follows:

[0087] (1) Thaw the competent medium at room temperature and place it on ice;

[0088] (2) Add the target gene DNA plasmid to the bacterial solution and flick gently to mix. Perform the following treatments in sequence: place on ice, freeze in liquid nitrogen, bath in 37°C water, and then place on ice again; each treatment lasts 5 minutes.

[0089] (3) Add YEP liquid culture medium without antibiotics to the clean bench and shake at 220 rpm at 28°C for 2-3 hours.

[0090] (4) In a clean bench, use a glass rod to evenly spread the bacterial liquid on YEP solid medium containing antibiotics Kan (working concentration: 50 μg / L) and Rif (working concentration: 25 μg / L), invert and culture in a 28°C incubator for 2-3 days;

[0091] (5) After colonies have grown, pick a single colony and place it in a 1.5 mL centrifuge tube containing antibiotics Kan (working concentration: 50 μg / L) and Rif (working concentration: 25 μg / L) in a clean bench. Place the EP tube in a shaker at 28°C and 200 rpm for 6 h. Then perform PCR identification on the colonies.

[0092] Table 5 Tobacco resuspension formula

[0093]

[0094] The protein location of GmPMEI156 was predicted using PSORT and WoLF PSORT websites.

[0095] Plant tobacco plants and wait about one month before selecting healthy, undamaged leaves for injection. Mark the leaves and dark-treat them for 2-3 days. After dark-treating, gently tear the lower epidermis of the tobacco leaves with tweezers and examine them under a laser confocal microscope.

[0096] The results are as follows Figure 4As shown in the figure, eGFP is the GFP channel (excitation wavelength 488nm), DAPI is the UV channel (excitation wavelength 360nm), and it can bind to DNA and emit blue fluorescence. Merge indicates the fusion of GFP and DAPI, and Bright field indicates bright field. The experiment shows that the GmPMEI156 protein is localized to the cell nucleus.

[0097] Example 4: Yeast autoactivation of GmPMEI156 and verification of candidate interacting proteins

[0098] (1) Amplification of target fragment: Using pLB-GmPMEI156 as template cDNA, recombinant cloning primers were designed using CE design V1.03.

[0099] pGBKT7-GmPMEI156-F(SEQ ID NO.11):5'-atggccatggaggccgaattcATGGCTTTCAAGAACTTGTCCG-3'

[0100] pGBKT7-GmPMEI156-R(SEQ ID NO.12):5'-ccgctgcaggtcgacggatccCTATCAATCCACTAATGTATGGAACTCC-3'

[0101] The full-length CDS sequence of the GmPMEI156 gene was amplified by PCR. The PCR amplification method and conditions were the same as above. The amplified product was subjected to gel electrophoresis and then purified using a product purification kit (Nanjing Novizan Biotechnology Co., Ltd., product model: DC301).

[0102] (2) Linearization vector: Linearize the pGBKT7 vector with EcoRI and BamHI restriction enzymes

[0103] (3) Ligation: The target fragment was ligated with pGBKT7, and the ligation product was transformed into DH5α E. coli. Then, colonies were picked for bacterial liquid identification and sequencing. After the sequencing was correct, the plasmid was extracted and the remaining strains were preserved to obtain the pGBKT7-GmPMEI156 vector for subsequent experiments.

[0104] The correct strain was transferred into LB liquid culture medium containing antibiotic Kan (working concentration: 50 μg / / L), placed in a shaking incubator at 37°C and 200 rpm for propagation, and operated according to the instructions of the Novozymes Plasmid Extraction Kit DC201.

[0105] (4) The successfully constructed pGBKT7-GmPMEI156 plasmid and pGADT7 empty vector were transformed into Y2HGold yeast competent cells to detect self-activation activity. The pGBKT7-53 plasmid and pGADT7-T were used as positive controls; pGBKT7-lam and pGADT7-T were used as negative controls. For specific operations, please refer to the instructions of Y2HGold Chemically Competent Cell of Shanghai Weidi Company. The strain was spread on yeast SD / -Trp-Leu plates and cultured in an inverted manner at 28°C in a constant temperature incubator for 2-3 days.

[0106] (5) Add Xa-Gal colorimetric reagent to SD / -Trp-Leu, pick colonies, dilute and resuspend with 0.9% saline, dip the bacterial solution onto the culture medium, and grow in a constant temperature incubator at 29°C for 2-3 days.

[0107] The results are as follows Figure 5 As shown in part a, GmPMEI156 does not self-activate.

[0108] ⑥ Using the SMART website, we predicted ten genes interacting with GmPMEI156 in yeast. We searched for these genes using Phytozome and designed primers for cloning the target fragments using NCBI's Primer BLAST. Using Huachun 6 soybean cDNA as a template, we successfully cloned two target genes through PCR amplification. We then verified their self-activation in yeast.

[0109] Glyma.13G134200-F(SEQ ID NO.13):GGAAACGTCTAGCACCCACA;

[0110] Glyma.13G134200-R(SEQ ID NO.14):CCCCTGCATTTATGCAACAGC;

[0111] Glyma.10G277200-F(SEQ ID NO.15):CAAACCCCTTCCCAAACCCA;

[0112] Glyma.10G277200-R(SEQ ID NO.16):CAATCATAGTGCACCTAGCTCT;

[0113] pGBKT7-Glyma.13G134200-F(SEQ ID NO.17):5'-atggccatggaggccgaattcATGGGTAACTCCCATGGACACC-3'

[0114] pGBKT7-Glyma.13G134200-R(SEQ ID NO.18):5'-ccgctgcaggtcgacggatccTAGTGTTTGATCTGCTGGCTTAGC-3';

[0115] pGADT7-Glyma.13G134200-F(SEQ ID NO.19):5'-gccatggaggccagtgaattcATGGGTAACTCCCATGGACACC-3'

[0116] pGADT7-Glyma.13G134200-R(SEQ ID NO.20):5'

[0117] acgattcatctgcagctcgagCTAGTGTTTTGATCTGCTGGCTTAGC-3'

[0118] pGBKT7-Glyma.10G277200-F(SEQ ID NO.21):5'-atggccatggaggccgaattcATGCTCCCCATCACCTGCA-3'

[0119] pGBKT7-Glyma.10G277200-R(SEQ ID NO.22):5'-ccgctgcaggtcgacggatccTAGTAATGATAATAAAAAGGCATGGTTG-3';

[0120] pGADT7-Glyma.10G277200-F(SEQ ID NO.23):5'-gccatggaggccagtgaattcATGCTCCCCATCACCTGCA-3'

[0121] pGADT7-Glyma.10G277200-R(SEQ ID NO.24):5'-acgattcatctgcagctcgagCTAGTAATGATAATAAAAAGGCATGGTTG-3'

[0122] The results are as follows Figure 5 Part b shows that the gene GmPMEI156 protein has protein interactions with the genes Glyma.13G134200 and Glyma.10G277200.

[0123] Analysis of the phosphorus expression patterns of interacting genes; the results are as follows Figure 6As shown, the expression of gene Glyma.13G134200 in soybean is not induced by low phosphorus stress; Glyma.10G277200 is a low phosphorus sensitive gene and is induced by low phosphorus stress. Among them, the quantitative primers for the interacting genes are as follows:

[0124] q Glyma.13G134200-F (SEQ ID NO.25):GGTAACTCCCATGGACACCG;

[0125] q Glyma.13G134200-R (SEQ ID NO.26): TTATGGGGAGGAGGAACCGT;

[0126] q Glyma.10G277200-F(SEQ ID NO.27):ACGCTCTTCTCAACCTCAACC;

[0127] q Glyma.10G277200-R (SEQ ID NO. 28): CCCTTCTCCGTAGTGAGGCA.

[0128] Example 5: Identification of soybean hairy root tolerance to low phosphorus

[0129] Construct a gene editing vector; use CRISPR-P 2.0 on the Huazhong Agricultural University website to design four targets for GmPMEI156. Obtain Guide2, Guide10, Guide37, and Guide53.

[0130] Guide2-F(SEQ ID NO.29):GGATTGCGTAAATCCTTCCTTCTGC;

[0131] Guide2-R(SEQ ID NO.30):AAACGCAGAAGGAAGGATTTACGCA;

[0132] Guide10-F (SEQ ID NO.31):GGATTGGTCTAACTTCTTGGACGGA;

[0133] Guide10-R(SEQ ID NO.32):AAACTCCGTCCAAGAAGTTAGACCA;

[0134] Guide37-F (SEQ ID NO.33):GGATTGCATTGTGAAAACGTACCTT;

[0135] Guide37-R(SEQ ID NO.34):AAACAAGGTACGTTTTCACAATGCA;

[0136] Guide53-F (SEQ ID NO.35):GGATTGGCGGCTAATAACCGTGCAG;

[0137] Guide53-R (SEQ ID NO. 36):AAACCTGCACGGTTATTAGCCGCCA.

[0138] Design and synthesize primers for the designed target site, referencing the cloning method for the legume CRISPR / Cas9 vector pUC19. After annealing the oligonucleotides into double-stranded DNA, ligate them with the pUC19 plasmid digested with BsaI. Transform the ligation product into competent E. coli DH5α, select colonies for identification and sequencing, and maintain the strains for plasmid extraction.

[0139] The correct strain was transferred to LB liquid culture medium containing antibiotic Kan (working concentration: 50 μg / L), placed at 37°C, 200 rpm shaking on a shaker, and operated according to the instructions of the Novozymes Plasmid Extraction Kit DC201.

[0140] Transform Agrobacterium K599 with the pTF101 empty vector, pTF101-GmPMEI156, and Cas9-GmPMEI156 plasmids. Proliferate the transformed strain until the OD600 reaches 0.6-0.8. Centrifuge at 5000 rpm for 5 minutes to retain the bacterial mass. Resuspend in 5 mL of resuspension buffer.

[0141] The formula of hair root resuspension is prepared according to Table 6 and is used immediately after preparation.

[0142] Table 6 Hair root resuspension formula

[0143]

[0144] Soybean rooting: Plant Brazil No. 13 seeds in vermiculite. When they grow to 6 cm, use a 1 mL syringe to draw up the resuspended bacterial solution and inject it into the soybean seedling 1-2 cm below the cotyledonary node. Incubate in a culture room (16h / 8h light / dark, 26°C) at high temperature and high humidity for approximately 7 days.

[0145] Identification of hairy root phenotype: After the seeds grow 3-5 cm hairy roots, cut off the primary roots, gently take the roots and culture them in Hoagland's solution with a KH2PO4 concentration of 500 μmol / L and 5 μmol / L (pH = 5.8) for 14 days, changing the water every 2 days.

[0146] During the hydroponic culture period, DNA was extracted from the hairy roots of each seedling to identify positive seedlings. Root samples were also collected for RNA extraction, with triplicate sampling for each treatment. RNA was reverse-transcribed into cDNA, and gene expression levels were determined by quantitative PCR under different treatments.

[0147] After the hydroponic culture was completed, photos were taken and recorded. At the same time, the fresh weight of the aboveground and underground parts of the soybean plants under different treatments was weighed, and the dry weight was weighed after the samples were completely dried. Fresh and dry samples were taken to determine the soluble phosphorus and total phosphorus content. At least three biological replicates were taken for each data set, and the collected samples were stored at -80°C.

[0148] The phenotypic identification results of transgenic hairy roots of GmPMEI156 are as follows Figure 7 As shown in the figure, a and b are the phenotypes of the soybean chimeras overexpressing the GmPMEI156 gene (OE), gene-edited GmPMEI156 gene (gmpmei156), and empty vector (CK) after treatment under normal phosphorus and low phosphorus conditions for 14 days; cI is the aboveground fresh weight, underground fresh weight, relative expression results of roots, aboveground fresh weight, underground fresh weight, aboveground phosphorus content, and underground phosphorus content.

[0149] The experimental results showed that the root elongation, lateral roots and dry weight of overexpression (OE) plants were significantly improved compared with the wild-type control plants (CK), indicating that overexpression of the GmPMEI156 gene can improve tolerance to low-phosphorus stress; gene editing of the GmPMEI156 gene will enhance soybean's sensitivity to low-phosphorus stress.

[0150] Example 6: Arabidopsis genetic transformation and phenotypic identification

[0151] Step 1: Construct an overexpression vector:

[0152] ① Amplify the target fragment: Use pLB-GmPMEI156 as the template cDNA and design the recombination cloning primers pTF-GmPMEI156-F and pTF-GmPMEI156-R using CE design V1.03.

[0153] pTF-GmPMEI156-F (SEQ ID NO.37):

[0154] gagaacacgggggactctagaATGGCTTTCAAGAACTTGTCCG

[0155] pTF-GmPMEI156-R(SEQ ID NO.38):

[0156] cgatcggggaaattcgagctcCTATATCAATCCACTAATGTATGGAACTCC

[0157] The full-length CDS sequence of the GmPMEI156 gene was amplified by PCR. The PCR amplification method and conditions were the same as above. The amplified product was subjected to gel electrophoresis and then purified using a product purification kit (Nanjing Novizan Biotechnology Co., Ltd., product model: DC301).

[0158] ② Linearized vector: Double-digest the pTF101 empty plasmid with XbaI and SacI restriction endonucleases.

[0159] ③ Ligation: Ligate the target fragment with pTF101 and transform the ligation product into DH5α E. coli. Then pick colonies for bacterial liquid identification and sequencing. After the sequencing is correct, extract the plasmid and save the remaining strains to obtain the pTF101-GmPMEI156 vector for subsequent experiments.

[0160] The pTF101-GmPMEI156 plasmid was transformed into GV3101 (Weidi), plated, and the bacterial solution was identified and maintained.

[0161] Preparation before heterologous transformation of Arabidopsis: Add water to wild-type Arabidopsis, purify in a 4°C refrigerator for 3 days, sow on nutrient soil, and place in a constant temperature incubator.

[0162] Anther infection of Arabidopsis: GV3101 strains containing the gene were shaken until OD600 = 0.6-0.8. The cells were then centrifuged at 5000 rpm for 5 minutes, preserving the bacterial clumps. 10 μL of Arabidopsis thaliana activator (Silliweet-77) was added to every 50 mL of 1 / 2 MS liquid and stirred on a magnetic stirrer to create a foam. The cells were resuspended in the resuspension buffer at a 1:1 ratio and the bacterial clumps were agitated.

[0163] Before infecting Arabidopsis, water the plants thoroughly. Remove any pods from the plants and completely immerse the flower buds in the resuspended bacterial solution for 1-2 minutes. Bag the plants to maintain moisture. Keep them in the dark for 12-16 hours before transferring them to an incubator. Infect the plants once a week, adding 6-BA to the resuspended solution for the second infection.

[0164] Step 2: Arabidopsis screening and identification

[0165] Arabidopsis thaliana plants harvested after infection were vernalized, sown on nutrient soil, and cultured in an incubator. After true leaves expanded, they were sprayed with 20 μg / mL glufosinate herbicide. Ten days later, resistant seedlings were transplanted to nutrient soil. After the T1 generation, DNA was extracted from leaves of the plants and positive seedlings were identified. Positive seedlings were multiplied until homozygous. RNA was extracted from leaves of the positive seedlings, and the relative expression of the GmPMEI156 gene in different strains was determined by quantitative PCR.

[0166] The results are as follows Figure 8 As shown, part a in the figure is a picture of Arabidopsis thaliana after spraying with glufosinate ammonium; part b is the relative expression level result of positive seedlings; part c is the identification result of the bacterial solution of positive seedlings, M is DNA ladder marker 2000, lane 1 is the water negative control, lane 2 is the pTF101-GmPMEI156 plasmid, and lanes 3-10 are transgenic Arabidopsis lines.

[0167] The experiment showed that compared with the wild type (WT), the expression level of the GmPMEI156 gene in the transgenic plants was significantly increased, indicating that the GmPMEI15 gene was successfully transferred into the plants and stably expressed in the transgenic plants.

[0168] Step 3: Identification of low phosphorus phenotype in Arabidopsis thaliana:

[0169] Three strains with high expression levels and the WT were selected for phenotypic characterization. Aliquot the strains and add 300 μL of 20% sodium hypochlorite and 700 μL of sterile ultrapure water to a clean bench. Wash on a shaker for 6-8 minutes. Then, wash the seeds eight times with ultrapure water and place in a 4°C refrigerator for 3 days for vernalization.

[0170] Prepare 1 / 2MS (pH=5.8) solid culture medium, sow vernalized Arabidopsis seeds on the plate, and place them vertically in the tissue culture room until the roots grow to about 1 cm.

[0171] Prepare solid culture media containing different phosphorus concentrations; namely, KH2PO4 concentrations of 500 μmol / L and 100 μmol / L, pH 5.8. Transplant five germinated strains and the WT onto normal and low-phosphorus plates for further growth. Observe the growth differences of the Arabidopsis plants 14 days later, photograph and record phenotypes, and record fresh weight.

[0172] The results are as follows Figure 9 As shown, part a in the figure is the identification diagram of the low-phosphorus tolerance phenotype of Arabidopsis thaliana; parts b and c are the bar charts of the phosphorus content of Arabidopsis thaliana, the fresh weight of the underground parts of five Arabidopsis thaliana plants, the length of the main root, and the number of lateral roots.

[0173] Experiments showed that under low-phosphorus conditions, the taproot and lateral roots of GmPMEI156-overexpressing plants grew better than those of wild-type Arabidopsis thaliana, and the transgenic Arabidopsis had higher aboveground and belowground fresh weights. Therefore, overexpressing Arabidopsis can alleviate the inhibitory effects of low-phosphorus stress on Arabidopsis growth and development.

[0174] In summary, the experiments described above showed that heterologous overexpression of the GmPMEI156 gene in Arabidopsis thaliana can significantly increase the main root length, number of lateral roots and fresh weight of the plant, thereby enhancing its low-phosphorus tolerance, proving that the GmPMEI156 gene has strong resistance to low-phosphorus stress.

[0175] This application confirmed that the soybean gene GmPMEI156 can enhance plant tolerance to low-phosphorus stress by cloning the soybean GmPMEI156 gene and conducting bioinformatics analysis, combined with the identification of soybean hairy root low-phosphorus tolerance and gene function verification in Arabidopsis.

[0176] The data in this example are the mean and standard error of three replicates, and "*", "**", "***" and "****" respectively indicate that the difference between the treatment and the control is significant (*P≤0.05), extremely significant (**P≤0.01), very significantly (***P≤0.001) and extremely significantly (****P≤0.0001).

[0177] The embodiments described above are only preferred implementations of the present invention and are not intended to limit the scope of protection of the present invention. Any non-substantial changes and modifications made by those skilled in the art on the basis of the invention fall within the scope of protection of the present invention.

Claims

1. The application of gene GmPMEI156 in improving the tolerance of plants to low phosphorus stress is characterized by: The nucleotide sequence of the CDS region of the gene GmPMEI156 is shown as SEQ ID NO.1, or the gene GmPMEI156 encodes the amino acid sequence shown as SEQ ID NO.

2.

2. The use according to claim 1, characterized in that The plant is Arabidopsis thaliana or soybean.

3. A method for improving plant tolerance to low phosphorus stress, characterized in that: The method is to increase the expression level of the amino acid sequence shown in SEQ ID NO. 2 in the recipient plant; The specific steps include: introducing the gene GmPMEI156 shown in SEQ ID NO.1 into a recipient plant to obtain a transgenic plant, wherein the transgenic plant has a higher tolerance to low phosphorus stress than the recipient plant; or overexpressing the amino acid sequence shown in SEQ ID NO.2 in the recipient plant.

4. The method according to claim 3, characterized in that The improvement of the low-phosphorus stress tolerance of the plant is reflected in the increase of its root length, fresh weight or the number of lateral roots.

5. Use of a recombinant plasmid, a recombinant vector, and a transgenic plant cell line of gene GmPMEI156 in improving plant tolerance to low-phosphorus stress, characterized in that: The nucleotide sequence of the gene GmPMEI156 is shown as SEQ ID NO.1; or the gene GmPMEI156 encodes the amino acid sequence shown as SEQ ID NO.

2.

6. The use of gene GmPMEI156 in cultivating plants tolerant to low phosphorus stress, characterized in that: The nucleotide sequence of the gene GmPMEI156 is shown as SEQ ID NO.1; or the gene GmPMEI156 encodes the amino acid sequence shown as SEQ ID NO.2.

Citation Information

Patent Citations

  • Application of gene GmPP2-10 in promoting growth of plant in low-phosphorus stress environment

    CN120400218A

  • Application of soybean low-phosphorus-tolerant gene GmVQ32 in improvement of low-phosphorus stress tolerance of plants

    CN120400219A

  • Application of soybean low-phosphorus-tolerant gene GmAP2 in improvement of low-phosphorus stress tolerance of plants

    CN120485245A