Application of GmXDH1a gene in increasing number of root nodules of leguminous plants
By overexpressing the GmXDH1a gene, the problem of insufficient nitrogen fixation of soybean rhizome tumors was solved, significantly improving the number of soybean rhizome tumors and symbiotic nitrogen fixation efficiency, and promoting the improvement of soybean yield.
Patent Information
- Application Number
- CN202510623671.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-15
- Publication Date
- 2025-08-15
AI Technical Summary
In the prior art, GmXDH1 mutations restrict nitrogen fixation in soybean nodules, resulting in insufficient supply of soybean nitrogen, affecting yield, and no related reports on the effect of overexpression of GmXDH1 on soybean nodules.
By overexpressing the GmXDH1a gene, the soybean plants are genetically transformed using the overexpression vector of the GmXDH1a gene, significantly improving the number of nodules and promoting symbiotic nitrogen fixation efficiency.
Significantly increase the number of soybean rhizombies, improve symbiotic nitrogen fixation efficiency, and improve soybean production.
Smart Images

Figure CN120485250A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of genetic engineering, and in particular to application of the GmXDH1a gene in increasing the number of root nodules in leguminous plants. Background Art
[0002] Soybeans are an important oil and protein crop worldwide, boasting high nutritional value and a wide range of uses. Soybeans are nitrogen-intensive crops, with nitrogen supply primarily coming from three sources: soil nitrogen, nitrogen provided by fertilizers, and symbiotic nitrogen fixation by rhizobia. Symbiotic nitrogen fixation between soybeans and rhizobia is one of nature's most efficient biological nitrogen fixation systems, providing over 80% of soybeans' nitrogen needs. Therefore, symbiotic nitrogen fixation is a key factor in high soybean yields.
[0003] Nitrogen obtained through symbiotic nitrogen fixation in soybeans can be transported in the form of ureides, products of purine metabolism catalyzed by multiple enzymes, with xanthine dehydrogenase (XDH) being a key enzyme in ureide synthesis. Mutations in soybean GmXDH1 have been reported to limit the conversion of xanthine to uric acid, thereby inhibiting nitrogen fixation in soybean nodules. However, the effects of overexpressing GmXDH1 on soybean nodulation have not been reported. Summary of the Invention
[0004] The object of the present invention is to provide an application of the GmXDH1a gene in increasing the number of root nodules in leguminous plants.
[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:
[0006] The present invention provides the use of overexpressing the GmXDH1a gene in any of the following:
[0007] (a) Increase the number of root nodules in legumes;
[0008] (b) Breeding leguminous plant varieties with increased nodule numbers;
[0009] (c) improving nitrogen fixation efficiency in legumes;
[0010] (d) Breeding leguminous plant varieties with improved nitrogen fixation efficiency;
[0011] The nucleotide sequence of the GmXDH1a gene is shown in SEQ ID NO.1.
[0012]
[0013] Preferably, the legume is soybean.
[0014] The present invention provides a method for increasing the number of soybean nodules, comprising the following steps:
[0015] (1) constructing an overexpression vector of the GmXDH1a gene and transforming it into Agrobacterium competent cells to obtain an engineered bacterium; the nucleotide sequence of the GmXDH1a gene is shown in SEQ ID NO.1;
[0016] (2) Infecting soybean plant tissue with the engineered bacteria obtained in step (1), performing plant tissue culture, and obtaining transgenic soybean plants with increased nodule numbers.
[0017] Preferably, the vector backbone of the overexpression vector in step (1) is a pUBI-GFP-4×MYC vector.
[0018] Preferably, the method for constructing the overexpression vector in step (1) is: using soybean genomic cDNA as a template, PCR amplification is performed with primers GmXDH1a-pUBI-4×MYC-F and GmXDH1a-pUBI-4×MYC-R to obtain a PCR amplification product; and the PCR amplification product is homologously recombined with the pUBI-GFP-4×MYC vector to obtain an overexpression vector of the GmXDH1a gene.
[0019] Preferably, the nucleotide sequence of the GmXDH1a-pUBI-4×MYC-F is shown as SEQ ID NO.2, and the nucleotide sequence of the GmXDH1a-pUBI-4×MYC-R is shown as SEQ ID NO.3.
[0020] Preferably, the Agrobacterium in step (1) is Agrobacterium K599.
[0021] Preferably, the infected site in step (2) is the soybean root.
[0022] The present invention provides an application of transgenic soybean plants obtained by the method in cultivation in a low-nitrogen soil environment.
[0023] Compared with the prior art, the present invention has the following beneficial effects:
[0024] The present invention experimentally discovered that soybean plants overexpressing the GmXDH1a gene significantly increased the number of soybean nodules compared to wild-type soybean plants. This is the first demonstration of the functional role of the soybean GmXDH1a gene in regulating nodulation. Genetic transformation of recipient soybean plants using a GmXDH1a gene overexpression vector significantly increased the number of root nodules in the transgenic soybean plants, thereby promoting the efficiency of symbiotic nitrogen fixation and having important implications for increasing soybean yield. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.
[0026] Figure 1 Schematic diagram of the vector map structure of pUBI-GFP-4×MYC-F;
[0027] Figure 2 A comparison of the root nodule status of wild-type soybean plants (EV) and transgenic soybean plants overexpressing the GmXDH1a gene (35::GmXDH1a);
[0028] Figure 3 The statistical results show the average number of root nodules per soybean plant in wild-type soybean plants (EV) and transgenic soybean plants overexpressing the GmXDH1a gene (35::GmXDH1a);
[0029] Figure 4 These are the GmXDH1a gene expression results in wild-type soybean plants (EV) and transgenic soybean plants overexpressing the GmXDH1a gene (35::GmXDH1a). DETAILED DESCRIPTION
[0030] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0031] Example 1 GmXDH1a vector construction
[0032] 1. Primer design
[0033] Primers were designed based on the Glyma.13G340300 coding sequence. The primers obtained are as follows (the underlined sequences are the linker and the corresponding enzyme cutting sites):
[0034] GmXDH1a-pUBI-4×MYC-F (SEQ ID NO.2):
[0035] TAGTGGATCCCCCCTAGA AGGCCTATGGGATCGTTGAAGACGG
[0036] GmXDH1a-pUBI-4×MYC-R (SEQ ID NO.3):
[0037] TTAATTAACCCGCT GGTACCAACACTAAGTTTGGGATGGAA
[0038] The primer sequences designed for recombinant plasmid identification are as follows:
[0039] pUBI-GFP-4×MYC-F: CTGTTTGATCCAAGCGTTAATTAG (SEQ ID NO.4)
[0040] GmXDH1a-R: ATCTGTTGTTCCAGCAAACC (SEQ ID NO.5)
[0041] 2. Construction of 4×MYC-GFP-GmXDH1a recombinant plasmid
[0042] (1) PCR amplification
[0043] Using soybean genomic cDNA as a template, PCR amplification was performed using the primers designed above to obtain the GmXDH1a gene shown in SEQ ID NO. 1, which has a sequence size of 4074 bp. The amplification reaction system is shown in Table 1, and the amplification reaction procedure is shown in Table 2.
[0044] Table 1 PCR amplification reaction system
[0045] Components Usage 2×Kodbuffer 10 μL dNTP 4 μL GmXDH1a-pUBI-4×MYC-F 0.5μL GmXDH1a-pUBI-4×MYC-R 0.5μL DNA template 1 μL DNA polymerase 0.5μL <![CDATA[ddH2O]]> 3.5 μL
[0046] Table 2 PCR amplification reaction program
[0047]
[0048] (2) Gel electrophoresis detection
[0049] 5 μL of PCR amplification product was taken for electrophoresis detection. The size of the amplified target band was 4074 bp, indicating that the GmXDH1a gene was successfully amplified.
[0050] (3) Purification of PCR amplification products
[0051] Purify the product using a PCR product purification kit from Sangon Biotech Co., Ltd. The specific steps are as follows:
[0052] 1) Make up the PCR amplification product to 100 μL, add 5 times the volume of Buffer B3, mix thoroughly, and transfer to the adsorption column;
[0053] 2) Centrifuge at 8000 rpm for 30 seconds and discard the liquid in the collection tube;
[0054] 3) Add 500 μL of Wash Solution to the adsorption column, centrifuge at 8000 rpm for 30 seconds, and discard the liquid in the collection tube;
[0055] 4) Repeat step 3) once;
[0056] 5) Centrifuge the empty column at 9000 rpm for 1 min;
[0057] 6) Place the adsorption column in a new 1.5 mL centrifuge tube. Add 25 μL of Eluent Buffer to the center of the column membrane. Let stand at room temperature for 2 minutes, then centrifuge at 9000 rpm for 1 minute. Collect the purified product for subsequent experiments or store at -20°C.
[0058] (4) Homologous recombination ligation
[0059] The pUBI-GFP-4×MYC vector ( Figure 1 ) Double enzyme digestion was performed with restriction endonucleases StuⅠ and KpnⅠ to obtain the vector digestion product. -Uni Seamless Cloning and Assembly Kit for homologous recombination ligation, the specific method is as follows:
[0060] The vector digestion product, the purified PCR amplification product, and the homologous recombinase were mixed according to the reaction system shown in Table 3, and reacted at 50° C. for 30 min to obtain a ligation product.
[0061] Table 3 Homologous recombination reaction system
[0062] Components Usage 2×AssemblyMix 5μL Target fragment: vector Amount of substance 2:1 <![CDATA[ddH2O]]> Make up to 10 μL
[0063] (5) Transformation into competent E. coli
[0064] 1) Take 50 μL of frozen DH5α competent cells, add 10 μL of the ligation product obtained in step (4), gently stir with a pipette tip to mix, and place on ice for 30 minutes;
[0065] 2) Heat shock at 42°C for 1 min 30 sec, cool on ice for 2 min, add 800 μL of antibiotic-free LB liquid medium, and incubate at 37°C with shaking at 150 rpm for 1 h;
[0066] 3) Collect the cells by centrifugation at 4000 rpm for 5 min, resuspend the cells, and evenly spread them on LB solid medium plates containing 50 mg / L kanamycin. Incubate the plates upside down at 37°C overnight.
[0067] Individual colonies grown on the plates were identified by colony PCR using the vector primers pUBI-GFP-4×MYC-F (SEQ ID NO. 4) and the intermediate primer GmXDH1a-R (SEQ ID NO. 5). The reaction system is shown in Table 4. Individual colonies were picked with a pipette tip and mixed into the reaction system before PCR. The reaction procedure is shown in Table 5. After the PCR reaction, the products were identified by electrophoresis. Positive clones should yield a 1084 bp PCR product. (Because the target fragment is too long, intermediate primers were designed during colony PCR identification. The amplified fragment is 1084 bp, but the full-length insert is still 4074 bp.)
[0068] Table 4 PCR identification reaction system
[0069] Components Usage 2×TaqMix 5μL PrimerF 0.5μL PrimerR 0.5μL <![CDATA[ddH2O]]> 4μL Single colony /
[0070] Table 5 PCR identification reaction procedure
[0071]
[0072] (6) Positive plasmid extraction and sequencing
[0073] 1) Pick a single colony that grows normally on LB solid medium, inoculate it into 2.0 mL of LB liquid medium, and culture with shaking at 37°C overnight (about 13 hours);
[0074] 2) Place 1.5 mL of the culture in an EP tube and centrifuge at 12,000 rpm at room temperature for 1 minute to collect the cells. Discard the supernatant and invert the tube to allow the liquid to drain as much as possible.
[0075] 3) Add 250 μL of Buffer P1 to the bacterial pellet and pipette until the cells are completely suspended.
[0076] 4) Add 250 μL of Buffer P2 and immediately mix by gently inverting the tube 10 times (do not shake vigorously). Incubate at room temperature for 3 minutes until the bacterial solution in the tube becomes clear.
[0077] 5) Add 350 μL of Buffer P3 and immediately mix thoroughly by gently inverting the tube 10 times;
[0078] 6) Place the liquid in the EP tube into a centrifuge and centrifuge at 12,000 rpm for 10 minutes. Carefully transfer all the supernatant into the adsorption column and centrifuge at 8,000 rpm for 30 seconds. Discard the liquid in the collection tube and place the adsorption column into the same collection tube.
[0079] 7) Add 500 μL of deproteinized Buffer DW1 to the adsorption column and centrifuge at 9,000 rpm for 30 seconds. Discard the liquid in the collection tube and place the adsorption column in the same collection tube.
[0080] 8) Add 500 μL of Wash Solution to the adsorption column, centrifuge at 9,000 rpm for 30 seconds, discard the liquid in the collection tube, and place the adsorption column in the same collection tube;
[0081] 9) Repeat step 8) once;
[0082] 10) Place the empty adsorption column and collection tube into a centrifuge and centrifuge at 12,000 rpm for 1 minute.
[0083] 11) Add 50 μL of Elution Buffer to the center of the adsorption membrane, let it stand at room temperature for 2 minutes, and then centrifuge at 12,000 rpm for 1 minute;
[0084] 12) Take 5 μL of the obtained plasmid for sequencing. The plasmid with correct sequencing (the structure map is as follows Figure 1 The pUBI-GFP-4×MYC vector shown above had a 4074 bp nucleotide sequence of GmXDH1a inserted between StuⅠ and KpnⅠ for subsequent experiments.
[0085] Example 2
[0086] 1. Plasmid transformation into Agrobacterium K599
[0087] 1) Take out 50 μL of frozen K599 competent cells, thaw on ice, add 1 μL of the correctly sequenced plasmid obtained in Example 1, gently stir with a pipette tip to mix, and place on ice for 30 minutes;
[0088] 2) After quick freezing in liquid nitrogen for 5 minutes, heat shock at 37°C for 5 minutes, and then cool in ice for 2 minutes;
[0089] 3) Add 800 μL of LB liquid medium without antibiotics and incubate at 28°C, 150 rpm, and shake for 4 h;
[0090] 4) Spread 100 μL of the shake-cultured bacterial solution evenly on LB solid medium (containing 50 mg / mL kanamycin and streptomycin) and incubate at 28°C for 2 days until a single colony grows.
[0091] 5) Colony PCR was used to detect whether the plasmid was successfully transformed into Agrobacterium K599;
[0092] 6) Select positive colonies and inoculate them into 5 mL of LB liquid medium containing the corresponding antibiotics. Cultivate with shaking at 200 rpm at 28°C overnight. Add an equal volume of 30% glycerol to the culture medium for preservation and freeze at -80°C for hairy root transformation.
[0093] 2. Soybean hairy root transformation
[0094] 1) Select large, plump, and spot-free mature soybean W82 seeds (Williams 82, obtained from the Agricultural Resources Research Center, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences) and evenly sprinkle them on a vermiculite surface, covered with 2 cm of vermiculite. Water the seeds and perform hairy root transformation after germination for 4 days, when the soybean cotyledons are about to open but have not yet opened (lateral roots are growing).
[0095] 2) The K599 strain containing the successfully transferred target plasmid was streaked onto LB solid medium (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, 15 g / L agar, ddH2O) for 2 days. One day before infection, a single colony was picked and inoculated into 4 mL of LB liquid medium (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, ddH2O) and cultured overnight at 28°C.
[0096] 3) The cultured strain was subcultured at a ratio of 1:100 (the volume of the bacterial solution depends on the number of explants) until the OD 600 =0.8~1(about 4h);
[0097] 4) Transfer the bacterial suspension to a sterile 50 mL centrifuge tube and centrifuge at 4,000 rpm for 10 min at room temperature. Discard the supernatant and resuspend the pellet in 1 / 10 MS liquid medium.
[0098] 5) When the cotyledons of the germinated seeds are about to open but not yet fully opened, remove the seed coat after the seeds turn green, cut the seeds 0.8 cm from the hypocotyl, and gently cut a cross-shaped wound at the lower end of the hypocotyl. Place the wounded explant in the bacterial solution obtained in 4) and gently shake it to infect for 30 minutes;
[0099] 6) Place sterile filter paper on a sterile culture dish, place the infected explant on the filter paper, and then place another layer of filter paper on top of the explant to remove excess bacterial solution.
[0100] 7) Place a layer of sterile filter paper on a culture dish and transfer the explants onto the filter paper moistened with 1 / 10 MS liquid medium (MS medium (containing Gamborg's vitamins) 0.44 g / L, sucrose 20 g / L, 2-morpholineethanesulfonic acid (MES) 3.9 g / L, pH 5.4) and culture in the dark at 24°C for 4 days.
[0101] 8) After the incubation period, transfer the explants to pre-saturated vermiculite and seal with transparent plastic film to maintain a moist environment and temperature. After one week, the explants will develop hairy roots, allowing for subsequent experiments.
[0102] 3. Cultivation of hairy root system plants
[0103] 1) Before transplanting, sterilize the vermiculite pots in an autoclave and the trays in a medical sterilizer under UV sterilization for 1 hour. After drying the pots and trays, fill them with vermiculite and pour enough BD nutrient solution (formula shown in Table 6). When transplanting, immerse the hypocotyls of the explants in the vermiculite.
[0104] 2) After transplanting, cover the plant with a transparent lid, leaving no space around it, and grow it in the dark for 3 days, then cultivate it under normal light conditions;
[0105] 3) When roots emerge, slowly open the transparent lid (when judging whether roots have emerged, you can gently pull out the plant to see if it can be pulled out), first open a small opening, then half open, and finally open it completely. Open the lid completely 2 days after roots emerge (do not open the lid all at once);
[0106] 4) Afterwards, water the plants alternately with distilled water (water without BD nutrient solution) and BD nutrient solution (BD nutrient solution added to distilled water at a ratio of 1:1000) (watering every 5 days with either distilled water without BD nutrient solution or distilled water with BD nutrient solution);
[0107] 5) 10 days after rooting, inoculate soybean Bradyrhizobium USDA110 (OD 600 = 0.08, diluted with distilled water), 30 mL per plant was used to infect soybeans and gently poured on the upper part of the root system around the soybean seedlings;
[0108] 6) 28 days after inoculation with rhizobia, the GFP fluorescent protein expressed by the 4×MYC vector was detected using a handheld fluorescence meter, and successfully transformed hairy roots were selected for subsequent measurements.
[0109] Table 6 BD nutrient solution formula (low nitrogen)
[0110]
[0111] Example 3 Comparison of the number of nodules in wild-type soybean plants and transgenic soybean plants
[0112] 1. Nodule number statistics
[0113] The number of nodules in single hairy roots of wild-type soybean plants (soybean plants transformed with an empty vector, EV) and transgenic soybean plants (soybean plants transformed with a GmXDH1a gene overexpression vector, 35::GmXDH1a) was counted. Figure 2 and Figure 3 As shown, it can be seen that the number of nodules in transgenic soybean plants is significantly increased compared with wild-type soybean plants, with an average increase of 46% per plant.
[0114] 2. Detection of GmXDH1a gene expression
[0115] Hairy root samples were collected and RNA was extracted using TRIpure Reagent. RNA was then converted to cDNA using RNA reverse transcriptase, and qPCR analysis was performed using designed gene expression detection primers. The primer sequences are shown in SEQ ID NOs. 6 and 7; the reaction system is shown in Table 7, and the reaction procedure was performed using an AB I7500 PCR / Bio-rad MyCycler instrument. The specific reaction procedure is shown in Table 8. The primer sequences are as follows:
[0116] GmXDH1a-F1 (SEQ ID NO.6): CAATATTTGATGCATTCCGGGT
[0117] GmXDH1a-R1(SEQ ID NO.7):TATCCATTATCACCACCTACGC
[0118] Table 7 Reaction system for qPCR detection of gene expression
[0119]
[0120] Table 8 qPCR reaction procedures for detecting gene expression
[0121]
[0122] The results are as follows Figure 4 As shown, it can be seen that the expression level of GmXDH1a gene in transgenic soybean plants is significantly higher than that in wild-type soybean plants, indicating that overexpression of GmXDH1a gene can increase the number of root nodules in soybean plants, thereby increasing soybean nitrogenase activity, promoting soybean symbiotic nitrogen fixation, and increasing soybean yield.
[0123] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.
Claims
1. Use of overexpression of the GmXDH1a gene in any of the following: (a) Increase the number of root nodules in legumes; (b) Breeding leguminous plant varieties with increased nodule numbers; (c) improving nitrogen fixation efficiency in legumes; (d) Breeding leguminous plant varieties with improved nitrogen fixation efficiency; The nucleotide sequence of the GmXDH1a gene is shown in SEQ ID NO.
1.
2. The use according to claim 1, characterized in that The legume is soybean.
3. A method for increasing the number of soybean nodules, characterized in that: The steps include: (1) constructing an overexpression vector of the GmXDH1a gene and transforming it into Agrobacterium competent cells to obtain an engineered bacterium; the nucleotide sequence of the GmXDH1a gene is shown in SEQ ID NO.1; (2) Infecting soybean plant tissue with the engineered bacteria obtained in step (1), performing plant tissue culture, and obtaining transgenic soybean plants with increased nodule numbers.
4. The method according to claim 3, wherein The vector backbone of the overexpression vector in step (1) is a pUBI-GFP-4×MYC vector.
5. The method according to claim 4, wherein The method for constructing the overexpression vector in step (1) is as follows: using soybean genomic cDNA as a template, performing PCR amplification with primers GmXDH1a-pUBI-4×MYC-F and GmXDH1a-pUBI-4×MYC-R to obtain a PCR amplification product; and homologously recombine-linking the PCR amplification product with the pUBI-GFP-4×MYC vector to obtain an overexpression vector of the GmXDH1a gene.
6. The method according to claim 5, wherein The nucleotide sequence of the GmXDH1a-pUBI-4×MYC-F is shown in SEQ ID NO.2, and the nucleotide sequence of the GmXDH1a-pUBI-4×MYC-R is shown in SEQ ID NO.
3.
7. The method according to claim 3, wherein The Agrobacterium in step (1) is Agrobacterium K599.
8. The method according to claim 3, wherein The infected part in step (2) is the soybean root.
9. Use of the transgenic soybean plant obtained by the method according to any one of claims 3 to 8 in cultivation in a low-nitrogen soil environment.