Application of soybean GmPCFS4a gene in regulation and control of seed appearance quality

Abstract

The invention discloses an application of a soybean GmPCFS4a gene in regulating and controlling the appearance quality of seeds. According to the invention, the GmPCFS4a gene is transferred into the cultivation type soybean Huachun 6, soybean seeds over-expressing the gene are obviously smaller than that of the control Huachun 6, and the grain length, the grain width and the grain thickness are obviously reduced; the result shows that the GmPCFS4a gene can inhibit appearance characters such as seed length, seed width, seed thickness and the like. Therefore, the GmPCFS4a gene can be used for improving the appearance quality of plant seeds, especially soybean seeds.

Description

Technical Field

[0001] This invention belongs to the field of biological breeding technology, specifically involving the application of the soybean GmPCFS4a gene in regulating seed appearance quality. Background Art

[0002] Soybean (Glycine max (L.) Merr.) is an important dual-purpose crop for grain, oil, and feed, and a significant source of plant-based protein and oil. Seed shape and size are crucial economic traits determining soybean yield and quality, making the selection of varieties with suitable seed shape and size a key objective of soybean breeding. Morphological studies of soybean seeds primarily focus on seed length, width, and thickness. Differences in seed size and shape significantly impact appearance and quality, consequently affecting commercial attributes and market prices. Existing research indicates that large-seed-diameter soybean varieties not only fail to increase seed yield but also lead to decreased total seed yield, lower lipid content, and no increase in protein content. Large-grained soybeans present several disadvantages in production and application: requiring more seeds for the same germination rate, increasing seed costs; seed size is significantly negatively correlated with field germination rate, with larger seeds exhibiting lower germination rates and resistance; large seeds are more susceptible to mechanical damage during harvest, affecting their appearance and physiological quality; and they require more coating agents during seed processing, leading to higher transportation costs. Therefore, modifying the appearance and quality of soybean seeds through biotechnology breeding is an urgent task in agricultural production. Summary of the Invention

[0003] To address the aforementioned technical problems, this invention aims to discover important genes that control the appearance quality of soybean seeds and to use genetic engineering techniques to alter the appearance quality of soybean seeds, providing the application of the soybean GmPCFS4a gene in regulating seed appearance quality.

[0004] The first objective of this invention is to provide the application of overexpression of the GmPCFS4a gene or GmPCFS4a protein in regulating the appearance quality of soybean seeds, wherein the CDS nucleotide sequence of the GmPCFS4a gene is shown in SEQ ID NO.1 and the amino acid sequence of the GmPCFS4a protein is shown in SEQ ID NO.2.

[0005] Preferably, the regulation of soybean seed appearance quality involves reducing the length, width, and thickness of soybean seeds.

[0006] A second objective of this invention is to provide a method for obtaining soybeans with improved seed appearance quality, comprising the step of overexpressing the GmPCFS4a gene in soybeans.

[0007] Preferably, the method includes the following steps: extracting soybean RNA, reverse transcribing it into cDNA, using it as a template for PCR reaction, performing PCR amplification with primers pcfs4a-F and pcfs4a-R, purifying and recovering the target fragment from the PCR product, and then performing homologous recombination with the linearized overexpression vector pTF101-Flag to obtain the target recombinant plasmid, transforming it into Agrobacterium EHA105, and then performing soybean genetic transformation to obtain transgenic positive plants, which are soybeans with improved seed appearance quality; the nucleotide sequence of primer pcfs4a-F is shown in SEQ ID NO.3, and the nucleotide sequence of primer pcfs4a-R is shown in SEQ ID NO.4.

[0008] Preferably, the improved seed appearance quality involves reducing the length, width, and thickness of soybean seeds.

[0009] This invention involves transferring the GmPCFS4a gene into the cultivated soybean variety Huachun 6. Soybean seeds overexpressing this gene are significantly smaller than the control Huachun 6, with significantly reduced seed length, width, and thickness. This indicates that the GmPCFS4a gene can suppress seed appearance traits such as seed length, width, and thickness. This invention reveals for the first time the biological function of the soybean GmPCFS4a gene in controlling the appearance quality of soybean seeds. Therefore, the GmPCFS4a gene can be used to improve the appearance quality of plant seeds, especially soybean seeds. Attached Figure Description

[0010] Figure 1 This is a phylogenetic analysis of GmPCFS4; Note: The phylogenetic tree was analyzed using the nearest neighbor method; the species name or accession number of the protein used in the phylogenetic analysis is located on the right side of the branch: Nycol: Blue Star Water Lily; AmTrH1: Oil-free Camphor; Bradi: Two-spike Short-stalked Grass; AT: Arabidopsis thaliana; Bol: Cabbage; Cucsa: Cucumber; Morus notabilis: Mulberry; Prope: Peach; Medtr: Tribulus terrestris; Phvul: Common Bean; Glyma: Soybean; Glyso: Wild Soybean.

[0011] Figure 2 The values ​​represent the expression levels of GmPCFS4a transgenic plants. Note: The expression levels of transgenic plants were detected using qRT-PCR technology. The data are the average of three replicates, and the error bars represent the standard errors. HC6 is the control. The numbers 1-12 correspond to the quantitative results of 12 independent lines from GmPCFS4a-1 to GmPCFS4a-12.

[0012] Figure 3This is a Western blot analysis of GmPCFS4a transgenic plants; Note: M is the protein marker; (-) negative control plants; GmPCFS4a-Flag-1 and GmPCFS4a-Flag-2 are the corresponding target protein bands.

[0013] Figure 4 This is a statistical analysis of the seed grain type phenotype of soybean transgenic plants of wild-type HC6 and GmPCFS4a; Note: Figure a shows the statistical data and phenotype of grain length of GmPCFS4a and HC6; Figure b shows the statistical data and phenotype of grain width of GmPCFS4a and HC6; Figure c shows the statistical data and phenotype of grain thickness of GmPCFS4a and HC6; Error bars represent standard errors. The results were obtained using a two-tailed samples t-test to generate p-values, *p<0.05, **p<0.01, scale bar = 1cm. Detailed Implementation

[0014] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0015] Example 1

[0016] I. Methods

[0017] 1. Construction of gene expression vector

[0018] 1.1 Total RNA extraction from the genome

[0019] The experimental procedure was as follows: The FastPure Universal Plant Total RNA Isolation Kit (Nanjing Novizan Biotechnology Co., Ltd.) was used according to the kit's instructions. The specific experimental steps are as follows:

[0020] (1) Take fresh soybean tissue samples, put them into pre-cooled centrifuge tubes and quickly immerse them in liquid nitrogen to freeze. Then, grind them thoroughly in a low-temperature environment using a high-frequency vibrating ultrafine powder mill to finally obtain a uniform powder sample.

[0021] (2) Quickly add 600 μL of Buffer PSL to the centrifuge tube, vortex for 30 seconds to ensure that the sample and lysis buffer are thoroughly mixed, and then centrifuge at 12,000 rpm for 5 min. The resulting supernatant is directly fed into the process.

[0022] (3) Take about 500 μL of the supernatant into the FastPure g DNA-Filter Columns Ⅲ that has been placed in the collection tube, centrifuge at 12,000 rpm for 30 s, discard the FastPure g DMA-Filter Columns Ⅲ, and collect the filtrate.

[0023] (4) Add 0.5 times the volume of the filtrate of anhydrous ethanol (250 μL) to the collection tube, and then vortex for 15 s to achieve thorough mixing.

[0024] (5) Pipette the above mixture into FastPure RNA Columns V (which is pre-loaded into the collection tube), then centrifuge at 12,000 rpm for 30 s and discard the waste liquid in the collection tube.

[0025] (6) Add 700 μL of Buffer RWA to FastPure RNA Columns V, centrifuge at 12,000 rpm for 30 seconds and discard the filtrate.

[0026] (7) Add 500 μL of Buffer RWB to FastPure RNA Columns V, centrifuge at 12,000 rpm for 30 s, and discard the filtrate.

[0027] (8) Repeat step 7 once.

[0028] (9) Put FastPure RNA Columns V back into the collection tube and centrifuge at 12,000 rpm for 2 min.

[0029] (10) Transfer FastPure RNA Columns V to a new 1.5 mL RNase-free collection tube, add 30-100 μL of RNase-free ddH2O to the center of the adsorption column membrane, and centrifuge at 12,000 rpm for 1 min.

[0030] 1.2 Carrier Construction

[0031] (1) First-strand cDNA required for reverse transcription synthesis experiment

[0032] Strictly following the instructions of the PrimeScript™ 1st Strand cDNA synthesis Kit (Takara, Japan), using purified total RNA as a template, genomic DNA was removed according to the reaction system in Table 1 (Step 1); then reverse transcription was performed according to the reaction system in Table 2. The synthesized cDNA was stored at -20°C for subsequent experiments, avoiding repeated freeze-thaw cycles.

[0033] Table 1. Genomic DNA Removal Reaction System (10 μL)

[0034]

[0035] Table 2 Reverse transcription system (20 μL)

[0036]

[0037] (2) Gene cloning

[0038] The first-strand cDNA synthesized in the previous step is used as the template for the PCR reaction. The specific steps are as follows:

[0039] Primers were designed based on the CDS sequence of the GmPCFS4a gene (the nucleotide sequence of the GmPCFS4a gene CDS is shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.2) (pcfs4a-F: gagaacacgggggactcta gaATGTTCTCTCAAAACGTGATTCTCC (SEQ ID NO.3); pcfs4a-R: atccttgtagtccatggatccAC TTCGCATTCGTTTCCTTTGG (SEQ ID NO.4)). Primer Primer 5.0 was used. The target gene was amplified using the phenotype high-fidelity phataase. All components were mixed and added to centrifuge tubes, vortexed, centrifuged, and then placed on ice for PCR. The PCR reaction system and procedure are shown in Tables 3 and 4.

[0040] Table 3. PCR reaction system for target gene amplification (20 μL)

[0041]

[0042] Table 4. PCR reaction procedure for target gene amplification

[0043]

[0044]

[0045] (3) Recovery of PCR amplification products of the target gene

[0046] The amplification products were recovered using a PCR product recovery kit. The experimental procedure is as follows:

[0047] 1) Place the PCR product into a 1.5 mL centrifuge tube;

[0048] 2) Add an appropriate volume of Buffer DP to the product and mix by inverting for 10-15 seconds.

[0049] 3) Briefly centrifuge to collect the droplets on the tube wall.

[0050] 4) Attach the HiPure DNA column to the collection tube. Transfer the mixture to the column. Centrifuge at 10,000 rpm for 15–60 seconds;

[0051] 5) After discarding the filtrate in the collection tube, reassemble the column into the original collection tube and add 600 μL of Buffer DW2 pre-diluted with anhydrous ethanol to the column. Then centrifuge at 10,000 rpm for 15–60 s to complete the column-membrane binding reaction.

[0052] 6) Discard the filtrate, put the column back into the collection tube, and add 300 μL of Buffer DW2 (diluted with anhydrous ethanol) to the column. Centrifuge at 10,000 rpm for 2 min.

[0053] 7) Discard the filtrate, put the column back into the collection tube, and add 300 μL of Buffer DW2 (diluted with anhydrous ethanol) to the column. Centrifuge at 10,000 rpm for 2 min.

[0054] 8) Vertically install the column into a 2 mL centrifuge tube. Using a micropipette, precisely transfer 10–50 μL of double-distilled water (ddH2O) to the center of the column membrane. Incubate at room temperature for 2–5 minutes to fully wet the matrix. Centrifuge at 10,000 rpm for 1 minute. Discard the column and store the DNA at -20°C.

[0055] (4) Homologous recombination

[0056] 1) Take the PCR purification and recovery target fragment obtained in step (3) for later use.

[0057] 2) Obtaining the linearized overexpression vector pTF101-Flag: The circular overexpression vector was double-digested with enzymes to obtain the linearized vector. The double-digestion system is shown in Table 5. After mixing the reaction system, the reaction was carried out in a water bath at 37°C (the time was determined according to the plasmid concentration). The enzyme digestion products were purified and recovered, and the concentration of the solution was determined.

[0058] Table 5. Double enzyme digestion system (50 μL)

[0059]

[0060]

[0061] 3) Connecting the linearized carrier and the inserted fragment

[0062] The target fragment, which has been purified and recovered by PCR, and the linearized vector were subjected to homologous recombination. The reaction system is shown in Table 6. After mixing, the mixture was incubated at 50°C for 5–15 min in a PCR instrument. The resulting recombination ligation product is the recombinant plasmid of the target gene.

[0063] Table 6. Homologous recombination systems (10 μL)

[0064]

[0065] (5) Transformation of Escherichia coli DH5α competent cells with the target gene

[0066] The experimental procedure is as follows:

[0067] 1) Construction of transformation system: Mix the recombinant ligation product with competent cells, gently tap the centrifuge tube wall to promote uniform contact between the vector and cells, and incubate on ice for 30 min;

[0068] 2) Heat shock-recovery treatment: After ice bath, transfer the mixture to a 42℃ metal bath for heat shock for 90s, then quickly ice bath for 3min (avoid shaking); add recovery medium, and incubate at 37℃ and 200rpm for 1h with shaking.

[0069] 3) Bacterial cell collection and plating: Centrifuge at 5,000 rpm for 5 min at room temperature, discard the supernatant and keep 200 μL of bacterial suspension and precipitate; spread the bacterial cells evenly on LB solid medium containing antibiotics and incubate upside down at 37℃ for 12-16 h.

[0070] 4) Single colony amplification: Select 3-5 morphologically typical single colonies, inoculate them into LB liquid medium, and incubate at 37℃ and 200 rpm for 12 h with shaking.

[0071] 5) Initial screening by colony PCR: Take 1 μL of bacterial culture as a template and amplify it by PCR using specific primers (M13fwd: TGTAAAACGACGGCCAGT; pcfs4a-201-JP-R: CATCCCTTGCTGGCATCTTG). Identify positive clones by electrophoresis.

[0072] 6) Sequencing verification: The initial screening positive bacterial culture was sent to the sequencing platform for Sanger sequencing, and the accuracy of the foreign fragment insertion was confirmed by sequence alignment.

[0073] Recombinants were identified using Rapid Taq Master Mix enzyme. The mixed components were vortexed, centrifuged, placed on ice, and then subjected to PCR. The reaction system and reaction procedure are shown in Tables 7 and 8.

[0074] Table 7. PCR reaction system for recombinant colonies (20 μL)

[0075]

[0076] Table 8. PCR reaction procedure for recombinant colonies

[0077]

[0078] (6) Agrobacterium-mediated transformation steps

[0079] For subsequent soybean genetic transformation, the target gene plasmid was transferred into Agrobacterium EHA105.

[0080] 1) Resuscitation of competent cells: Agrobacterium competent cells stored at -80℃ were placed in an ice-water bath and slowly thawed until the suspension became clear.

[0081] 2) Add 1 μL of the target gene recombinant plasmid to the thawed cell suspension and mix gently by pipetting; incubate on ice for 30 min to promote contact between the plasmid and the cell membrane.

[0082] 3) Quickly freeze in liquid nitrogen for 5 minutes, then rapidly transfer to a 37°C water bath for 5 minutes of heat shock; immediately stop the reaction by placing it in an ice bath for 5 minutes to stabilize the transformed complex.

[0083] 4) Add 500 μL of antibiotic-free YEP liquid culture medium to the clean bench and culture at 28-30℃ and 200 rpm for 2-3 hours to restore cell metabolic activity.

[0084] 5) Centrifuge at 5,000 rpm for 5 min, discard the supernatant and keep 100 μL of bacterial suspension; after resuspending the bacterial cells, take 50 μL and spread it evenly on YEP solid plates containing the corresponding antibiotics, air dry at room temperature and then invert and incubate at 28℃ for 48-72 h.

[0085] 6) Select a single colony for colony PCR and confirm the size of the target band by 1% agarose gel electrophoresis; select the strain that has been verified by sequencing for expansion culture, add 25% glycerol to the final concentration and store at -80℃ for a long time.

[0086] 2. Soybean genetic transformation

[0087] (1) Selecting seeds

[0088] Soybean genetic transformation has high requirements for seeds. Seeds that are plump, free of insect holes, and have good color should be selected and stored in a -20℃ refrigerator for later use.

[0089] (2) Sterilization of seeds

[0090] The seeds were sterilized by chlorine fumigation. Selected and stored wild-type soybean HC6 (Huachun 6 soybean) seeds were taken out from a -20℃ freezer, soaked in 75% alcohol for 1 minute, wiped dry, arranged in a single layer in a petri dish, and then placed in a fume hood desiccator. A 250mL beaker was placed in the desiccator, 100mL of sodium hypochlorite was added, and 5mL of concentrated hydrochloric acid was added. The desiccator was covered and sterilized for 13.5 hours. The seeds were then removed and air-dried in a clean bench and stored at room temperature for later use.

[0091] (3) Soaking seeds

[0092] Soybeans were soaked in sterilized ddH2O and placed in a dark environment at 24°C for 10–16 hours. They were then used the next day when preparing explants.

[0093] (4) Large-scale culture of bacterial culture

[0094] The EHA105 bacterial culture transformed with the target plasmid was extracted and added to 5 mL of YEP liquid medium containing 100 mg / L Spec and 30 mg / L Rif. The culture was incubated overnight at 28°C and 220 rpm on a shaker. After the culture became turbid, it was transferred to 150 mL of YEP liquid medium containing 100 mg / L Spec and 30 mg / L Rif and incubated overnight. The bacterial culture was collected and centrifuged at 4000 rpm and 25°C for 10 min. The supernatant was discarded, and the collected culture was resuspended. The culture was then placed in a shaker at 200 rpm and an ambient temperature of 22–25°C, and incubated in the dark at 22°C for 3 days. After the incubation period, the explants were transferred to shoot induction medium containing selection agents and cultured for 14 days.

[0095] (5) Preparation of resuspension

[0096] The absorbance (OD) of the bacterial suspension was measured the following day. 600 Pour the bacterial culture into a sterile 50mL centrifuge tube and centrifuge at 5000rpm for 10min; discard the supernatant and resuspend the bacterial cells in CCM liquid medium to allow the OD to adjust. 600 =0.6~0.8, store at 4℃ for the next experiment.

[0097] (6) Infection

[0098] In a clean bench, the hypocotyl of the soaked seeds was cut open using tweezers and a scalpel. The seeds were then vertically split along the cotyledons, and the buds, epicotyl, and seed coat on the cotyledons were removed. The cotyledonary explants were then immersed in a prepared CCM resuspension, sonicated for 3 minutes, vacuumed for 10 minutes, and shaken at 120–150 rpm for 40 minutes at 28°C. After infection, the bacterial suspension was poured out, and the explants were spread evenly on a CCM solid culture medium lined with filter paper using tweezers. The explants were sealed with medical tape and placed in a tissue culture room at 22°C for 48 hours in the dark and then incubated under light until the cotyledons turned completely green.

[0099] (7) Induction of young shoots

[0100] The hypocotyl was precisely removed using a sterile scalpel, preserving healthy tissue. Explants were inserted at a 45° angle into bud induction medium (containing 0.5 mg / L 6-BA), and the culture dishes were sealed with medical tape. The culture was then placed in a tissue culture room (temperature 22±1℃, photoperiod 16h light / 8h dark) for 14 days. After the initial culture, the explants were aseptically transferred to fresh bud induction medium. Undifferentiated clustered buds were removed from the explants, leaving 6–7 valid samples per dish. The culture dishes were resealed, and induction continued for another 14 days under the same environmental conditions, monitoring the progress of adventitious bud morphogenesis.

[0101] (8) Growth of young buds

[0102] After 4 weeks of in vitro shoot induction culture, undifferentiated tissues were screened out, and explants that had formed clusters of adventitious shoots were selected. After removing the cotyledons, they were transferred to shoot elongation medium, ensuring that the cut surface of the explant was in full contact with the medium substrate to promote organogenesis. Six to seven explants were placed in each culture dish and placed in the tissue culture room. The medium was changed every 14 days; this was the longest stage. The stem elongation medium was changed every 14 days until the seedlings grew to a certain length, at which point they were transferred to rooting medium.

[0103] (9) Rooting

[0104] Seedlings with shoot elongation >3cm were selected and cut into detached sections 1-2mm from the root tip using a sterile scalpel. The detached shoot segments were then immersed in a 1.0mg / L indolebutyric acid (IBA) solution for 60s to promote callus formation. During this process, the tweezers sterilized by an alcohol lamp needed to be cooled to room temperature; otherwise, they would be burned when picking the shoots, and the roots would not be able to absorb nutrients from the culture medium.

[0105] (10) Transplanting seedlings

[0106] After the plant has developed 5-6 roots in the rooting medium, unscrew the cap of the tissue culture bottle and add a small amount of distilled water to the medium to allow the seedlings to adapt to the external environment for 1-2 days. Then, carefully remove the plant from the rooting medium, being careful not to damage the roots. Gently rinse the roots with tap water to remove the medium. Transplant the seedlings into sterilized nutrient soil (vermiculite: substrate soil = 1:2) and place them in a warm and humid seedling tray. Newly transplanted seedlings are less adapted to the external environment and should not be exposed to strong light. After transplanting, gently cover them with a black plastic bag or a suitably sized lid to block light. Place the treated seedlings in an incubator at 26℃ with a 16-hour light / 8-hour dark photoperiod. During this period, maintain humidity by spraying the leaves with water every 1-2 days. Once the plants are larger, open the lid and fertilize. After they have grown larger, transfer them to flowerpots.

[0107] 3. Real-time fluorescence quantification

[0108] 3.1 Sampling

[0109] Take the same part of fresh leaves and put it into a 1.5 mL centrifuge tube with steel balls, then quickly place it in liquid nitrogen. Grind it into powder using a high-speed grinder.

[0110] 3.2 Real-time quantitative PCR (qRT-PCR)

[0111] Real-time quantitative PCR primers were designed across introns (see Table 9) and their specificity was compared using NCBI.

[0112] Table 9 Primers for Quantitative Real-Time PCR

[0113]

[0114] The quantitative PCR reaction system was prepared using Novizan Taq Pro Universal SYBR qPCR Master Mix (see Table 10). The system was prepared fresh and placed on ice. Then, the quantitative PCR reaction program was performed (see Table 11).

[0115] Table 10 Quantitative PCR reaction system (10 μL)

[0116]

[0117] Table 11 Quantitative PCR reaction procedure

[0118]

[0119] 4. Detection of transgenic plants

[0120] 4.1 Western-Blot Detection

[0121] (1) Plant protein extraction

[0122] Leaves from the same part of the GmPCFS4a transgenic plant and the wild-type HC6 were placed in a 1.5mL centrifuge tube containing steel balls, quickly placed in liquid nitrogen, and ground in a grinder with the program set to 60Hz and 120s.

[0123] (2) SDS-PAGE electrophoresis

[0124] 1) Gel preparation: Select a suitable concentration of PAGE gel based on protein size, and prepare the gel using the Yaxin 10% SDS-PAGE Gel Preparative Kit. Lower gel: 4 mL lower gel solution ①, 4 mL lower gel solution ②, 40 μL coagulant. After solidification, add the upper gel. Upper gel: 750 μL upper gel solution ①, 750 μL upper gel solution ②, 15 μL coagulant. Add anhydrous ethanol for sealing. Reserve the upper gel after solidification.

[0125] 2) Protein denaturation: Add the broken protein sample to the diluted 1.5× loading buffer in proportion, vortex to mix, incubate at 95℃ for 20 min, centrifuge and aspirate the supernatant for later use.

[0126] 3) Electrophoresis: Evenly spot the sample into the well for electrophoresis, adjust the voltage to 180V, and run for 45 minutes.

[0127] (3) Western blot

[0128] 1) Transfer: Use a GenScript fast transfer apparatus for transfer. Cut an NC membrane to the appropriate size according to the gel size. Immerse the NC membrane in the prepared membrane equilibration solution and place it in a sandwich structure: sponge-NC membrane-protein gel-sponge for transfer, with the NC membrane facing the positive electrode. Adjust the transfer time according to the protein size; the standard mode is 10 minutes, and the long mode is 16 minutes.

[0129] 2) After successful transfer, the marker can be clearly seen on the membrane. Wash the membrane with TBST for 10 minutes; seal it with 5% skim milk powder prepared with TBST for 2 hours.

[0130] 3) Add the primary antibody to 5% skim milk powder at a ratio of 1:2000 in TBST and incubate overnight in a cold storage.

[0131] 4) Clean the membrane with TBST for 10 min / time, for a total of 3 times; add secondary antibody to TBST containing 5% skim milk powder at a ratio of 1:2000 and incubate at room temperature for 1 h.

[0132] 5) Clean the membrane with TBST for 10 minutes each time, for three times; develop with ELC luminescent developer and take pictures.

[0133] Measurement of appearance quality traits of soybean seeds from wild-type HC6 and GmPCFS4a transgenic plants

[0134] Wild-type HC6 and GmPCFS4a transgenic plants were planted in outdoor flowerpots, with two plants per pot, and ten plants were selected from each pot. After maturity, the grain length, width, and thickness were investigated. A t-test was used to analyze whether there were significant differences in grain length, width, and thickness between GmPCFS4a transgenic plants and wild-type HC6 soybean seeds.

[0135] 2. Results

[0136] 1. Phylogenetic analysis of the GmPCFS4 gene

[0137] To analyze the evolutionary relationship of Arabidopsis thaliana PCFS4 in soybean and to identify PCFS4 homologous genes in soybean, a phylogenetic tree was constructed. The results ( Figure 1The results showed that homology analysis revealed three homologous genes of Arabidopsis thaliana PCFS4 (AT4G04885) in soybean: Glyma.20G142500 (GmPCFS4a), Glyma.10G251100 (GmPCFS4b), and Glyma.10G251200 (GmPCFS4c). These soybean genes Glyma.20G142500, Glyma.10G251100, and Glyma.10G251200 formed a highly conserved cluster with a score of 100, indicating that they share a common ancestor in the soybean genome and may belong to the same gene family. Alfalfa and soybean genes formed a high-confidence branch (Bootstrap value ≥ 89.9), indicating a close homology relationship in soybean genes. Amino acid sequence alignment revealed that GmPCFS4a and GmPCFS4b have high homology and both possess a conserved RPR domain. Sequence alignment of GmPCFS4c showed that this conserved domain was missing, suggesting that GmPCFS4c may have lost its function during evolution.

[0138] 2. Identification of positive seedlings of GmPCFS4a transgenic plants

[0139] To verify the function of GmPCFS4a in regulating seed appearance quality in soybean, an overexpression vector with a 35S promoter and a 3×Flag tag was constructed, resulting in the 35::GmPCFS4a:Flag vector, which was then transformed into Huachun 6 soybean (HC6). The relative expression levels of HC6 and GmPCFS4a transgenic plants were analyzed using qRT-PCR. Plants with good growth and one high and one low relative expression level were selected for further investigation. Two lines, GmPCFS4a-1 and GmPCFS4a-2, were chosen for phenotypic observation. Figure 2 ).

[0140] Western blotting was used to validate positive T0 plants identified by PCR. Total protein was extracted from T0 plants, and after SDS-PAGE gel electrophoresis, the protein was transferred to a membrane. According to the Expasy website (https: / / web.expasy.org / protparam), the predicted protein size of GmPCFS4a was 107 kDa, 3×Flag was 3 kDa, and the internal control Actin was 43 kDa. The internal control protein served as a standard reference for protein expression levels, allowing for quantification and comparison of target protein expression. For proteins >100 kDa, the transfer time was adjusted to a longer setting of 16 min. After transfer, a clear marker was observed. After washing with TBST, the membrane was blocked and incubated overnight with primary antibody. Since the target and internal control proteins differed significantly in size, the NC membrane was cut open to separately incubate with mouse-derived Flag and Actin antibodies. After washing, the membrane was incubated with secondary antibodies of the same origin before exposure and development. Figure 3 It can be seen that the target protein is located at 110 kDa, which matches the predicted size of the target protein.

[0141] 3. Analysis of differences in grain shape in soybeans overexpressing GmPCFS4a

[0142] To investigate the effects of the GmPCFS4a gene on soybean seed morphology, the seed length, width, and thickness of mature seeds from the GmPCFS4a transgenic line and HC6 were measured. The results of the seed length measurement showed ( Figure 4 In the study (a), the average grain length of HC6 was 0.740±0.0189 cm, while the average grain lengths of GmPCFS4a-1 and GmPCFS4a-2 were 0.711±0.024 cm and 0.588±0.047 cm, respectively. Compared with HC6, the grain length of the GmPCFS4a overexpression lines was significantly reduced, with decreases of 3.88% and 20.47%, respectively. Grain width measurements showed ( Figure 4 In section b), the average grain width of HC6 was 0.597±0.012 cm, while the average grain widths of GmPCFS4a-1 and GmPCFS4a-2 were 0.565±0.013 cm and 0.529±0.015 cm, respectively. The grain width of the GmPCFS4a transgenic line was significantly lower than that of the wild-type HC6, with reductions of 5.28% and 11.38%, respectively. Grain thickness measurements showed ( Figure 4In section c), the average grain thickness of HC6 was 0.465±0.012 cm, while the average grain thicknesses of GmPCFS4a-1 and GmPCFS4a-2 were 0.446±0.011 mm and 0.457±0.010 cm, respectively. The grain thickness of the GmPCFS4a transgenic lines was significantly lower than that of wild-type HC6, with reductions of 4.07% and 1.64%, respectively. These results indicate that the expression level of GmPCFS4a was significantly negatively correlated with grain length, width, and thickness.

Claims

1. Application of overexpressing the GmPCFS4a gene or GmPCFS4a protein in regulating the appearance quality of soybean seeds. The CDS nucleotide sequence of the GmPCFS4a gene is shown in SEQ ID NO.1, and the amino acid sequence of the GmPCFS4a protein is shown in SEQ ID NO.

2.

2. The use according to claim 1, characterized in that The regulating the appearance quality of soybean seeds is to reduce the length, width and thickness of soybean seeds.

3. A method for obtaining soybeans with improved seed appearance quality, characterized in that: The invention comprises the steps of overexpressing the GmPCFS4a gene in soybean.

4. The method according to claim 3, characterized in that The following steps are involved: Soybean RNA is extracted, reverse transcribed into cDNA, and used as a PCR reaction template. PCR amplification is performed using primers pcfs4a-F and pcfs4a-R. The PCR product is purified and the target fragment is recovered, followed by homologous recombination with a linearized overexpression vector pTF101-Flag to obtain a target recombinant plasmid, which is then transformed into Agrobacterium EHA105. Then, soybean genetic transformation is performed to obtain transgenic positive plants, namely soybeans with improved seed appearance quality. The nucleotide sequence of the primer pcfs4a-F is shown in SEQ ID NO.3, and the nucleotide sequence of the primer pcfs4a-R is shown in SEQ ID NO.

4.

5. The method according to claim 3, characterized in that The improved seed appearance quality is to reduce the length, width and thickness of soybean seeds.

Images