Method for cultivating drought-resistant and high-temperature-resistant plant by expressing GmSBT1.2b

Abstract

The invention discloses a method for cultivating a drought-resistant and high-temperature-resistant plant by expressing GmSBT1.2b. The method comprises a kit, the kit is used for operating specific molecular biology of a target gene, and the method comprises the following steps: (1) determining the target gene: the target gene comprises: a, a soybean source gene with the gene number of Glyma. 05G051500; b, a gene which has the same or corresponding biological functions with the gene a, has 90% similarity with the gene a, and also comprises a known gene or a newly identified unknown gene; and (2) carrying out specific molecular biological operation, namely increasing or reducing the expression quantity of the target gene. According to the method for cultivating the drought-resistant and high-temperature-resistant plant by expressing the Glyma. 05G051500 provided by the invention, a transgenic plant is obtained by transforming a receptor soybean plant by constructing an overexpression vector, so that the survival rate of soybeans under drought and high-temperature stress can be remarkably promoted.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to a method for cultivating drought-resistant and high-temperature-resistant plants by expressing GmSBT1.2b. Background Art

[0002] Providing a new method for cultivating drought- and high-temperature-resistant plants by overexpressing GmSBT1.2b is the key to the technical solution of the present invention. Summary of the Invention

[0003] In view of this, the present invention provides a method for cultivating drought-resistant and high-temperature-resistant plants by expressing GmSBT1.2b.

[0004] In order to solve the above technical problems, the present invention adopts the following technical solutions:

[0005] A method for cultivating drought-resistant and heat-resistant plants by expressing GmSBT1.2b, comprising: a kit for performing specific molecular biological operations on a target gene, specifically comprising the following steps:

[0006] (1) Determine the target gene:

[0007] The target genes include:

[0008] a. soybean-derived gene with gene number Glyma.05G051500;

[0009] b. Genes having equivalent or corresponding biological functions to the soybean-derived gene Glyma.05G051500, with a similarity of 90%, including known genes or newly identified unknown genes;

[0010] (2) Perform specific molecular biology operations:

[0011] This includes increasing or decreasing the expression level of the target gene.

[0012] Preferably, the kit comprises necessary genetic engineering components for overexpressing the target gene.

[0013] Preferably, the necessary genetic engineering group is selected from: one or any combination of template DNA, primers, enzymes, recombinant expression vectors, buffer solutions and infection media.

[0014] Preferably, the recombinant expression vector contains a target gene cDNA vector, and the vector is pTF101.

[0015] Preferably, the method for increasing the expression of the target gene in crops is as follows:

[0016] (1) Construct an overexpression vector containing the target gene cDNA;

[0017] (2) Using the overexpression vector to construct a transformant, the transformant is then used to infect the target plant, and positive plants are screened to obtain transgenic plants with increased survival rates under drought and high temperature stress compared with wild controls.

[0018] Preferably, the method for improving the crop's resistance to drought and high temperature stress is to increase the expression of target genes in the crop through genetic engineering operations, thereby obtaining transgenic plants with increased survival rates under drought and high temperature stress compared to wild controls.

[0019] Preferably, the transformant is obtained by transforming Agrobacterium EHA101 with an overexpression vector.

[0020] Preferably, the transgenic plants are obtained by Agrobacterium EHA101-mediated soybean stable transgenic method, and positive plants are screened to obtain transgenic plants with increased survival rate under drought and high temperature stress compared with wild controls.

[0021] Preferably, the crop is soybean.

[0022] Compared with the prior art, the present invention has achieved the following technical effects:

[0023] The invention obtains transgenic plants by transforming recipient soybean plants with the constructed expression vector, which can significantly improve the survival rate of soybeans under drought and high temperature adversity. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Schematic diagram of W82 and GmSBT1.2b under normal growth (CK) and 14-day drought treatment conditions, and a statistical graph of the survival rates of W82 and GmBTS1.2b under 14-day drought treatment conditions;

[0025] Figure 2 This is a schematic diagram of W82 and GmBTS1.2b under high temperature treatment for 7 days and a statistical diagram of leaf SPAD values in the present invention. DETAILED DESCRIPTION

[0026] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0027] like Figure 1-2As shown, the present invention discloses a method for cultivating drought-resistant and high-temperature-resistant plants by expressing GmSBT1.2b, comprising: a kit, which operates on specific molecular biology of the target gene, specifically comprising the following steps:

[0028] (1) Determine the target gene:

[0029] Target genes include:

[0030] a. soybean-derived gene with gene number Glyma.05G051500;

[0031] b. Genes with equivalent or corresponding biological functions to the soybean gene with gene number Glyma.05G051500, with a similarity of 90%, including known genes or newly identified unknown genes;

[0032] (2) Perform specific molecular biology operations:

[0033] This includes increasing or decreasing the expression level of the target gene.

[0034] The kit contains the necessary genetic engineering components for overexpressing the gene of interest.

[0035] The necessary genetic engineering group is selected from: template DNA, primers, enzymes, recombinant expression vectors, buffer solutions and infection media, or any combination thereof.

[0036] The recombinant expression vector contains a target gene cDNA vector, and the vector is pTF101.

[0037] The methods for increasing the expression of target genes in crops are as follows:

[0038] (1) Construct an overexpression vector containing the target gene cDNA;

[0039] (2) Using the overexpression vector to construct a transformant, the transformant is then used to infect the target plant, and positive plants are screened to obtain transgenic plants with increased survival rates under drought and high temperature stress compared with wild controls.

[0040] The method for improving crop resistance to drought and high temperature stress is to increase the expression of target genes in crops through genetic engineering operations, thereby obtaining transgenic plants with increased survival rate under drought and high temperature stress compared with wild controls.

[0041] The transformants were obtained by transforming Agrobacterium EHA101 with the overexpression vector.

[0042] Transgenic plants were obtained by Agrobacterium tumefaciens EHA101-mediated soybean stable transgenic method. Positive plants were screened to obtain transgenic plants with increased survival rate under drought and high temperature stress compared with wild controls.

[0043] The crop is soybean.

[0044] Example 1:

[0045] A method for cultivating drought- and heat-resistant plants by expressing GmSBT1.2b, comprising:

[0046] Gene naming: The constructed expression vector can overexpress the Glyma.05G051500 gene in soybean.

[0047] Example 2:

[0048] A method for cultivating drought-resistant and high-temperature-resistant plants by expressing GmSBT1.2b, comprising:

[0049] Construction of soybean GmSBT1.2b vector

[0050] (1) The GmSBT1.2b sequence was obtained from the soybean database, and primers were designed. The primer sequences (the underlined sequences are the corresponding restriction sites and protective bases) are:

[0051] GmSBT1.2b-BS2-F:GGAGAGAACACGGGGGAC TCTAGA ATGTTCAAAGCACACCGAAC(SEQ IDNO:3);

[0052] GmSBT1.2b-BS2-R:CTCGCCCTTGCTCACCAT GGATCC TACAAAGCTGATCGAGATAGGG(SEQ IDNO:4);

[0053] (2) Fragment amplification

[0054] Williams 82 soybean RNA was extracted and converted into cDNA using reverse transcriptase. The cDNA was used as a template and amplified using the primers designed above to obtain the target fragment.

[0055] (3) Recover the target fragment

[0056] The amplified fragments were subjected to agarose gel electrophoresis, and the gel containing the target fragments was cut with a scalpel and placed in a centrifuge tube. The PCR products were recovered using an agarose gel DNA recovery kit.

[0057] (4) Connect the target fragment to the pTF101 vector

[0058] The vector plasmid pTF101 was extracted, and the target fragment was connected to the BS2 vector by homologous recombination using restriction enzymes XbaI and BamHI, and then transformed into Escherichia coli DH5α.

[0059] (5) Transformation of target fragment into Agrobacterium rhizogenes EHA101

[0060] The pTF101 plasmid containing the target fragment was extracted from Escherichia coli DH5α, transformed into Agrobacterium tumefaciens EHA101, and after correct identification, stored in a -80°C ultra-low temperature freezer for use.

[0061] Example 3:

[0062] A method for cultivating drought-resistant and high-temperature salt-resistant plants by expressing GmSBT1.2b, comprising:

[0063] The creation of stable transgenic soybean mutants is as follows:

[0064] (1) Activate the strain and verify its growth activity: Streak the activated strain (resistant to Rif and Kana) on YEP solid medium. After the colony grows, inoculate a single colony into 5 mL YEP liquid medium (resistant to Rif and Kana) and shake in a shaker at 28°C and 200 rpm until the OD600 is about 1.0.

[0065] (2) Strain verification: 500 μL of bacterial solution was applied to the same resistance culture medium to verify the growth activity of the bacteria. The best result was that a lawn of bacteria could grow within 16 h.

[0066] (3) Disinfection: Select healthy soybean seeds with intact, plump seed coats and no pests or diseases. Soak them in a 75% ethanol solution for 30 seconds. Dry them with absorbent paper and place them in a culture dish. Place the culture dish in a vacuum desiccator and disinfect them for 12-16 hours using chlorine generated from commercial bleaching water and concentrated hydrochloric acid. After disinfection, blow the seeds in a clean bench until there is no obvious chlorine smell. Seal the seeds and store them for later use.

[0067] (4) Germination and bacterial plate coating: This experiment used soybeans that had been soaked in distilled water for 1 day for infection and transformation. The specific steps of soybean germination were as follows: 100 sterilized soybeans were placed in a sterile 12 cm glass dish, and 100 mL of sterilized water was added (usually around 4 pm). The beans were soaked until two-thirds of the beans were soaked. Water could be added if it was insufficient during the process. On the same day, the infective bacteria were cultured. The glycerol bacteria stored in the -80 °C refrigerator were taken out, and 500 μL was applied to a YEP solid culture medium with a diameter of 12 cm. The bacterial solution was spread evenly, blown dry, and placed in a bacterial incubator at 28 °C for about 16 h.

[0068] (5) Transformation and infection (preferably starting at 8 am): Use a disposable surgical blade that has been sterilized at high temperature to scrape off the bacterial moss, resuspend the bacterial cells in liquid CCM in a triangular flask to OD600 = 0.7-0.8, use a scalpel to remove the radicle, and cut longitudinally along the hypocotyl to divide the soybean into two, producing two explants (hypocotyl length ≤ 3 mm), each with a growth point: immerse the explants in the bacterial solution resuspended in CC for infection (30-40 cells / 50 mL), and place them on a horizontal shaker at room temperature at 80-100 rpm for infection;

[0069] (6) Transfer to CCM medium: On the second day of transformation and infection, pour out the bacterial solution in the triangular flask, turn the bean upside down on sterile filter paper, absorb the bacterial solution, peel off the seed coat, and place the bean with the inner side of the cotyledon facing up on CCM solid medium lined with a layer of filter paper (40-50 explants can be placed in one dish), seal the flask, and culture in a dark incubator for 3-5 days;

[0070] (7) Transfer to SIM medium: Cut off the swollen hypocotyl, leaving a remaining length of about 0.5 cm; insert the explants into S1 bud induction medium with the wound facing downward and the cotyledon plane facing upward at an angle of about 45°. Place about 18 explants in each tissue culture box and place them in a light culture room (24°C, 18 h light / 6 h dark) for 14 days before subculturing;

[0071] (8) Second transfer to SIM medium: Cut off the black material on the wound surface of the explant and cut half of the sprout to stop its growth. Insert the cut explant into SIM medium with the inner side facing down at a 45-degree angle. Place 18 explants in one dish and grow them on a culture rack for 2 weeks.

[0072] (9) Transfer to SEM culture medium: Cut off the black substance on the surface of the explant wound, cut off half of the sprout to stop its growth, cut off half of the cotyledon, insert the wound on both sides into SEM culture medium so that the sprout can grow upward, place 12 explants in a dish, transfer to a light and temperature incubator with stricter temperature control and grow for 2 weeks. The temperature of the light and temperature incubator is 24℃, and the photoperiod is 16 hours of light and 8 hours of darkness.

[0073] (10) Continue to transfer to SEM culture medium: Cut off the black material on the surface of the two wounds of the explants, remove the yellow and wilted leaves, insert the wounds on both sides into SEM culture medium so that the buds can grow upwards, place 12 explants in a dish, place them in a light and temperature incubator for growth, and subsequently transfer the culture medium every 2 weeks. Generally, it is difficult to produce new seedlings after 7 to 8 subcultures on SEM culture medium, or the positive rate of seedling emergence is low, so no further subculture is done;

[0074] (11) Transfer to rooting medium: During the transfer to SEM medium (usually the second or third time), seedlings begin to emerge. When the seedlings grow to more than 3 cm, they can be cut off from the explant with a sterile blade (ensuring that the wound is flat) and inserted into the rooting medium for rooting. New roots will grow in 7-14 days, and the seedlings can be transferred to vermiculite for further growth.

[0075] (12) Positive identification of transgenic seedlings: A small amount of leaves were taken from the transgenic seedlings for DNA extraction, and the Bar gene and editing status were detected by PCR amplification.

[0076] Example 4:

[0077] A method for cultivating drought-resistant and high-temperature-resistant plants by expressing GmSBT1.2b, comprising:

[0078] Identification of transgenic positive seedlings is as follows:

[0079] (1) Take leaf materials in a normal growth state, extract DNA using the CTAB method, and then first detect the Bar gene to determine the Bar gene-positive individual plants. Prepare 10 μL of the following system, as shown in Table 1, which is a schematic table for preparing 10 μL;

[0080] Table 1: Schematic table for preparing 10 μL

[0081]

[0082] (2) Amplify the target fragment according to the following PCR reaction system. The annealing temperature of 54-58°C is determined according to the primer Tm value, and the extension time of 1 min-3 min is determined according to the length of the target fragment, usually 1 kb / min. As shown in Table 2, which is a schematic diagram of the PCR reaction system;

[0083] Table 2: Schematic diagram of PCR reaction system

[0084]

[0085] (3) After the Bar gene-positive individual strain is identified, PCR amplification is performed using the target sequence primers. After the target band is amplified, the sample is sent to a biological company for testing. The amplification method is the same as the PCR amplification process for the Bar gene detection described above, except that the system is changed to 30 μL and the number of cycles is changed to 30.

[0086] Example 5:

[0087] A method for cultivating drought-resistant and high-temperature-resistant plants by expressing GmSBT1.2b, comprising:

[0088] Drought stress resistance test, details are as follows:

[0089] A control soybean variety, Williams 82, and a positive transgenic mutant, GmSBT1.2b, were grown simultaneously in a greenhouse. At germination, they were inoculated with the rhizobium USDA110. Both the control and drought-treated soybeans were watered abundantly on day 7 of germination. Thereafter, the control soybeans were watered normally with distilled water, while the drought-treated soybeans were not watered until a distinct phenotype emerged. The soybean survival rate was calculated.

[0090] By using the constructed overexpression vector to transform the recipient soybean plant to obtain transgenic plants, the survival rate of soybeans under drought stress can be significantly increased and the growth of soybeans under drought stress can be promoted.

[0091] High temperature stress resistance test, details are as follows:

[0092] A control soybean variety, Williams 82 (W82), and a positive transgenic mutant, GmSBT1.2b, were grown simultaneously in a greenhouse. When the plants reached the V4 stage, they were placed in a high-temperature chamber for seven days. Specific culture conditions were as follows: 50% relative humidity, 200 kPa light intensity, 25°C for 24 hours for the control treatment, and 42°C for 16 hours followed by 25°C for 8 hours for the high-temperature treatment. SPAD values were calculated for the soybeans.

[0093] By using the constructed overexpression vector to transform the recipient soybean plant to obtain transgenic plants, the SPAD value of soybean under high temperature stress can be significantly increased, thereby promoting the growth of soybean under high temperature stress.

[0094] The above description is merely a preferred embodiment of the present invention and does not limit the technical scope of the present invention. Therefore, any minor modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention are still within the scope of the technical solution of the present invention.

Claims

1. A method for cultivating drought-resistant and high-temperature-resistant plants by expressing GmSBT1.2b, characterized in that: include: The kit performs a specific molecular biology operation on a target gene, specifically comprising the following steps: (1) Determine the target gene: The target genes include: a. soybean-derived gene with gene number Glyma.05G051500; b. Genes having equivalent or corresponding biological functions to the soybean-derived gene Glyma.05G051500, with a similarity of 90%, including known genes or newly identified unknown genes; (2) Perform specific molecular biology operations: This includes increasing or decreasing the expression level of the target gene.

2. The method for cultivating drought-resistant and high-temperature-resistant plants by expressing GmSBT1.2b according to claim 1, characterized in that: The kit comprises necessary genetic engineering components for overexpressing the target gene.

3. The method for cultivating drought-resistant and high-temperature-resistant plants by expressing GmSBT1.2b according to claim 2, characterized in that: The necessary genetic engineering group is selected from: template DNA, primers, enzymes, recombinant expression vectors, buffer solutions and infection media, or any combination thereof.

4. The method for cultivating drought-resistant and high-temperature-resistant plants by expressing GmSBT1.2b according to claim 3, characterized in that: The recombinant expression vector contains a target gene cDNA vector, and the vector is pTF101.

5. The method for cultivating drought- and high-temperature-resistant plants by expressing GmSBT1.2b according to claim 1, characterized in that: The methods for increasing the expression of target genes in crops are as follows: (1) Construct an overexpression vector containing the target gene cDNA; (2) Using the overexpression vector to construct a transformant, the transformant is then used to infect the target plant, and positive plants are screened to obtain transgenic plants with increased survival rates under drought and high temperature stress compared with wild controls.

6. The method for cultivating drought-resistant and high-temperature-resistant plants by expressing GmSBT1.2b according to claim 1, characterized in that: The method for improving crop resistance to drought and high temperature stress is to increase the expression of target genes in crops through genetic engineering operations, thereby obtaining transgenic plants with increased survival rate under drought and high temperature stress compared with wild controls.

7. The method for cultivating drought-resistant and high-temperature-resistant plants by expressing GmSBT1.2b according to claim 5, characterized in that: The transformant is obtained by transforming Agrobacterium EHA101 with the overexpression vector.

8. The method for cultivating drought-resistant and high-temperature-resistant plants by expressing GmSBT1.2b according to any one of claims 5 to 6, characterized in that: The transgenic plants are obtained by using a soybean stable transgenic method mediated by Agrobacterium EHA101, and positive plants are screened to obtain transgenic plants with increased survival rate under drought and high temperature adversity compared with wild controls.

9. The method for cultivating drought-resistant and high-temperature-resistant plants by expressing GmSBT1.2b according to claim 1, characterized in that: The crop is soybean.

Images