Molecular marker related to Hastelloy unit of egg and application of molecular marker

Through genome-wide analysis and specific primers to detect SNP sites related to Hastello units in eggs, the time-consuming and destructive problem of Hastello units in eggs is solved, and early and precise trait selection is achieved, which improves breeding efficiency and economic benefits.

CN120485378AActive Publication Date: 2025-08-15INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202510475468.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-16
Publication Date
2025-08-15
Estimated Expiration
2045-04-16

AI Technical Summary

Technical Problem

In the prior art, the evaluation of Hastello units of eggs is time-consuming and destructive, the traditional breeding cycle is long, the genetic progress is slow, and it is difficult to achieve early and accurate trait selection.

Method used

By mining SNP sites with significantly associated Hastello unit traits in eggs across the genome, designing specific primers for PCR amplification, detecting the genotype of chicken individuals, and using SNP molecular markers to assist in early breeding.

Benefits of technology

The early and precise selection of Hastello unit traits in eggs has been achieved, which significantly accelerated the breeding process and improved the selection efficiency and economic benefits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120485378A_ABST
    Figure CN120485378A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of gene detection, and discloses a molecular marker related to an egg Hastelloid unit and application of the molecular marker. The molecular marker is located in sequence information of a chicken reference genome Galusgallus 7.0 W version published by an ENSEMBL database, is located on a 1032742 site starting from the 5'tail end on a chromosome 1, and has a basic group of A / G and a basic group of A / G on a chromosome 2. The molecular marker related to the egg Hastelloid unit related to the egg Hastelloid unit related to the egg Hastelloid unit related to the egg Hastelloid unit related to the egg Hastelloid unit related to the egg Hastelloid unit. In addition, the invention also relates to a specific primer for detecting the single nucleotide polymorphism molecular marker. By utilizing the molecular marker and a matched primer thereof, an efficient and accurate molecular marker-assisted breeding technology can be constructed, so that the breeding process of Harshy units of eggs is improved. The technology has a remarkable application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of gene detection, in particular to a molecular marker related to an egg Haugh unit and an application thereof. Background Art

[0002] Chickens, as important agricultural animals, provide humans with high-quality protein-rich products such as chicken meat and eggs. Haugh units, a key indicator of egg freshness, significantly influence consumer purchasing decisions and the economic benefits of the egg industry. Therefore, this indicator has become a key quality trait of laying hens of particular interest to consumers, farmers, and breeding experts.

[0003] Currently, Haugh unit values ​​in eggs are maintained through adjustments to feed formulations and improved storage management. Higher values ​​indicate better egg freshness. Studies have shown significant variation in Haugh unit values ​​within a population, suggesting potential for selective breeding to produce individuals with higher Haugh units. Haugh unit values ​​are primarily assessed based on albumen height and egg weight, but this process requires repeated measurements of a large number of samples. This time-consuming and destructive process limits secondary sales of eggs and increases costs. Traditional breeding cycles are long and genetic progress is slow. In contrast, trait selection using genetic variation, such as SNP molecular markers, allows for earlier and more precise selection, accelerating the genetic development of target traits. Therefore, the discovery and validation of molecular markers associated with Haugh unit values ​​in eggs, as well as the development of molecular breeding techniques, are crucial for improving the efficiency of breeding for this trait. Summary of the Invention

[0004] In view of this, the present invention proposes a molecular marker related to the Haugh unit in eggs and its application, aiming to overcome the shortcomings of the existing technology, explore important SNP sites that are significantly associated with the traits of the Haugh unit in eggs from the whole genome, and provide a basis for the application of molecular marker-assisted selection to improve breeding effects.

[0005] The present invention proposes an application, which is A1, A2 or A3;

[0006] Said A1 is the use of a substance for detecting the genotype of a SNP site in identifying or assisting in identifying the Haugh unit of an egg;

[0007] A2 is the use of a substance for detecting the genotype of a SNP site in preparing a product for identifying or assisting in identifying the Haugh unit of an egg;

[0008] A3 is the use of a substance for detecting SNP site genotype in egg breeding or preparing egg breeding products;

[0009] The SNP is the 1032742nd position from the 5' end on chromosome 1 of the chicken reference genome Gallus_gallus 7.0_W version sequence information, which is A / G.

[0010] The present invention also provides a product, which contains the above-mentioned substance for detecting the genotype of the SNP site of the chicken reference genome, and is B1, B2 or B3;

[0011] B1 is a product for detecting the genotype of SNP sites related to the Haugh unit in eggs;

[0012] B2 is a product for identifying or assisting in identifying the Haugh unit of an egg;

[0013] The B3 is a product used for chicken breeding.

[0014] The present invention also provides a method for identifying or assisting in identifying the Haugh unit in eggs, wherein the method is C1 or C2;

[0015] Said C1 comprises detecting the genotype of the above-mentioned SNP in the chicken to be tested, and identifying or assisting in identifying the Haugh unit of the egg according to the genotype of the chicken to be tested;

[0016] When the genotypes of the SNP are GG, AG and AA respectively, the Haugh units of the eggs corresponding to the tested chickens increase in sequence.

[0017] The invention also proposes an application of the method in chicken breeding.

[0018] Preferably, according to the above application, product or method, the substance for detecting the polymorphism or genotype of the SNP is at least one of the following:

[0019] D1) containing in vitro nucleic acid amplification primers that specifically amplify the SNP;

[0020] D2) an in vitro nucleic acid amplification reagent containing the in vitro nucleic acid amplification primer described in D1);

[0021] D3) a kit containing the in vitro nucleic acid amplification primers described in D1) or the in vitro nucleic acid amplification reagents described in D2);

[0022] D4) A detection instrument containing the in vitro nucleic acid amplification primers described in D1), the in vitro nucleic acid amplification reagents described in D2) or the kit described in D3).

[0023] The present invention also proposes an in vitro nucleic acid amplification primer pair for identifying or assisting in identifying the Haugh unit in eggs. The nucleotide sequence of the upstream primer of the in vitro nucleic acid amplification primer pair is shown in SEQ ID NO: 2; the nucleotide sequence of the downstream primer of the in vitro nucleic acid amplification primer pair is shown in SEQ ID NO: 3.

[0024] The present invention also provides an application of the above-mentioned in vitro nucleic acid amplification primer pair for identifying or assisting in identifying the Haugh unit in eggs, wherein the application comprises at least one of the following:

[0025] E1) Application in identifying or assisting in identifying Haugh units in eggs;

[0026] E2) Application in chicken breeding;

[0027] E3) Application in preparing chicken breeding products.

[0028] Compared with the prior art, the present invention has the following beneficial effects:

[0029] There is a significant correlation between the single nucleotide polymorphism (SNP) molecular markers covered by the present invention and the Haugh unit in eggs, which represents an innovative molecular marker technology. By accurately detecting the genotype of the individual chicken to be tested at this specific site, researchers and breeding experts can identify chickens carrying the dominant genotype. Using this technology, effective selection can be carried out in the early stages of chickens, thereby accelerating the breeding process of chickens with high Haugh unit eggs. This early selection method not only improves the efficiency of breeding, but also has significant application value and potential economic benefits because it can quickly screen out individuals with excellent traits. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Various other advantages and benefits will become apparent to those skilled in the art upon reading the detailed description of the preferred embodiment below. The accompanying drawings are for illustration purposes only and are not to be considered as limiting the present invention. The same reference symbols are used throughout the drawings to represent the same components. In the drawings:

[0031] Figure 1 This is the result diagram of the whole genome association analysis in Example 1. DETAILED DESCRIPTION

[0032] Exemplary embodiments of the present disclosure will be described in more detail below with reference to the accompanying drawings. Although exemplary embodiments of the present disclosure are shown in the accompanying drawings, it should be understood that the present disclosure can be implemented in various forms and should not be limited by the embodiments set forth herein. On the contrary, these embodiments are provided to enable a more thorough understanding of the present disclosure and to fully convey the scope of the present disclosure to those skilled in the art. It should be noted that, unless there is a conflict, the embodiments of the present disclosure and the features in the embodiments can be combined with each other. The present invention will be described in detail below with reference to the accompanying drawings and in conjunction with the embodiments.

[0033] Example 1 Determination of SNP Molecular Markers Associated with Egg Haugh Unit Size

[0034] (1) Experimental animals: This study used 197 white Leghorn chickens as experimental subjects. They were fed and watered ad libitum during the feeding period, and the feeding conditions strictly complied with the relevant provisions of the industry standard (NY / T 33-2004).

[0035] (2) Phenotypic determination: The Haugh unit of each egg was measured three times for each chicken at 32 weeks of age.

[0036] (3) Genomic DNA extraction: 0.5 mL of sub-wing venous blood was collected from all test chickens using an anticoagulant vacuum tube. Whole genomic DNA was extracted using the phenol-chloroform extraction method. Qualified DNA samples were subjected to agarose gel electrophoresis to further assess the purity and integrity of the DNA samples. The sample concentration should be greater than 50 ng / μL, the purity OD260 / 280 should be between 1.8 and 2.0, and the integrity should be good. Qualified DNA samples were stored at -20 degrees Celsius for future use.

[0037] (4) Genome Resequencing: DNA samples from all experimental chickens were sent to BGI for whole-genome resequencing at a depth of approximately 15× using the DNBSEQ sequencing platform according to standard operating procedures. Sequence alignment and genotype extraction were performed using BWA and GATK software. After SNP call rate and MAF quality control, 7,498,204 SNPs were obtained and used for subsequent analysis.

[0038] (5) Genome-wide association analysis: Pedigree data, phenotypic data, and genomic SNP site data were collated and genome-wide association analysis was performed using GCTA software. The univariate mixed linear model was:

[0039] y=Xb+jα+u+e;

[0040] Where y represents the phenotypic value; b represents the fixed effect (including group effect and cage effect); X represents the corresponding relationship matrix; J represents the additive genotype of the SNP site to be detected; α represents the additive SNP effect; u represents the random animal effect, which obeys Where G represents the additive relationship matrix of the genome, represents additive genetic variance; e represents compliance The residual effect of , where I represents the identity matrix, The R package qvalue was used to calculate the genome-wide FDR value, with FDR < 0.01 as the significance threshold (P = 7.36E-07). Figure 1As shown, the egg Hatch unit was significantly associated with a 0.05Mb region on chromosome 1 (chr1:1022532-1068485). All sites in the genomic association region were further verified, and the chr1:1032742 site was identified as a candidate site.

[0041] Table 1

[0042] SNP chromosome physical location base substitution Minimum allele frequency P-value chr1:1032742 1 1032742 A / G 0.43 2.09E-07

[0043] Example 2 Correlation between different genotypes at chr1:1032742 and the Haugh unit at the egg

[0044] (1) Experimental animals: 197 White Leghorn chickens, fed in the same manner as in Example 1.

[0045] (2) Phenotypic determination: Same as Example 1.

[0046] (3) Extraction of genomic DNA: Same as Example 1.

[0047] (4) Genotyping of specific gene loci: Same as Example 1.

[0048] (5) Identification of the dominant genotype for the phenotype: At the chr1:1032742 locus, the Haugh unit of eggs produced by experimental animals with the GG genotype was 66.21, the Haugh unit of eggs produced by experimental animals with the AG genotype was 70.64, and the Haugh unit of eggs produced by experimental animals with the AA genotype was 73.21. Based on this analysis, the AA genotype is the dominant genotype for this trait. Table 2 shows the correlation between individuals with different genotypes at the chr1:1032742 SNP locus and the Haugh unit of eggs.

[0049] Table 2

[0050]

[0051] ab: Different letters in the shoulders indicate significant differences among the groups (P<0.05).

[0052] Example 3 Establishment of a molecular marker detection method for chr1:1032742 and its application in breeding

[0053] Establishment of molecular marker detection method: Based on the upstream and downstream DNA sequence information of chr1:1032742 site published in the Ensemble database (SEQ ID NO:1), specific primers were designed and synthesized for PCR amplification. SEQ ID NO:1:

[0054] AACCGTAATACTTACAGATCCATGGAAGTGAACCAAGCAGCCTTTGTAGCACTTACAGCACGGGGAGAGCGGGTGGCTTTAAAGCAGATGAGAAGCAAAGGAGACCCGGAGAACTGCAACCGCAGAGCCGTG CAGCTCGCAGCAGCAGCTCTGCTCGAGGTCAGCGTGAGAGCATCTGGAGCTCAGAGAGCTCTGCTCAGCTGAGCACAGCTCTATAAATAGGGCGGGCACCCCGCCAGCGCGCTGCACG / ACTCAGCCCCAC CACTTCTCTGCTGATTCCTCGGCAAGGTCGCCTGGGCGGCCTCAGAGAGAGGCAGCAAACCAACCATTAAAAACTATGCCAATTAGCTTCGCTGAGAGAAGAGAGGATGATGCAGGAGCGAACTTATCCCACACGCGGTGGTGCTGAGGTTGGAGCTGGAGGAGGGCTGGAGCACGAAGGGCTGGAGCACGAAGGGATGCCTCACAGCTGCACTGCAGGAGCTGACACACTCTTC.

[0055] See Table 3 for primer sequence information, Table 4 for polymerase chain reaction (PCR) amplification system, and Table 5 for PCR amplification conditions. The amplified products were analyzed using first-generation sequencing to determine the genotype at locus 1032742 on chromosome 1 (chr1). The genotypes included GG, AG, and AA.

[0056] Table 3

[0057] Primer name Sequence (5'-3') Corresponding number in sequence listing Upstream primer CAAAGGAGACCCGGAGAACT SEQ ID NO:2 Downstream primer GTTGGTTTGCTGCCTCTCTC SEQ ID NO:3

[0058] Table 4

[0059] Reagents Volume (μL) ddH2O 8.0 2×Taq Plus Master Mix 10.0 Upstream primer (10 μM) 0.5 Downstream primer (10 μM) 0.5 genomic DNA 1.0 Total 20.0

[0060] Table 5

[0061]

[0062]

[0063] (2) Breeding strategy based on molecular markers at the chr1:1032742 locus to improve the Haugh unit in eggs

[0064] In this study, 224 purebred individuals of Beijing oily chickens were selected as breeding objects, aiming to improve their Haugh unit. At 3 weeks of age, blood samples were collected from all individuals, and genomic DNA was extracted according to step (3) of Example 1. The target site sequence was amplified using specific primers, and genotyping was performed using first-generation sequencing technology. Among the genotypes obtained, there were 171 individuals with GG genotype, 46 individuals with AG genotype, and 7 individuals with AA genotype. Based on the dominant genotype of the Haugh unit, this study selected individuals with AA genotype for subsequent breeding. After being raised to the egg-laying period, the Haugh unit was measured at 32 weeks of age. Table 6 shows the correlation results between individuals with different genotypes at the chr1:1032742 SNP site of chickens and the Haugh unit of eggs. The average Haugh unit of individuals with GG genotype was 66.49, that of individuals with AG genotype was 67.49, and that of individuals with AA genotype reached 73.26.

[0065] Table 6

[0066]

[0067] ab: Different letters in the shoulders indicate significant differences among the groups (P<0.05).

[0068] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to the above embodiments, ordinary technicians in the field should understand that the specific implementation methods of the present invention can still be modified or replaced by equivalents. Any modification or equivalent replacement that does not depart from the spirit and scope of the present invention should be covered by the scope of protection of the claims of the present invention.

Claims

1. An application, characterized in that: The application is A1, A2 or A3; Said A1 is the use of a substance for detecting the genotype of a SNP site in identifying or assisting in identifying the Haugh unit of an egg; A2 is the use of a substance for detecting the genotype of a SNP site in preparing a product for identifying or assisting in identifying the Haugh unit of an egg; A3 is the use of a substance for detecting SNP site genotype in egg breeding or preparing egg breeding products; The SNP is the 1032742nd position from the 5' end on chromosome 1 of the chicken reference genome Gallus_gallus 7.0_W version sequence information, which is A / G.

2. A product, characterized in that The product contains the substance for detecting the genotype of the SNP site of the chicken reference genome as described in claim 1, and is B1, B2 or B3; B1 is a product for detecting the genotype of SNP sites related to the Haugh unit in eggs; B2 is a product for identifying or assisting in identifying the Haugh unit of an egg; The B3 is a product used for chicken breeding.

3. A method for identifying or assisting in identifying the Haugh unit in an egg, characterized in that: The method is C1 or C2; Said C1 comprises detecting the genotype of the SNP according to claim 1 in the chicken to be tested, and identifying or assisting in identifying the Haugh unit of the egg according to said genotype of the chicken to be tested; When the genotypes of the SNP are GG, AG and AA respectively, the Haugh units of the eggs corresponding to the tested chickens increase in sequence.

4. Application of the method according to claim 3 in chicken breeding.

5. The use according to claim 1, the product according to claim 2, the method according to claim 3 or the use according to claim 4, characterized in that: The substance for detecting the genotype of the SNP site is at least one of the following: D1) containing in vitro nucleic acid amplification primers that specifically amplify the SNP; D2) an in vitro nucleic acid amplification reagent containing the in vitro nucleic acid amplification primer described in D1); D3) a kit containing the in vitro nucleic acid amplification primers described in D1) or the in vitro nucleic acid amplification reagents described in D2); D4) A detection instrument containing the in vitro nucleic acid amplification primers described in D1), the in vitro nucleic acid amplification reagents described in D2) or the kit described in D3).

6. An in vitro nucleic acid amplification primer pair for identifying or assisting in identifying the Haugh unit in eggs, characterized in that: The nucleotide sequence of the upstream primer of the in vitro nucleic acid amplification primer pair is shown in SEQ ID NO: 2; the nucleotide sequence of the downstream primer of the in vitro nucleic acid amplification primer pair is shown in SEQ ID NO:

3.

7. The use of the in vitro nucleic acid amplification primer pair for identifying the Haugh unit of an egg according to claim 6, characterized in that: The application includes at least one of the following: E1) Application in identifying or assisting in identifying Haugh units in eggs; E2) Application in chicken breeding; E3) Application in preparing chicken breeding products.

Citation Information

Patent Citations

  • Molecular genetic maker for egg quality of laying hen and application of molecular genetic marker

    CN106701919A

  • Genetic marker related to egg quality traits and application of genetic marker

    CN107130023A

  • Molecular marker related with chicken beak distortion property and application thereof

    CN108570508A

  • Laying hen whole genome low-density SNP chip and application thereof

    CN118064597A