Probe primer combination for identifying TaqMan real-time fluorescent quantitative PCR of egret, kit and application

Abstract

The embodiment of the invention discloses a probe primer combination for identifying TaqMan real-time fluorescent quantitative PCR of egret, a kit and application. The fluorescent primer combination comprises a probe, an upstream primer and a downstream primer, the nucleotide sequence of the probe is 5 '-FAM-TGGAAATGCTATATCAGG-MGB-3', the nucleotide sequence of the upstream primer is 5 '-GGATTCGGAACTGACTAGTACCC-3', and the nucleotide sequence of the downstream primer is 5 '-GGTGGGAAGGAGTCAGAAACTTATG-3'. The TaqMan probe real-time fluorescent PCR detection method established by the invention can effectively distinguish the egret from other birds (covering near-source species and distant birds), has excellent specificity and sensitivity in the aspect of identifying the egret species, greatly improves the detection accuracy, shortens the detection time, and has good application prospects. The effects of stability, reliability, short period, low cost and the like are achieved, and the method has important significance on egret protection and related ecological research.

Description

Technical Field

[0001] The embodiments of the present invention relate to the field of molecular biomedical technology, and specifically to a probe primer combination, a kit, and an application for identifying little egrets using TaqMan real-time fluorescence quantitative PCR. Background Art

[0002] The little egret (Egretta garzetta), a key representative species of the Ardeidae family, is widely distributed in wetland ecosystems across East Asia, Southeast Asia, and Europe. It plays an important ecological role in maintaining a balanced aquatic food chain and providing an indicator of environmental health. However, with the intensification of habitat destruction and illegal hunting, the need for population monitoring and protection is becoming increasingly urgent. Furthermore, in wildlife law enforcement, forensic evidence identification, and trade regulation, accurate species identification of Ardeidae artifacts (such as feathers and bones) is often required to combat illegal trade. Therefore, the development of efficient and reliable Little Egret-specific identification technology has significant scientific significance and application value.

[0003] Traditional species identification relies primarily on morphological features, but this method requires high sample integrity and is susceptible to interference from subspecies variation, developmental stage, or human manipulation (such as taxidermy), making it difficult to distinguish closely related species. While molecular identification techniques have partially addressed these issues, existing methods still have limitations. For example, conventional PCR based on the mitochondrial COI or Cytb genes requires sequencing verification, resulting in a cumbersome process and the inability to achieve quantitative analysis. Real-time quantitative PCR (qPCR) using common fluorescent primers lacks specificity and is prone to cross-amplification due to the high homology between Ardeidae species, compromising detection accuracy.

[0004] In recent years, TaqMan probe-based real-time fluorescence quantitative PCR has gradually become the mainstream technology for species identification due to its advantages such as high sensitivity, strong specificity and closed-tube anti-contamination. It can accurately distinguish single nucleotide differences by binding to the target sequence through specific probes, and is particularly suitable for the detection of closely related species or degraded DNA samples. However, there are currently no reports on the TaqMan detection system for the little egret, and the existing universal primers for the heron family are difficult to meet its specific identification needs, especially in complex environmental samples (such as feces, feathers, etc.) or mixed DNA backgrounds, where the risk of false positives is significantly increased.

[0005] Therefore, a TaqMan probe primer combination and supporting kit based on the Little Egret's specific genetic markers were developed to break through the bottleneck of insufficient resolution of closely related species and low detection efficiency of existing technologies, and to achieve rapid, quantitative and highly sensitive species identification, which has important practical significance for ecological research, biodiversity conservation and forensic identification. Summary of the Invention

[0006] To this end, the present invention provides a probe and primer combination, a kit and an application for identifying little egrets by TaqMan real-time fluorescence quantitative PCR.

[0007] In order to achieve the above objectives, the embodiments of the present invention provide the following technical solutions:

[0008] According to a first aspect of an embodiment of the present invention, the present invention provides a probe primer combination for identifying little egrets by TaqMan real-time fluorescence quantitative PCR, comprising a probe, an upstream primer and a downstream primer, the nucleotide sequence of the probe being 5'-FAM-TGGAAATGCTATATCAGG-MGB-3', the nucleotide sequence of the upstream primer being 5'-GGATTCGGAAACTGACTAGTACCC-3', and the nucleotide sequence of the downstream primer being 5'-GGTGGAAGGAGTCAGAAACTTATG-3'.

[0009] According to a second aspect of an embodiment of the present invention, the present invention provides a kit for identifying Little Egrets using TaqMan real-time fluorescence quantitative PCR, characterized in that it comprises the probe primer combination described above.

[0010] According to a third aspect of the embodiments of the present invention, the present invention provides use of the probe and primer combination as described above, or the kit as described above, in species identification of Little Egret.

[0011] According to a fourth aspect of the embodiments of the present invention, the present invention provides a method for identifying species of a little egret, the method comprising:

[0012] (1) Extracting cDNA or genomic DNA from the sample to be tested;

[0013] (2) performing TaqMan real-time fluorescence quantitative PCR reaction using the probe, upstream primer, and downstream primer described above to obtain a Ct value and an amplification curve;

[0014] (3) Determination of test results: If the Ct value is ≤35 and a typical amplification curve appears, the result is positive; if there is no Ct value or no amplification curve, the result is negative; if the Ct value is >35, the sample is repeated. If there is no Ct value in the repeated result, it is negative; otherwise, it is positive.

[0015] Furthermore, the TaqMan real-time fluorescence quantitative PCR reaction system was as follows: 2xT5 Fast qPCR Mix 10 μL, upstream primer 10 μM 0.7 μL, downstream primer 10 μM 0.7 μL, TaqMan probe 10 μM 0.6 μL, DNA template 1 μL, supplemented with ddH2O to a total volume of 20 μL.

[0016] Furthermore, the TaqMan real-time fluorescence quantitative PCR reaction conditions were as follows: pre-denaturation at 95°C for 2 min; 95°C for 15 s, 60°C for 30 s, and 40 cycles.

[0017] The embodiments of the present invention have the following advantages:

[0018] Based on the differences in the mitochondrial control regions of different ardeidae species, the present invention designs specific oligonucleotide primers and probes to establish a TaqMan probe real-time fluorescence PCR detection method that can effectively distinguish little egrets from other poultry (including closely related species and distantly related birds). It has excellent specificity and sensitivity in identifying little egret species, greatly improves the accuracy of detection, and shortens the detection time, achieving stable, reliable, short cycle, and low cost effects. It is of great significance to the protection of little egrets and related ecological research. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] To more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for the embodiments or the description of the prior art. Obviously, the drawings described below are merely exemplary, and those skilled in the art can derive other implementation drawings based on the provided drawings without inventive effort.

[0020] Figure 1 A specificity verification amplification curve provided by the present invention;

[0021] Figure 2 Amplification curves of different copy numbers of the Little Egret gene provided by the present invention;

[0022] Figure 3 This is a standard curve diagram for the Little Egret gene detection provided by the present invention;

[0023] Figure 4 This is an amplification curve diagram of the Little Egret gene detected by a single probe provided by the present invention;

[0024] Figure 5 This is an amplification curve diagram of the Little Egret gene mixed probe detection provided by the present invention;

[0025] Figure 6 This is the NTC detection spectrum provided by the present invention. DETAILED DESCRIPTION

[0026] The following describes the implementation of the present invention using specific embodiments. Those skilled in the art will readily understand the other advantages and benefits of the present invention from the disclosure herein. Obviously, the embodiments described are only a portion of the present invention, not all of it. All other embodiments derived by persons of ordinary skill in the art based on the embodiments of the present invention without inventive effort are intended to fall within the scope of protection of the present invention.

[0027] Example 1 Design of primers and probes

[0028] Mitochondrial sequences of the target species and related species were downloaded from the NCBI database and aligned using MEGA6 software. Species-specific regions were selected and primers and probes were designed using Primer Express 3.0.1 software to ensure specific detection of the target species. Primer and probe design and synthesis were performed by Beijing Qingke Biotechnology Co., Ltd. Primer and probe information is provided in Table 1 below.

[0029] Table 1

[0030] name Sequence (5'→3') Upstream primer 5'-GGATTCGGAAACTGACTAGTACCC-3'(SEQ ID NO:1) Downstream primer 5'-GGTGGAAGGAGTCAGAAACTTATG-3'(SEQ ID NO:2) probe 5'-FAM-TGGAAATGCTATATCAGG-MGB-3'(SEQ ID NO:3)

[0031] Example 2 Specificity Detection

[0032] DNA templates were extracted from the Little Egret as positive samples, and DNA templates were extracted from herons, night herons, pond herons, cattle egrets, white wagtails, yellow-rumped bulbuls, house sparrows, and black-bellied whistling pheasants as negative samples. ddH2O was used instead of the nucleic acid in the system as a no-template control (NFC). Amplification was performed using the upstream and downstream primers and probes listed in Table 1. Primer and probe specificity was verified by Ct values. Each sample was assayed in triplicate. DNA templates were extracted from feathers using a commercially available kit.

[0033] The real-time fluorescence PCR reaction system was as follows: 2xT5 Fast qPCR Mix (Qingke, TSE301) 10 μL, upstream primer 10 μM 0.7 μL, downstream primer 10 μM 0.7 μL, probe 10 μM 0.6 μL, DNA template 1 μL, and ddH2O was added to make up the total volume to 20 μL.

[0034] The real-time fluorescence amplification program was as follows: pre-denaturation at 95°C for 2 min, 1 cycle; 95°C for 15 s, 60°C for 30 s, 40 cycles; and collection of fluorescence signals during annealing and extension (60°C).

[0035] The results are shown in Table 2 and Figure 1 , the positive sample showed a typical S-shaped amplification curve (see Figure 1 ), while other negative samples and no-template controls showed a straight line (see Figure 1There was no increase in fluorescence value, indicating that the primers and probes provided by the present invention can specifically detect Little Egret DNA.

[0036] Table 2

[0037]

[0038] Example 3 Probe amplification efficiency detection

[0039] The target product obtained by amplification in Example 2 was cloned into a vector (Qingke pClone007 Versatile SimpleVector). The resulting plasmid was sequenced and verified as a Little Egret standard plasmid for probe amplification efficiency testing. The nucleotide sequence of the Little Egret standard plasmid is as follows:

[0040] AGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTT

[0041] TACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCC

[0042] GCAAAAAACGGAATAAGTGCGACACGGAAATGTTGAATACTCATTTTAG

[0043] CTTCCTTAGCTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGT

[0044] GATCTTATTTCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAAGT

[0045] CAAAAGCCTCCGGTCGGAGGCTTTTGACTTTCTGTTCCGGCTCGTATGTT

[0046] GTGTCTATGGAAGCGGATAACAATTTCACACAGGAAACAGCTATGACCA

[0047] AGTTTGACATCCTTCAGGTGGACTCAAGACTGCAATCGCGTGTCGCCCTT

[0048] GGATTCGGAAACTGACTAGTAACCCCTCATAATTGGTGCCCCTGATATAGCA

[0049] TTTCCACGCATAAACAACATAAGTTTCTGACTCCTTCCACCAAGGGCGAC

[0050] ACGCGATTGCAGTGTAACACGAGGTGATCCTGAGTTCAGATCAACTGGCC

[0051] GTCGTTTTACACAATCAAGTCGTGACTGGGAAAACCCTGGCGCTCCAAC

[0052] TTAATCGCCTTGCAGCACTGGCTCACCTTCACGGGTGGGCCTTTCTTCGG

[0053] TAGAAAATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGC

[0054] TGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGG

[0055] ATCAAGAGCTACCAACTCTTTTTCCGAGGTAACTGGCTTCAGCAGAGCG

[0056] CAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTT

[0057] CAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTAC

[0058] CAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTC

[0059] AAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGG

[0060] TTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGA

[0061] TACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAA

[0062] AGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCA

[0063] CGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGG

[0064] GTTTCGCCACCTCTGACTTGAGCATCGATTTTTGTGATGCTCGTCAGGGG

[0065] GGCGGAGCCTATGGAAAAACGCCAGCAACGCAGAAAGGCCCACCCGAA

[0066] GGTGAGCCAGGTGATTACATTTGGGCCCTCATTACCAATGCTTAATCAGT

[0067] GAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGA

[0068] CTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCC

[0069] CAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTAT

[0070] CAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTG

[0071] CAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGA

[0072] GTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTAC

[0073] AGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCG

[0074] GTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAA

[0075] AGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCG

[0076] CAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCA

[0077] TGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCA

[0078] TTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAAT

[0079] ACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTG

[0080] GAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAG

[0081] ATCC, see SEQ ID NO:4.

[0082] The Little Egret standard plasmid was gradiently diluted as a positive standard and detected according to the real-time fluorescence PCR reaction system and amplification procedure of Example 2. Each dilution factor was repeated 3 times to obtain the probe gradient amplification curve ( Figure 2 , 1: dilution factor 10^3, 2: dilution factor 10^4, 3: dilution factor 10^5, 4: dilution factor 10^6, 4: dilution factor 10^7), CT and copy number LOG values ​​were fitted to obtain the standard curve equation ( Figure 3 ), detect R 2 The results reached 0.9997, indicating a good linear relationship between the CT and the logarithmic copy number values ​​for the Little Egret gene within the range of 5.42E+7 to 5.42E+3 copies / µL. Based on the established standard curve, the amplification efficiency was calculated to be 97.2%. The test data are shown in Table 3.

[0083] Table 3

[0084]

[0085]

[0086] After the plasmid was diluted 10^7 times, the detection repeatability was good, and the probe detection efficiency was within the normal range (90%-110%). The sensitivity of the primers and probes provided by the present invention met the detection requirements.

[0087] Example 4 Interference Detection of Multiplex qPCR

[0088] Another positive sample was amplified using the upstream primers, downstream primers, and probes in Table 1 using the real-time fluorescence PCR reaction system and real-time fluorescence amplification program in Example 2, and the assay was repeated three times.

[0089] Mix multiple primers and probes in the same reaction system and perform multiplex PCR on positive samples of the same concentration to test whether they interfere with each other. The information of the primers and probes used in the multiplex reaction system is as follows:

[0090] Upstream primer:

[0091] Upstream primer 1: SEQ ID NO: 1;

[0092] Upstream primer 2: 5′-AACTTGGACAACCAGGGACG-3′ (SEQ ID NO: 5);

[0093] Upstream primer 3: 5′-CGCCTTYGTAATAATCTTCTTTATAGTG-3′ (SEQ ID NO: 6);

[0094] Upstream primer 4: 5′-GGCCAACCCGGAACACTG-3′ (SEQ ID NO: 7);

[0095] Upstream primer 5: 5′-GAGCCGGCATAATTGGAACT-3′ (SEQ ID NO: 8);

[0096] Downstream primer:

[0097] Downstream primer 1: SEQ ID NO: 2

[0098] Downstream primer 2: 5′-ATCCTCCGATTATGATCGGTATTAC-3′ (SEQ ID NO: 9);

[0099] Downstream primer 3: 5′-CAGAAGCTCATGTTGTTTATACGG-3′ (SEQ ID NO: 10);

[0100] Downstream primer 4: 5′-AAGAAAATTATTACGAAGGCATGG-3′ (SEQ ID NO: 11);

[0101] Downstream primer 5: 5′-CATGGGCGGTGACAATTACG-3′ (SEQ ID NO: 12);

[0102] Probe:

[0103] Probe 1: SEQ ID NO: 3

[0104] Probe 2: 5′-VIC-AATGTGATTGTTACTGCC-MGB-3′ (SEQ ID NO: 13);

[0105] Probe 3: 5′-ROX-TGACTAGTACCACTAATAA-MGB-3′ (SEQ ID NO: 14);

[0106] Probe 4: 5′-TAMRA-CGGTGACGACTACA-MGB-3′ (SEQ ID NO: 15);

[0107] Probe 5: 5'-CY5-CCGAGCCGAGCTT-MGB-3' (SEQ ID NO: 16).

[0108] The multiplex PCR reaction system was as follows: 15 μL of premixed reagent 2xT5 Fast qPCR Mix (Qingke, TSE301), 3.5 μL of 10 μM upstream primer (0.7 μL × 5), 3.5 μL of 10 μM downstream primer (0.7 μL × 5), 3 μL of 10 μM probe (0.6 μL × 5), and 1 μL of DNA template, which was supplemented with ddH2O to a total volume of 30 μL.

[0109] The amplification program was as follows: pre-denaturation at 95°C for 2 min, 1 cycle; 95°C for 15 s, 60°C for 1 min, 40 cycles; and collecting fluorescence signals during annealing and extension (60°C).

[0110] The results are shown in Table 4 below, and Figure 4-6 .

[0111] Table 4

[0112]

[0113] The results showed that the Ct values ​​of the mixed probe and the single probe for detecting samples of the same concentration had little difference, indicating that the primer probe provided by the present invention has strong anti-interference ability, ensuring the accuracy and reliability of the detection results.

[0114] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made thereto. Therefore, such modifications and improvements, without departing from the spirit of the present invention, are intended to be within the scope of protection claimed herein.

[0115]

[0116]

[0117]

[0118]

[0119]

Claims

1. A probe and primer combination for identifying Little Egret by TaqMan real-time fluorescence quantitative PCR, characterized in that: The method comprises a probe, an upstream primer and a downstream primer, wherein the nucleotide sequence of the probe is 5'-FAM-TGGAAATGCTATATCAGG-MGB-3', the nucleotide sequence of the upstream primer is 5'-GGATTCGGAAACTGACTAGTACCC-3', and the nucleotide sequence of the downstream primer is 5'-GGTGGAAGGAGTCAGAAACTTATG-3'.

2. A kit for identifying Little Egret by TaqMan real-time fluorescence quantitative PCR, characterized in that: Comprising the probe primer combination as claimed in claim 1.

3. Use of the probe-primer combination as claimed in claim 1, or the kit as claimed in claim 2 in species identification of Little Egret.

4. A method for identifying the species of Little Egret, characterized in that: The method comprises: (1) Extracting cDNA or genomic DNA from the sample to be tested; (2) performing a TaqMan real-time fluorescence quantitative PCR reaction using the probe, upstream primer, and downstream primer as claimed in claim 1 to obtain a Ct value and an amplification curve; (3) Determination of test results: If the Ct value is ≤35 and a typical amplification curve appears, the result is positive; if there is no Ct value or no amplification curve, the result is negative; if the Ct value is >35, the sample is repeated. If there is no Ct value in the repeated result, it is negative; otherwise, it is positive.

5. The method for identifying the species of Little Egret according to claim 4, wherein: The TaqMan real-time fluorescence quantitative PCR reaction system was as follows: 2xT5 Fast qPCR Mix 10 μL, upstream primer 10 μM 0.7 μL, downstream primer 10 μM 0.7 μL, TaqMan probe 10 μM 0.6 μL, DNA template 1 μL, and supplemented with ddH2O to a total volume of 20 μL.

6. The method for identifying the species of Little Egret according to claim 4, wherein: The reaction conditions of TaqMan real-time fluorescence quantitative PCR were as follows: pre-denaturation at 95°C for 2 min; 40 cycles of 95°C for 15 s and 60°C for 30 s.

Images