Primers, kit and method for identifying pelteobagrus fulvidraco, pelteobagrus vachelli, leiocassis longirostris and hybrids thereof

Abstract

The invention relates to the technical field of biology, in particular to primers, a kit and a method for identifying pelteobagrus fulvidraco, pelteobagrus vachelli, leiocassis longirostris and hybrids of the pelteobagrus fulvidraco, the pelteobagrus vachelli, the leiocassis longirostris and the hybrids of the pelteobagrus fulvidraco and the leiocassis longirostris. According to the method, after DNA extraction is carried out on a fin ray trace sample, species identification can be completed through combination of PCR amplification and an agarose gel electrophoresis technology, the accuracy of a detection result is high, the genetic marker specificity is high, the method is not limited by the growth condition of fish bodies, sampling identification can be carried out in all breeding stages, and an important technical support is provided for aquatic product breeding management.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to a primer, a kit and a method for identifying yellow catfish, yellow catfish vachelli, longnose catfish and their hybrids. Background Art

[0002] Pelteobagrus fulvidraco, Tachysurus vachellii, and Leiocassis longirostris are all important freshwater fish species in my country, belonging to the order Siluriformes and family Bagridae. Traditional morphological identification methods rely on experience and have high error rates, which can easily lead to chaotic aquaculture management and mixed germplasm resources. Hybrids, in particular, exhibit morphological traits similar to their parents, making accurate visual identification difficult in aquaculture settings. In recent years, the development of hybrid breeding technology has further complicated morphological identification of hybrid offspring between different species.

[0003] Obtaining DNA molecular markers by comparing specific differences in DNA sequences between species is one of the efficient and stable means of quickly identifying similar species. However, the existing technology lacks rapid identification methods for Pelteobagrus fulvidraco, Pelteobagrus vachelli, Longnose catfish, and their hybrids. Using morphological methods to identify closely related species can be difficult and prone to errors. Therefore, it is urgent to design and develop primers, kits, and methods for DNA molecular markers that can stably and efficiently identify Pelteobagrus fulvidraco, Pelteobagrus vachelli, Longnose catfish, and their hybrids, providing important technical support for breeding management during the seedling and grow-out stages. Summary of the Invention

[0004] In view of this, the present invention proposes a primer, a kit and a method for identifying Pelteobagrus fulvidraco, Pelteobagrus vachelli, Catfish longnose and their hybrids.

[0005] The technical solution of the present invention is achieved as follows:

[0006] In a first aspect, the present invention provides primers for identifying Pelteobagrus fulvidraco, Pelteobagrus vachelli, Catfish longnose, and hybrids thereof, wherein the forward and reverse primer sequences of the primers are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively. The hybrids include: a hybrid of Pelteobagrus fulvidraco and Pelteobagrus vachelli, a hybrid of Pelteobagrus fulvidraco and Catfish longnose, and a hybrid of Catfish longnose and Pelteobagrus vachelli.

[0007] In a second aspect, the present invention provides the use of the primers in identifying Pelteobagrus fulvidraco, Pelteobagrus vachelli, Catfish and their hybrids.

[0008] In a third aspect, the present invention provides a kit for identifying Pelteobagrus fulvidraco, Pelteobagrus vachelli, Catfish longnose and their hybrids, the kit comprising the primers and further comprising a PCR reaction reagent.

[0009] In a fourth aspect, the present invention provides use of the kit in identifying Pelteobagrus fulvidraco, Pelteobagrus vachelli, Catfish and their hybrids.

[0010] In a fifth aspect, the present invention further provides a method for identifying Pelteobagrus fulvidraco, Pelteobagrus vachelli, Catfish longnose and their hybrids, comprising the following steps:

[0011] Extract DNA from samples to be identified;

[0012] Performing PCR amplification on the extracted DNA to be tested using the primers described in claim 1;

[0013] The PCR amplification products were detected by agarose gel electrophoresis, and the sample types were identified based on the positions of the bands after electrophoresis.

[0014] Furthermore, the method for determining the type of sample based on the position of the band after electrophoresis is as follows:

[0015] If a 412 bp band is amplified, the corresponding species is Pelteobagrus fulvidraco;

[0016] If a 526 bp band is amplified, the corresponding species is Pelteobagrus vachelli;

[0017] If a 572 bp band is amplified, the corresponding species is Catfish;

[0018] If two bands of 412 bp and 526 bp were amplified, the corresponding species was a hybrid of Pelteobagrus fulvidraco and Pelteobagrus vachelli;

[0019] If two bands of 412 bp and 572 bp were amplified, the corresponding species was a hybrid of Pelteobagrus fulvidraco and Catfish;

[0020] If two bands of 572 bp and 526 bp are amplified, the corresponding species is a hybrid of Catfish longnose and Pelteobagrus vachelli.

[0021] Furthermore, the sample to be identified is fish fin ray tissue.

[0022] Furthermore, the PCR amplification reaction system is 10 μL, which includes: 0.5 μL 10 μM forward primer, 0.5 μL 10 μM reverse primer, 5 μL 2×TaqMasterMix, 1 μL DNA template and 3 μL ddH2O.

[0023] Furthermore, the reaction procedure of the PCR amplification is:

[0024] First, pre-denaturation at 95°C for 3-5 minutes;

[0025] Then enter the cyclic amplification stage: 95℃40s, 60℃30s, 72℃60s, cycle 30-35 times;

[0026] Finally, keep the mixture at 72°C for 7 min.

[0027] The beneficial effects of the present invention include at least the following:

[0028] The specific primers, detection kit, and method provided by the present invention can accurately identify yellow catfish, yellow catfish (Petrostris vachelli), longnose catfish, and their hybrids. This method uses DNA extracted from fin ray trace samples, followed by PCR amplification combined with agarose gel electrophoresis to complete species identification. The present invention offers highly accurate detection results and strong genetic marker specificity, offering advantages such as accuracy, reliability, low cost, and ease of use. Furthermore, sampling and testing can be performed at various breeding stages, including the seedling and growout stages, providing important technical support for aquaculture breeding management. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0030] Figure 1 Schematic diagram of primer design in an embodiment of the present invention;

[0031] Figure 2 This is a graph showing the gel electrophoresis results of the PCR amplification products in Example 1 of the present invention;

[0032] Figure 3 This is a diagram showing the gel electrophoresis results of the PCR amplification products in Example 2 of the present invention. DETAILED DESCRIPTION

[0033] In order to make the purpose, technical solutions and advantages of the present invention clearer, the technical solutions in the present invention will be clearly and completely described below. Obviously, the embodiments described are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention. If specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or the conditions recommended by the manufacturer. If the manufacturer is not specified for the reagents or instruments used, they are all conventional products that can be purchased commercially.

[0034] Table 1 Sequence information

[0035] name SEQ ID NO Sequence (5'-3') Length (bp) Forward primer 1 TGCCATCATTGTTGTCTTCA 20 Reverse primer 2 ATCAGTCGTGGCTCTGTTCC 20

[0036] Primer design principles:

[0037] In the assembled and annotated genome sequence of Pelteobagrus vachelli, the aaas gene sequence of Pelteobagrus vachelli was aligned with the publicly published genomes of Pelteobagrus fulvidraco and Catfish in the NCBI database to obtain the corresponding sequence. Then, the three corresponding difference sequences were arranged by base and the difference positions were marked, such as Figure 1 As shown, based on this DNA sequence difference, primers can be designed to accurately identify the species of Pelteobagrus fulvidraco, Pelteobagrus vachelli, Catfish longnose and their hybrids. The forward primer sequence is shown in SEQ ID NO: 1, and the reverse primer sequence is shown in SEQ ID NO: 2 (Table 1).

[0038] Example 1

[0039] 1. Materials and Methods

[0040] (1) Sample collection: 10 each of 2-year-old yellow catfish, yellow catfish, longnose catfish and their hybrids were collected.

[0041] (2) Genomic DNA extraction: DNA was extracted using the alkaline lysis method. The specific steps include:

[0042] (a) Take 10-50 mg of fresh fin ray tissue, mince it, and place it in a 1.5 mL centrifuge tube.

[0043] (b) Prepare 50 mM NaOH using 0.1 g NaOH and 50 mL ddH2O.

[0044] (c) Add 100 μL of 50 mM NaOH to a 1.5 mL centrifuge tube containing fin ray tissue and heat in a 94°C water bath for 2 h, shaking every 30 min until complete lysis.

[0045] (d) Add 5 μL of Tris-HCl to a 1.5 mL centrifuge tube for alkaline neutralization. Centrifuge the tube to collect the supernatant, transfer it to a new centrifuge tube, and store it at 4°C.

[0046] (3) Measure DNA concentration: Adjust the DNA concentration to 50 ng / μL.

[0047] (4) Primer preparation: Taking the gene sequence of Pelteobagrus vachelli as an example, after the assembled and annotated Pelteobagrus vachelli genome is completed, it is aligned with the publicly published Pelteobagrus vachelli and Catfish genomes in the NCBI database to obtain the corresponding sequences. Then, the three corresponding differential sequences are arranged by base and the differential positions are marked, such as Figure 1As shown, based on this DNA sequence difference, primers can be designed to accurately identify the species of Pelteobagrus fulvidraco, Pelteobagrus vachelli, Catfish longnose and their hybrids. The forward primer sequence is: TGCCATCATTGTTGTCTTCA; the reverse primer sequence is: ATCAGTCGTGGCTCTGTTCC.

[0048] (5) PCR amplification was performed on the tissue DNA of 6 species using the above-mentioned forward and reverse primers. The PCR reaction system was 10 μL, including 0.5 μL 10 μM forward primer, 0.5 μL 10 μM reverse primer, 5 μL 2× TaqMasterMix, 1 μL fin genomic DNA, and 3 μL ddH2O. PCR procedure: The above-mentioned premix was slightly centrifuged and placed in a PCR instrument for PCR amplification. Pre-denature at 95°C for 5 minutes, and then enter the cyclic amplification stage: 95°C for 40 seconds → 60°C for 30 seconds → 72°C for 60 seconds, cycle 35 times, and then keep warm at 72°C for 7 minutes.

[0049] (6) Electrophoresis detection of PCR products: Prepare 1% agarose gel, mix the PCR amplification products with Gel-red dye and then spot them. Perform electrophoresis at 200V and 200A for 15 minutes. Place the gel on a UV-illuminator to compare the bands.

[0050] 2. Results

[0051] The gel electrophoresis results of the primer PCR amplification products are shown in the figure below. Figure 2 shown.

[0052] Figure 2 (a) From left to right: the first position is a marker (DL2000plus), electrophoresis bands 1-5 are longnose catfish, and the amplified band size is 572bp; bands 6-10 are hybrids of longnose catfish and Pelteobagrus vachelli, and the amplified band sizes are 572bp and 526bp; bands 11-15 are Pelteobagrus vachelli, and the amplified band size is 526bp.

[0053] Figure 2 (b) From left to right: the first position is a marker (DL2000plus), electrophoresis bands 1-5 are longnose catfish, and the amplified band size is 572bp; bands 6-10 are hybrids of longnose catfish and yellow catfish, and the amplified band sizes are 572bp and 412bp; bands 11-15 are yellow catfish, and the amplified band size is 412bp.

[0054] Figure 2(c) From left to right: the first position is a marker (DL2000plus), electrophoresis bands 1-5 are Pelteobagrus vachelli, and the amplified band size is 526 bp; bands 6-10 are hybrids of Pelteobagrus vachelli and Pelteobagrus fulvidraco, and the amplified band sizes are 526 bp and 412 bp respectively; bands 11-15 are Pelteobagrus fulvidraco, and the amplified band size is 412 bp.

[0055] The species identification success rate is 100%, and the above 6 species can be identified quickly and accurately.

[0056] Example 2

[0057] 1. Method

[0058] (1) Species tagging: 10 each of yellow catfish, yellow catfish, longnose catfish, and their hybrids, for a total of 60 fish, implanted with PIT electronic tags for species identification, and co-cultured in the same aquaculture pond for identification;

[0059] (2) Sample collection: Randomly collect 30 fish to be identified;

[0060] (3) Extraction of fin ray DNA from yellow catfish, yellow catfish, long snout catfish and their hybrids, genomic DNA extraction using alkaline lysis method to extract DNA, the specific steps are the same as in Example 1;

[0061] (4) Using forward and reverse primers as shown in SEQ ID NO: 1-2, PCR amplification of genomic DNA of Pelteobagrus fulvidraco, Pelteobagrus vachelli, Catfish longnose and their hybrids was performed, and the specific steps were the same as in Example 1;

[0062] (5) Mix the PCR amplification products with nucleic acid dye and run electrophoresis on 1% agarose gel for 15 minutes. Place the gel on a UV-illuminator to check the bands and determine the species.

[0063] 2. Results

[0064] The gel electrophoresis results of the PCR amplification products were as follows Figure 3 As shown, from left to right: the first position is a marker (DL2000plus), the electrophoresis bands 1, 7, and 13 are longnose catfish, and the amplified band size is 572bp; the 5th, 8th, and 15th are hybrids of longnose catfish and Pelteobagrus vachelli, and the amplified band sizes are 572bp and 526bp; the 3rd and 11th are Pelteobagrus vachelli, and the amplified band size is 526bp; the 2nd, 9th, and 16th are hybrids of Pelteobagrus vachelli and Pelteobagrus fulvidraco, and the amplified band sizes are 526bp and 412bp; the 6th, 10th, and 14th are Pelteobagrus fulvidraco, and the amplified band size is 412bp; the 4th, 12th, and 17th are hybrids of longnose catfish and Pelteobagrus fulvidraco, and the amplified band sizes are 572bp and 412bp.

[0065] Combined with the implanted PIT species tag, the electrophoresis band identification results were verified. The species identification success rate was 100%, and the six species mentioned above could be identified quickly and accurately.

[0066] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A primer for identifying Pelteobagrus fulvidraco, Pelteobagrus vachelli, Catfish longnose and their hybrids, characterized in that: The forward and reverse primer sequences of the primers are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively.

2. Use of the primers according to claim 1 in identifying Pelteobagrus fulvidraco, Pelteobagrus vachelli, Catfish and their hybrids.

3. A kit for identifying Pelteobagrus fulvidraco, Pelteobagrus vachelli, Catfish longnose and their hybrids, characterized in that: Comprising the primer according to claim 1.

4. The kit according to claim 3, characterized in that Also includes PCR reaction reagents.

5. Use of the kit according to claim 3 or 4 in identifying Pelteobagrus fulvidraco, Pelteobagrus vachelli, Catfish and their hybrids.

6. A method for identifying Pelteobagrus fulvidraco, Pelteobagrus vachelli, Catfish and their hybrids, characterized in that: The steps include: Extract DNA from samples to be identified; Performing PCR amplification on the extracted DNA to be tested using the primers described in claim 1; The PCR amplification products were detected by agarose gel electrophoresis, and the sample types were identified based on the positions of the bands after electrophoresis.

7. The method according to claim 6, characterized in that If a 412 bp band is amplified, the corresponding species is Pelteobagrus fulvidraco; If a 526 bp band is amplified, the corresponding species is Pelteobagrus vachelli; If a 572 bp band is amplified, the corresponding species is Catfish; If two bands of 412 bp and 526 bp were amplified, the corresponding species was a hybrid of Pelteobagrus fulvidraco and Pelteobagrus vachelli; If two bands of 412 bp and 572 bp were amplified, the corresponding species was a hybrid of Pelteobagrus fulvidraco and Catfish; If two bands of 572 bp and 526 bp are amplified, the corresponding species is a hybrid of Catfish longnose and Pelteobagrus vachelli.

8. The method according to claim 6, characterized in that The sample to be identified is fish fin ray tissue.

9. The method according to claim 6, characterized in that The PCR amplification reaction system is 10 μL, which includes: 0.5 μL 10 μM forward primer, 0.5 μL 10 μM reverse primer, 5 μL 2×TaqMasterMix, 1 μL DNA template and 3 μL ddH2O.

10. The method according to claim 6, characterized in that The reaction procedure of the PCR amplification is: First, pre-denaturation at 95°C for 3-5 minutes; Then enter the cyclic amplification stage: 95℃40s, 60℃30s, 72℃60s, cycle 30-35 times; Finally, keep the mixture at 72°C for 7 min.

Images