Application of substance for detecting genotype of SNP (Single Nucleotide Polymorphism) site in identification or auxiliary identification of dairy cow milk fatty acid traits
By detecting the SNP site genotype at position 22889812 on chromosome 26 of UMD3.1, the problem of identifying fatty acid traits of dairy cow milk was solved, and precise management and cost reduction of dairy cow breeding were achieved.
Patent Information
- Application Number
- CN202510752230.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-06
- Publication Date
- 2025-08-15
AI Technical Summary
It is difficult to effectively identify or assist in the identification of fatty acid traits of dairy cow milk, affecting dairy breeding and precise management of dairy cows.
By detecting the SNP site genotype at position 22889812 on chromosome 26 of UMD3.1, the cattle genomic DNA was amplified and sequenced using specific primers to determine the content of cow milk fatty acids, including C6:0, C8:0, C10:0, C14:0, C14:1, C16:1, C17:0 and C18:0 fatty acid content.
Accurate identification of fatty acid traits of dairy cow milk is achieved, and dairy cows with target fatty acid content can be selected according to the genotype, improving breeding efficiency and reducing breeding costs.
Smart Images

Figure FT_1 
Figure SMS_1 
Figure SMS_2
Abstract
Description
Technical Field
[0001] The present invention relates to the field of molecular biotechnology, and in particular to an application of a substance for detecting SNP site genotypes in identifying or assisting in identifying dairy cow milk fatty acid traits. Background Art
[0002] Milk and dairy products are nutritious foods that contain a variety of essential nutrients. Milk fat is one of the most important breeding targets for dairy cows. The fatty acids in milk fat include saturated fatty acids and unsaturated fatty acids, which are considered to be essential nutrients in the human diet and play an important role in influencing human health outcomes. The biological activity of fatty acids shows structure dependence, and the carbon chain length, saturation and stereoisomerism determine their different roles in metabolic regulation and cell signaling pathways. Milk fatty acid content plays an important role in selective breeding and precision management, and helps to improve milk quality. Therefore, there is an urgent need in this field for a method to identify or assist in the identification of dairy cow milk fatty acid traits. Summary of the Invention
[0003] The technical problem to be solved by the present invention is how to identify or assist in identifying the fatty acid properties of dairy cow milk.
[0004] In a first aspect, the present invention provides an application of a substance for detecting the genotype of a SNP site in identifying or assisting in identifying the milk fatty acid traits of dairy cows, wherein the SNP site is g.22889812, and the g.22889812 is the base at position 22889812 on chromosome 26 of the bovine reference genome UMD3.1.
[0005] In the application described above, the bovine reference genome UMD3.1 is the bovine reference genome sequence in the GenBank database.
[0006] As described above, the SNP site has a C / T polymorphism.
[0007] As described above, the material for detecting the SNP site genotype includes a first primer and a second primer, the first primer is a single-stranded DNA molecule with a nucleotide sequence shown in SEQ ID NO: 1, and the second primer is a single-stranded DNA molecule with a nucleotide sequence shown in SEQ ID NO: 2.
[0008] In the above application, the cow genomic DNA is amplified using the first primer and the second primer. The nucleotide sequence of the obtained amplified product is SEQ ID NO: 3. The g.22889812 is the 214th position from the 5' end of the nucleotide sequence shown in SEQ ID NO: 3.
[0009] In the application as described above, the milk fatty acid trait includes the content of at least one fatty acid of C6:0, C8:0, C10:0, C14:0, C14:1, C16:1, C17:0 and C18:0 in cow milk.
[0010] In a second aspect, the present invention provides a method for identifying or assisting in identifying the milk fatty acid trait of a dairy cow, comprising: detecting the genotype of a SNP site in the genome of a dairy cow to be tested, and determining the milk fatty acid trait of the dairy cow to be tested according to the genotype; The SNP site is g.22889812, and g.22889812 is the base at position 22889812 on chromosome 26 of the cattle reference genome UMD3.1.
[0011] According to the method described above, the genotype of the SNP site in the genome of the cow to be tested can be obtained by conventional methods such as PCR; in a specific embodiment, the genomic DNA of the cow to be tested is extracted, and the genomic DNA of the cow to be tested is used as a template, and the genomic DNA of the cow to be tested is amplified using the first primer and the second primer to obtain an amplified product; the amplified product is then sequenced to determine the genotype of the SNP site.
[0012] According to the method described above, the genotypes of the SNP site include CC, CT, and TT. CC indicates that the SNP site is a homozygous type of C, CT indicates that the SNP site is a heterozygous type of C and T, and TT indicates that the SNP site is a homozygous type of T.
[0013] The method described above, wherein determining the milk fatty acid trait of the cow to be tested according to the genotype comprises: The content of C6:0 in the milk of cows whose genotype of the SNP site is TT is greater than the content of C6:0 in the milk of cows whose genotype of the SNP site is CC, and the content of C6:0 in the milk of cows whose genotype of the SNP site is CC is greater than the content of C6:0 in the milk of cows whose genotype of the SNP site is CT; The content of C8:0 in the milk of cows whose genotype of the SNP site is TT is greater than the content of C8:0 in the milk of cows whose genotype of the SNP site is CC, and the content of C8:0 in the milk of cows whose genotype of the SNP site is CC is greater than the content of C8:0 in the milk of cows whose genotype of the SNP site is CT; The content of C10:0 in the milk of cows whose genotype at the SNP site is TT is greater than the content of C10:0 in the milk of cows whose genotype at the SNP site is CT, the content of C10:0 in the milk of cows whose genotype at the SNP site is TT is greater than the content of C10:0 in the milk of cows whose genotype at the SNP site is CC, and there is no statistically significant difference between the content of C10:0 in the milk of cows whose genotype at the SNP site is CT and the content of C10:0 in the milk of cows whose genotype at the SNP site is CC; The content of C14:0 in the milk of cows whose genotype of the SNP site is TT is greater than the content of C14:0 in the milk of cows whose genotype of the SNP site is CC, the content of C14:0 in the milk of cows whose genotype of the SNP site is CT is greater than the content of C14:0 in the milk of cows whose genotype of the SNP site is CC, and there is no statistically significant difference in the content of C14:0 in the milk of cows whose genotype of the SNP site is TT and the content of C14:0 in the milk of cows whose genotype of the SNP site is CT; The content of C14:1 in the milk of cows whose genotype at the SNP site is CC is greater than the content of C14:1 in the milk of cows whose genotype at the SNP site is TT, the content of C14:1 in the milk of cows whose genotype at the SNP site is CC is greater than the content of C14:1 in the milk of cows whose genotype at the SNP site is CT, and there is no statistically significant difference between the content of C14:1 in the milk of cows whose genotype at the SNP site is TT and the content of C14:1 in the milk of cows whose genotype at the SNP site is CT; The content of C16:1 in the milk of cows whose genotype at the SNP site is TT is greater than the content of C16:1 in the milk of cows whose genotype at the SNP site is CC, the content of C16:1 in the milk of cows whose genotype at the SNP site is CT is greater than the content of C16:1 in the milk of cows whose genotype at the SNP site is CC, and there is no statistically significant difference between the content of C16:1 in the milk of cows whose genotype at the SNP site is TT and the content of C16:1 in the milk of cows whose genotype at the SNP site is CT; The content of C17:0 in the milk of cows whose genotype at the SNP site is CC is greater than the content of C17:0 in the milk of cows whose genotype at the SNP site is TT, the content of C17:0 in the milk of cows whose genotype at the SNP site is CT is greater than the content of C17:0 in the milk of cows whose genotype at the SNP site is TT, and there is no statistically significant difference between the content of C17:0 in the milk of cows whose genotype at the SNP site is CC and the content of C17:0 in the milk of cows whose genotype at the SNP site is CT; The content of C18:0 in the milk of cows whose genotype at the SNP site is CC is greater than the content of C18:0 in the milk of cows whose genotype at the SNP site is TT, the content of C18:0 in the milk of cows whose genotype at the SNP site is CC is greater than the content of C18:0 in the milk of cows whose genotype at the SNP site is CT, and there is no statistically significant difference in the content of C18:0 in the milk of cows whose genotype at the SNP site is CT and the content of C18:0 in the milk of cows whose genotype at the SNP site is TT.
[0014] In a third aspect, the present invention provides a method for comparing or assisting in comparing milk fatty acid traits of dairy cows, comprising: detecting the genotypes of SNP sites in the genomes of at least two dairy cows to be tested, and comparing the milk fatty acid traits of the dairy cows to be tested based on the genotypes; The SNP site is g.22889812, and g.22889812 is the base at position 22889812 on chromosome 26 of the cattle reference genome UMD3.1.
[0015] In a fourth aspect, the present invention provides a method for screening dairy cows, comprising: detecting the genotype of a SNP site in the genome of the dairy cow to be screened, and selecting a dairy cow having a target genotype at the SNP site according to a screening target; The SNP site is g.22889812, and g.22889812 is the base at position 22889812 on chromosome 26 of the cattle reference genome UMD3.1.
[0016] The method described above, wherein the cow having the target genotype at the SNP site is selected according to the screening target, comprises at least one of the following A1) to A8): A1) When the screening target is to increase the milk fatty acid C6:0 content, dairy cows with a TT genotype at the SNP site are selected; A2) When the screening target is to increase the milk fatty acid C8:0 content, dairy cows with a TT genotype at the SNP site are selected; A3) When the screening target is to increase the milk fatty acid C10:0 content, dairy cows with a TT genotype at the SNP site are selected; A4) When the screening target is to increase the milk fatty acid C14:0 content, cows with a TT genotype at the SNP site are selected; A5) When the screening target is to increase the milk fatty acid C16:1 content, dairy cows with a TT genotype at the SNP site are selected; A6) When the screening target is to increase the milk fatty acid C14:1 content, cows with a CC genotype at the SNP site are selected; A7) When the screening target is to increase the milk fatty acid C17:0 content, cows with a CC genotype at the SNP site are selected; A8) When the screening target is to increase the milk fatty acid C18:0 content, dairy cows with a CC genotype at the SNP site are selected.
[0017] In a fifth aspect, the present invention provides a method for breeding dairy cows, comprising detecting the genotype of a SNP site in the genome of a dairy cow, selecting a dairy cow having a target genotype at the SNP site according to a breeding goal; and breeding dairy cows using the dairy cows having the target genotype as parents; The SNP site is g.22889812, and g.22889812 is the base at position 22889812 on chromosome 26 of the cattle reference genome UMD3.1.
[0018] In a sixth aspect, the present invention provides a composition for detecting the genotype of a SNP site, comprising a first primer and a second primer, wherein the first primer is a single-stranded DNA molecule having a nucleotide sequence as shown in SEQ ID NO:1, and the second primer is a single-stranded DNA molecule having a nucleotide sequence as shown in SEQ ID NO:2.
[0019] In a seventh aspect, the present invention provides a kit for detecting the genotype of a SNP site, comprising the above-mentioned composition.
[0020] The dairy cows involved in the present invention are all Holstein cows.
[0021] The milk fat properties involved in the present invention are all milk fat properties of dairy cows in lactation period 1, and the lactation period 1 refers to the lactation period after the first parturition.
[0022] The SNP site provided by the present invention is g.22889812, which is the base at position 22889812 on chromosome 26 of the bovine reference genome UMD3.1, and has a C / T polymorphism. The SNP site provided by the present invention is significantly or extremely significantly associated with the content of fatty acids in cow milk ( P = 0.0012 ~ P <0.0001), can be used for early screening of dairy cows, reduce breeding costs, and has application value in dairy cow breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] Figure 1 This is the mutation position of g.22889812C / T. DETAILED DESCRIPTION
[0024] In order to make the purpose, technical solutions and advantages of the present invention clearer, the technical solutions of the present invention will be clearly and completely described below in conjunction with the drawings in the present invention. Obviously, the embodiments described are part of the embodiments of the present invention, not all of the embodiments, and they should not be understood as limitations on the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention. In the description of the present invention, it should be understood that the terms used are only for descriptive purposes and cannot be understood as indicating or implying relative importance.
[0025] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.
[0026] The frozen semen samples of Chinese Holstein bulls and Chinese Holstein cows involved in the following examples were sourced from the Beijing Dairy Center.
[0027] The data involved in the following examples are all data of lactation period 1. Lactation period 1 refers to the lactation period after the first parturition.
[0028] Unless otherwise specified, the quantitative tests in the following examples were performed three times, and the results were averaged.
[0029] Example 1: Discovery of SNP sites Using the genotypes and milk fatty acid phenotypes of 784 Chinese Holstein cattle as materials, genome-wide association analysis revealed NFKB2 The gene is a key candidate gene for milk fatty acid content (C14:1 ~ P = 2.22E-12). Combined with functional annotation analysis, we found NFKB2 Genes involved in regulating milk fatty acid synthesis.
[0030] NFKB2 The (nuclear factor kappa B subunit 2, ID: 526392) gene encodes a subunit of the transcription factor complex nuclear factor κB and has been reported to be associated with milk production traits. NFKB2 It is the endpoint of a series of signal transduction events related to many biological processes such as inflammation, immunity, differentiation, cell growth, tumorigenesis and apoptosis. NFKB2 Involved in NF-κB, MAPK, and breast cancer signaling pathways. MAPK regulates breast cell growth, proliferation, and survival.
[0031] Example 2: Gene polymorphism detection First, a total of 44 Chinese Holstein bulls in Beijing were selected as the test population for genetic polymorphism testing. The 44 bulls were randomly divided into two groups (22 bulls in each group). Genomic DNA was extracted from frozen semen samples, and the DNA concentration was accurately measured using a nucleic acid quality detector. The DNA was diluted to a concentration of 50 ng / μL and mixed into two equal pools, which served as templates for PCR amplification.
[0032] 2. According to cattle NFKB2 gene sequence (gene ID 526392), and 23 pairs of primers were designed as shown in Table 1.
[0033] Table 1 NFKB2 Gene PCR amplification primer sequence information
[0034] 3. Using the pooled DNA obtained in step 1 as a template, perform PCR amplification using each primer pair to obtain a PCR amplification product. The PCR reaction system is shown in Table 2, and the PCR reaction conditions are shown in Table 3.
[0035] Table 2 PCR reaction system
[0036] Table 3 PCR reaction conditions
[0037] Fourth, the PCR amplification products were sequenced. The results showed that the bull population NFKB2 There is a SNP marker in the 5' regulatory region of the gene. The SNP marker is shown in Table 4. The mutation position is shown in Figure 1 As shown. g.22889812C / T is adopted NFKB2-5F and NFKB2-5R The products obtained by PCR amplification with the primer pairs composed of the above two sequences were sequenced and analyzed. NFKB2-5F and NFKB2-5R The nucleotide sequences correspond to the sequences shown in SEQ ID NO: 1-2 in the sequence table, and the nucleotide sequence of the PCR product is shown in SEQ ID NO: 3, where Y represents C or T, and the SNP site is located at the 214th position from the 5' end of the PCR amplification product.
[0038] SEQ ID NO: 3 is specifically as follows: 5'-tttcccttatcctcggaagacttcctgagctcaggtctgaaagtctggccagctgttaaatgttctgtcatttacagaacaagcttcaggtccagacactttctt cccgggaagattgagagtattacggagtctccatgaggctccagaggggccaccagatggcactctagaacctactgcaagatcaacttccttcctcttcctctaagt Y ttcccggcagccgggcccgctccgggcgggaccagagggctgaggcatatcagcttccccctggggttccccgacttcagaggtggccgagcattaggcggagcatagaaccgagtagcagcaggggcttccagccggcttggacaggcctgggtgtgaggaga ccggagccaggtccctcggctggggaatggcgctcggtcagcggatcccgcagcgggttggcagagctagtgcctgtctgagggtcattctcactctggcttccagagctacacaaatgtttctcctccaaggggcgccccagagtcactcccgattggt-3'.
[0039] g.22889812C / T is the designation for the SNP. SNPs are generally named based on the pattern observed when the SNP was first discovered. DNA is double-stranded and follows the principle of complementary base pairing. Sequence 47 in the present invention and the sequence at the time of SNP discovery are the reverse complements of the same double-stranded DNA. Therefore, for Sequence 1 in the present invention, the polymorphic form of g.22889812C / T is C / T. To avoid confusion, g.22889812C / T will continue to be described in this specification as a C / T polymorphic form.
[0040] Table 4 One SNP found in the NFKB2 gene
[0041] Example 3, association analysis 1. Obtaining the test population The experimental group consisted of 1065 Chinese Holstein cows.
[0042] 2. Genotyping Each individual in the test group was genotyped separately.
[0043] (A) Genotyping based on g.22889812C / T.
[0044] 1. Take blood from the test individual and extract genomic DNA.
[0045] 2. Using genomic DNA as template, NFKB2-5F and NFKB2-5R PCR amplification was performed using the primer pairs composed of the two primers. The PCR amplification products were then recovered and sequenced. The PCR amplification reaction system is shown in Table 5. The PCR amplification reaction conditions are shown in Table 6. The PCR amplification products for each test individual were 538 bp, with g.22889812C / T at position 214.
[0046] Table 5 PCR reaction system
[0047] Table 6 PCR reaction conditions
[0048] 2. Detection of milk fatty acid content Each cow in the test group had its milk fatty acid content tested by gas chromatography. The milk fatty acid content traits included the following eight indicators: C6:0, C8:0, C10:0, C14:0, C14:1, C16:1, C17:0, and C18:0.
[0049] The records of each individual include the cow's individual number, father's number, mother's number, grandfather's number, grandmother's number, maternal grandfather's number, maternal grandmother's number, date of birth, lactation period, calving date, and milk fatty acid C6:0, C8:0, C10:0, C14:0, C14:1, C16:1, C17:0, and C18:0 contents.
[0050] 3. Association analysis between SNP sites and traits The MIXED procedure in SAS 9.2 software was used to perform association analysis between eight indicators of milk fatty acid content traits: C6:0, C8:0, C10:0, C14:0, C14:1, C16:1, C17:0, C18:0 and genotype. NFKB2 The results of association analysis between gene g.22889812C / T and milk fatty acid content are shown in Table 7.
[0051] The association analysis used an animal model, the specific model is as follows:
[0052] in, is the phenotypic value of milk fatty acid content (C6:0, C8:0, C10:0, C14:0, C14:1, C16:1, C17:0, and C18:0); is the group mean; was the fixed effect corresponding to the genotype combination of individual i; (j=1-23) and (k=1-4) are field and lactation stage effects, respectively; It is an individual additive genetic effect; (m=1-293) is the effect of calving age in months; is the regression coefficient of the covariate M; is a random residual effect.
[0053] Table 7 Association analysis between NFKB2 gene g.22889812C / T and milk fatty acid content (least squares mean ± standard error)
[0054] Note: ** indicates P < 0.01, indicating extremely significant differences. Data in the same column a and b with different superscripts indicate significant differences; data in the same column A and B with different superscripts indicate extremely significant differences.
[0055] As shown in Table 7, g.22889812C / T has a very significant correlation with the contents of C6:0, C8:0, C10:0, C14:0, C14:1, C16:1, C17:0 and C18:0 ( P = 0.0012 ~ P <0.0001), the dominant allele for the C6:0, C8:0, C10:0, C14:0, and C16:1 content traits was T; and the dominant allele for the C14:1, C17:0, and C18:0 content traits was C.
[0056] for NFKB2 Gene g.22889812C / T, the C6:0 and C8:0 contents of milk fatty acids in cows with CC genotype were lower than those in cows with TT genotype, the C6:0 and C8:0 contents of milk fatty acids in cows with CT genotype were lower than those in cows with TT genotype, and the C6:0 and C8:0 contents of milk fatty acids in cows with CC genotype were higher than those in cows with CT genotype.
[0057] for NFKB2Gene g.22889812C / T, the C10:0 content of milk fatty acid in cows with CC genotype was lower than that in cows with TT genotype, and the C10:0 content in milk fatty acid in cows with CT genotype was lower than that in cows with TT genotype. There was no significant difference in the C10:0 content in milk between cows with CC genotype and cows with CT genotype.
[0058] for NFKB2 Gene g.22889812C / T, the C14:0 and C16:1 contents of milk fatty acids in cows with CC genotype were lower than those in cows with TT genotype. There were no significant differences in the C14:0 and C16:1 contents of milk fatty acids in cows with CT genotype and TT genotype. The C14:0 and C16:1 contents of milk fatty acids in cows with CC genotype were lower than those in cows with CT genotype.
[0059] for NFKB2 Gene g.22889812C / T, the C14:1 and C18:0 contents of milk fatty acids in cows with CC genotype were higher than those in cows with TT genotype. There were no significant differences in the C14:1 and C18:0 contents of milk fatty acids in cows with CT genotype and TT genotype. The C14:1 and C18:0 contents of milk fatty acids in cows with CC genotype were higher than those in cows with CT genotype.
[0060] for NFKB2 Gene g.22889812C / T, the C17:0 content of milk fatty acid in cows with CC genotype was higher than that in cows with TT genotype, the C17:0 content of milk fatty acid in cows with CT genotype was higher than that in cows with TT genotype, and there was no significant difference in the C17:0 content in milk between cows with CC genotype and cows with CT genotype.
[0061] 4. Analysis of genetic effects SAA 9.2 software was used to perform significance tests of SNP additive effect, dominant effect and substitution effect.
[0062] The basic calculation formula is as follows: ; in, is an additive effect, For dominant effect, is the allele substitution effect; AA, AB, and BB are the least square means of milk production traits of the corresponding genotypes; is the frequency of allele A, is the frequency of allele B.
[0063] The results of the tests for additive effect, dominance effect and allele substitution effect are shown in Table 8.
[0064] Table 8 NFKB2 Results of tests on additive effect, dominance effect and substitution effect of gene alleles
[0065] Note: * indicates P<0.05, the difference is significant; ** indicates P<0.01, the difference is extremely significant.
[0066] As shown in Table 8, g.22889812C / T had significant additive effects on milk fatty acids C6:0, C8:0, C10:0, C14:0, C14:1, C16:1, C17:0, and C18:0. The allele substitution effect of g.22889812C / T on milk fatty acids C10:0, C14:0, C14:1, C16:1, C17:0, and C18:0 was significant, that is, each T allele replacing a C allele would result in a decrease of 0.0478 mg / 100g in C10:0 ( P <0.01), C14:0 decreased by 0.1636 mg / 100g ( P <0.01), C14:1 increased by 0.0495 mg / 100g ( P <0.01), C16:1 decreased by 0.0645 mg / 100g ( P <0.01), C17:0 increased by 0.0072 mg / 100g ( P <0.01) and C18:0 increased by 0.2654 mg / 100g ( P <0.01).
[0067] The molecular markers provided by the present invention can be used to identify or assist in identifying dairy cow groups with excellent milk production traits (milk fatty acid content C6:0, C8:0, C10:0, C14:0, C14:1, C16:1, C17:0 and C18:0). It has the advantages of being simple, rapid, sensitive, and providing reliable, stable and accurate results, and is suitable for the needs of large-scale group testing.
[0068] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.
Claims
1. Use of a substance for detecting SNP site genotype in identifying or assisting in identifying dairy cow milk fatty acid traits, characterized in that: The SNP site is g.22889812, and g.22889812 is the base at position 22889812 on chromosome 26 of the cattle reference genome UMD3.
1.
2. The use according to claim 1, characterized in that The material for detecting the genotype of the SNP site includes a first primer and a second primer, wherein the first primer is a single-stranded DNA molecule with a nucleotide sequence shown in SEQ ID NO: 1, and the second primer is a single-stranded DNA molecule with a nucleotide sequence shown in SEQ ID NO:
2.
3. The use according to claim 1, characterized in that The milk fatty acid traits include the content of at least one fatty acid of C6:0, C8:0, C10:0, C14:0, C14:1, C16:1, C17:0 and C18:0 in cow milk.
4. A method for identifying or assisting in identifying the fatty acid properties of dairy cow milk, characterized in that: include: Detecting the genotype of the SNP site in the genome of the tested dairy cow, and determining the milk fatty acid trait of the tested dairy cow according to the genotype; The SNP site is g.22889812, and g.22889812 is the base at position 22889812 on chromosome 26 of the cattle reference genome UMD3.
1.
5. A method for comparing or assisting in comparing the fatty acid properties of dairy cow milk, characterized in that: include: detecting the genotypes of the SNP sites in the genomes of at least two tested dairy cows, and comparing the milk fatty acid traits of the tested dairy cows based on the genotypes; The SNP site is g.22889812, and g.22889812 is the base at position 22889812 on chromosome 26 of the cattle reference genome UMD3.
1.
6. A method for screening dairy cows, characterized in that, include: Detecting the genotype of the SNP site in the genome of the cow to be screened, and selecting cows with the target genotype at the SNP site according to the screening target; The SNP site is g.22889812, and g.22889812 is the base at position 22889812 on chromosome 26 of the cattle reference genome UMD3.
1.
7. The method according to claim 6, characterized in that Selecting a dairy cow having a target genotype at the SNP site according to a screening target includes at least one of the following A1) to A8): A1) When the screening target is to increase the milk fatty acid C6:0 content, dairy cows with a TT genotype at the SNP site are selected; A2) When the screening target is to increase the milk fatty acid C8:0 content, dairy cows with a TT genotype at the SNP site are selected; A3) When the screening target is to increase the milk fatty acid C10:0 content, dairy cows with a TT genotype at the SNP site are selected; A4) When the screening target is to increase the milk fatty acid C14:0 content, cows with a TT genotype at the SNP site are selected; A5) When the screening target is to increase the milk fatty acid C16:1 content, dairy cows with a TT genotype at the SNP site are selected; A6) When the screening target is to increase the milk fatty acid C14:1 content, cows with a CC genotype at the SNP site are selected; A7) When the screening target is to increase the milk fatty acid C17:0 content, cows with a CC genotype at the SNP site are selected; A8) When the screening target is to increase the milk fatty acid C18:0 content, dairy cows with a CC genotype at the SNP site are selected.
8. A method for breeding dairy cows, characterized in that: include: Detecting the genotype of the SNP site in the cow genome, and selecting cows with target genotypes at the SNP site according to breeding goals; Breeding dairy cows using cows with target genotypes as parents; The SNP site is g.22889812, and g.22889812 is the base at position 22889812 on chromosome 26 of the cattle reference genome UMD3.
1.
9. A composition for detecting SNP site genotype, characterized in that: It comprises a first primer and a second primer, wherein the first primer is a single-stranded DNA molecule whose nucleotide sequence is shown in SEQ ID NO: 1, and the second primer is a single-stranded DNA molecule whose nucleotide sequence is shown in SEQ ID NO:
2.
10. A kit for detecting SNP genotypes, characterized in that: Comprising the composition of claim 9.