Protein detection system based on glass nanopore and nano manipulation as well as preparation method and application of protein detection system

Abstract

The invention relates to a protein detection system based on glass nanopores and nano manipulation as well as a preparation method and application of the protein detection system, and belongs to the technical field of biology. Aiming at the technical defects that an existing protein detection method is high in detection limit and complex in operation and traditional nanopores are prone to being blocked, efficient capture and detection of protein are achieved by designing a double-Gap double-chain DNA chip and aptamer combination system and combining 10-17 nm glass nanopores and an accurate nanometer manipulation technology. The method comprises the following steps: fixing double-Gap-containing double-chain DNA on the surface of a glass sheet, and specifically capturing a target protein through an aptamer specifically bound with Gap; a nano control platform is used for controlling the glass nanopore to carry out directional capture on a DNA-protein compound, and protein detection is realized through ion current change. The problems of non-specific adsorption and hole blocking in protein detection are effectively solved, and a novel protein detection platform is provided for clinical diagnosis.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and relates to a protein detection system based on glass nanopores and nanomanipulation, and a preparation method and application thereof. Background Art

[0002] Existing methods for detecting protein molecules, such as enzyme-linked immunosorbent assay (ELISA), surface-enhanced Raman spectroscopy (SERS), electrochemical methods, and fluorescence methods, generally have problems such as high detection limits, complex operations, and high costs. Nanopore detection technology, as an emerging single-molecule technology, has been widely used in the field of molecular detection in recent years due to its advantages such as low detection limits, high sensitivity, and high resolution. However, protein tumor markers, as the most commonly used type of marker in clinical practice, have complex conformations, stickiness, and uneven charge distribution. The use of traditional nanopore free translocation detection methods will cause pore blocking, which is not conducive to the detection of protein molecules. Therefore, a specific binding strategy between aptamers and protein molecules was adopted, and the detection of protein molecules was studied by combining solid-state nanopores and nanomanipulation technologies. The present invention achieves precise capture and high-resolution signal analysis of single proteins by optimizing the aptamer immobilization strategy and nanomanipulation parameters. Summary of the Invention

[0003] In view of this, one of the objects of the present invention is to provide a protein detection system based on glass nanopores and nanomanipulation, a second object is to provide a preparation method of a protein detection system based on glass nanopores and nanomanipulation, and a third object is to provide an application of a protein detection system based on glass nanopores and nanomanipulation.

[0004] In order to achieve the above object, the present invention provides the following technical solutions:

[0005] The present invention provides a protein detection system based on glass nanopores and nanomanipulation. The protein detection system comprises a DNA chip and a glass nanopore. Double-Gap double-stranded DNA is connected to the glass surface of the DNA chip. The double-Gap double-stranded DNA contains two segments of Gap single-stranded sequences. The Gap single-stranded sequences bind to the protein to be detected via an aptamer. The inner wall diameter of the glass nanopore is 10-17 nm. The glass nanopore is connected to the positive electrode of the patch clamp, and an electrolyte buffer solution is injected into the nanopore. The negative electrode is placed in the DNA chip solution. The glass nanopore is moved by a nanomanipulation platform to capture and detect the double-Gap double-stranded DNA and protein.

[0006] Preferably, the nucleic acid sequence of the double-Gap double-stranded DNA is shown in SEQ ID NO: 2, and the nucleic acid sequences of the Gap complementary strands are shown in SEQ ID NO: 7 and SEQ ID NO: 8;

[0007] Furthermore, a method for preparing a protein detection system based on glass nanopores and nanomanipulation is characterized by:

[0008] S1: Using circular plasmid PET28-N809 as a template, biotin-labeled aptamer primers were used for PCR amplification to obtain biotin-labeled aptamer double-stranded DNA;

[0009] S2: using Nt.BbvCI enzyme to digest the biotin-labeled double-stranded DNA to form a single-stranded nick at the 5'-CCTCAGC-3' site, and then adding the Gap complementary chain described in claim 2 to promote the shedding of the short chain to generate double-stranded DNA containing double Gap;

[0010] S3: After the enzyme digestion in step S2, BamHI enzyme was added to double-strand the undigested double-stranded DNA for double-strand cut, and the digestion was carried out at 37°C for 1 hour;

[0011] S4: Separate and purify double-gap double-stranded DNA by electrophoresis;

[0012] S5: The glass sheet of the DNA chip is modified with PEG and streptavidin, and the 3' or 5' end of the double-gap double-stranded DNA is modified with biotin. The double-gap double-stranded DNA is fixed on the surface of the glass sheet through the specific binding of streptavidin and biotin.

[0013] Preferably, in step S1, the biotin-labeled adaptor primers are primer 1: the nucleic acid sequence is shown in SEQ ID NO: 9, and primer 2: the nucleic acid sequence is shown in SEQ ID NO: 10, and the 5' end of primer 1 is biotin-labeled;

[0014] Preferably, the reaction conditions in step S2 are: 37°C, 3 hours; 90°C, 1 minute; 72°C, 5 minutes; 55°C, 5 minutes; 37°C, 20 minutes; 90°C to 37°C for a total of 4 cycles;

[0015] Preferably, the nucleic acid sequence of the plasmid PET28-N809 is shown in SEQ ID NO: 1;

[0016] Furthermore, the application of protein detection system based on glass nanopores and nanomanipulation in protein detection;

[0017] Preferably, the amino acid sequence of the protein is as shown in SEQ ID NO: 5 and SEQ ID NO: 6.

[0018] The beneficial effects of the present invention are:

[0019] 1. Effectively solve the pore blocking problem in protein detection

[0020] By designing a double-gap double-stranded DNA scaffold specifically binding to an aptamer, target proteins (such as CEA and AFP) are anchored to the surface of a DNA chip. A nanomanipulation platform is then used to precisely control the displacement of a glass nanopore (10-17nm inner diameter) to prevent clogging caused by direct protein entry. Experiments have demonstrated that this method can stably capture and detect protein molecules, and the area of ​​ion current trajectory changes can be reproducibly analyzed.

[0021] 2. Achieve high-sensitivity detection at the single-molecule level

[0022] By combining a glass nanopore with a patch clamp system, the detection resolution is significantly improved by detecting the changes in ionic current amplitude and trajectory area when protein molecules enter / exit the nanopore, making it possible to distinguish different protein molecules.

[0023] 3. Optimize the preparation process to improve detection stability

[0024] Double-stranded DNA containing double gaps was efficiently prepared by combining Nt.BbvCI digestion (37°C, 3h) with BamHI secondary digestion (37°C, 1h) and electrophoresis purification. The glass slide surface was modified with PEG-biotin (30:1 ratio) and immobilized with streptavidin to ensure firm binding of the DNA scaffold, reduce nonspecific adsorption, and improve system stability.

[0025] 4. Integrated detection system simplifies the operation process

[0026] By integrating DNA chips, glass nanopores and nanomanipulation platforms, automated capture and detection can be achieved by controlling the displacement of the nanopore, avoiding the complex sample labeling steps in traditional methods and significantly improving operational convenience.

[0027] Other advantages, objects, and features of the present invention will be described in part in the following description and, in part, will be apparent to those skilled in the art upon examination of the following description or may be learned from practice of the present invention. The objects and other advantages of the present invention may be realized and obtained through the following description. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to make the purpose, technical solutions and advantages of the present invention more clear, the present invention will be described in detail below with reference to the accompanying drawings, in which:

[0029] Figure 1 Schematic diagram of the system for nanomanipulation of protein molecules;

[0030] Figure 2 Ionic current trajectory diagram for manipulating CEA into and out of glass nanopores;

[0031] Figure 3Variation of the area of ​​the ionic current trajectory to manipulate CEA through a glass nanopore, (left) entering the nanopore, (right) exiting the nanopore;

[0032] Figure 4 Ionic current trajectory diagram for manipulating AFP into and out of glass nanopores;

[0033] Figure 5 Variations in the area of ​​the ionic current trajectory to manipulate AFP through a glass nanopore, (left) entering the nanopore, (right) exiting the nanopore;

[0034] Figure 6 Schematic diagram for preparing double-stranded DNA scaffold with Gap;

[0035] Figure 7 This is a DNA electrophoresis diagram with double gaps. DETAILED DESCRIPTION

[0036] The following describes the embodiments of the present invention by means of specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that the illustrations provided in the following embodiments are only schematic illustrations of the basic concept of the present invention, and the following embodiments and features in the embodiments can be combined with each other without conflict.

[0037] Among them, the accompanying drawings are only for illustrative purposes and represent only schematic diagrams rather than actual pictures, and should not be understood as limiting the present invention. In order to better illustrate the embodiments of the present invention, some parts of the accompanying drawings may be omitted, enlarged or reduced, and do not represent the dimensions of actual products. For those skilled in the art, it is understandable that some well-known structures and their descriptions may be omitted in the accompanying drawings.

[0038] The same or similar numbers in the drawings of the embodiments of the present invention correspond to the same or similar parts; in the description of the present invention, it should be understood that if there are terms such as "upper", "lower", "left", "right", "front", "back", etc. indicating directions or positional relationships, they are based on the directions or positional relationships shown in the drawings. They are only for the convenience of describing the present invention and simplifying the description, and do not indicate or imply that the device or element referred to must have a specific direction, be constructed and operate in a specific direction. Therefore, the terms describing the positional relationship in the drawings are only used for illustrative purposes and cannot be understood as limiting the present invention. For ordinary technicians in this field, the specific meanings of the above terms can be understood according to specific circumstances.

[0039] Example 1 Preparation of double-stranded DNA scaffold containing Gap

[0040] like Figure 6 As shown, the customized circular plasmid PET28-N809 was used as a template, and the nucleic acid sequence was shown in SEQ ID NO: 1, wherein:

[0041] CCATGG: NcoI restriction site;

[0042] AAGCTT: HindIII restriction site;

[0043] GCTGAGG: Nt.BbvCI restriction site;

[0044] GGATCC: BamHI restriction site;

[0045] GAATTC: EcoRI restriction site.

[0046] PCR amplification was performed using biotinylated primer 1 and non-biotinylated primer 2.

[0047] The primer sequences are as follows:

[0048] Primer 1, B-1461S: 5'CCAATGCGACCAGATGCTCCAC 3' (SEQ ID NO: 9) 5'biotin

[0049] Modification

[0050] Primer 2, 3401R: 5'GAACCATCACCCTAATCAAGT 3' (SEQ ID NO: 10)

[0051] The amplified 4687 bp biotin-labeled double-stranded DNA (B4-DNA) nucleic acid sequence is shown in SEQ ID NO: 2, wherein:

[0052] CCATGG: NcoI restriction site

[0053] AAGCTT: HindIII restriction site

[0054] GCTGAGG: Nt.BbvCI restriction site, cutting the complementary chain 5'CC / TCAGC 3'.

[0055] Double-stranded DNA was digested at 37°C using Nt.BbvCI. Nt.BbvCI is a nicking endonuclease that creates single-stranded nicks (nicks) at specific DNA sequences rather than completely severing the double-stranded DNA. Nt.BbvCI recognizes the sequence 5'-CCTCAGC-3', creating a single-stranded nick between CC and TCAGC. After Nt.BbvCI recognizes and cleaves the specific sequence, four single-stranded nicks are formed on the top strand of the double-stranded DNA. Adding an excess of base sequences that complementarily pair with the short strands formed by the single-stranded nicks causes the resulting short strands to fall off the double-stranded DNA. Due to the efficiency of the enzyme digestion, not all double-stranded DNA is digested. At this point, the sample contains not only double-stranded DNA with two single-stranded gaps but also intact, undigested double-stranded DNA.

[0056] In order to distinguish the intact double-stranded DNA that has not been digested by the enzyme from the target DNA fragment with two gaps, it is necessary to perform enzyme digestion again. BamHI is a restriction endonuclease (Restriction Enzyme), which can also recognize specific DNA sequences, but unlike Nt.BbvCI, BamHI cuts double-stranded DNA at the enzyme cutting site. Its recognition sequences are: 5'-GGATCC-3' and 3'-CCTAGG-5', cutting the double-stranded DNA between G and GATCC. Adding BamHI to the sample after the first enzyme digestion can cut the intact double-stranded DNA that has not been digested by Nt.BbvCI, producing two double-stranded chains with shorter chain lengths, which are clearly distinguishable from the chain length of the target DNA fragment. The obtained sample is cut and recovered by gel cutting to obtain the required double-gap double-stranded DNA.

[0057] Prepare a 50 μL system of double-stranded DNA scaffold (4B-Gap) containing double Gap: 4B DNA (SEQ ID NO: 2) 3' end biotin labeled, 10 μL to 20 μL; 10× rSmartBuffer, 5 μL; Nt.BbvCI, 1 μL; S5C (20 μM) and S3C (20 μM) 1.5 μL each; add ddH2O to 50 μL, mix well,

[0058] Gap complementary sequence:

[0059] S3C:GGTCACAGCAGCCGCAAGCACTGGATCCGCTGA (SEQ ID NO:7);

[0060] S5C:GGCTGTCATCCCGACGATCAGTGAATTCGCTGA (SEQ ID NO:8);

[0061] Prepare a 50 μL system of a double-stranded DNA scaffold (B4-Gap) containing a double Gap: 10 to 20 μL of 5'-end biotin-labeled B4DNA (SEQ ID NO: 2); 5 μL of 10× rSmartBuffer; 1 μL of Nt.BbvCI; 1.5 μL each of S5C (20 μM) and S3C (20 μM); add ddH2O to 50 μL and mix well.

[0062] Enzyme digestion conditions: 37°C, 3 hours; 90°C, 1 minute; 72°C, 5 minutes; 55°C, 5 minutes; 37°C, 20 minutes; 90°C-37°C for a total of 4 cycles. After the above digestion process is completed, add 1 μL of BamHI per 50 μL of the system and incubate at 37°C for 1 hour.

[0063] The agarose gel electrophoresis images after two rounds of enzyme digestion are shown in Figure 2. Figure 7 As shown, double-stranded DNA containing Gap was recovered by gel excision.

[0064] Example 2 Pretreatment and preparation of glass nanopores

[0065] The glass nanopore in this example was fabricated from a QF100-70-7.5 glass capillary tube from Sutter Corporation in the United States. This capillary tube is made of quartz, 7.5 cm long, has an outer diameter of 1 mm, an inner diameter of 0.7 mm, and contains a flow guide wire. The flow guide wire helps the electrolyte solution better fill the tip of the glass nanopore and connect to the sample cell to form a loop.

[0066] Before drawing the glass capillary into a glass nanopore, the glass capillary needs to be pre-treated to maximize cleaning of the glass tube and reduce interference during signal detection. The specific experimental steps are as follows:

[0067] (1) Soak the quartz glass capillary in acetone solution. Since acetone is volatile, sufficient acetone solution needs to be added and ultrasonicated in an ultrasonic cleaning machine for 20 minutes.

[0068] (2) Transfer the glass capillary from the acetone solution to 18.2 MΩ·cm deionized water and ultrasonicate it twice in an ultrasonic cleaner for 20 minutes each time. After the first ultrasonic cleaning is completed, place the glass capillary in clean deionized water and perform a second ultrasonic treatment.

[0069] (3) Soak the glass capillary in piranha solution (98% concentrated sulfuric acid: 30% hydrogen peroxide = 3:1) for 3 hours. Piranha solution has a strong oxidizing property and can remove organic pollutants on the glass surface. In addition, piranha solution can generate a large number of silanol groups (-Si-OH) on the glass surface, increasing the hydrophilicity of the glass surface, which is beneficial to improving the wettability of the glass nanopores with the electrolyte solution.

[0070] (4) To remove the piranha solution, the glass capillary was immersed in deionized water and ultrasonically cleaned five times for 10 minutes each time;

[0071] (5) Soak the glass capillary in anhydrous ethanol and ultrasonically clean it for 20 minutes;

[0072] (6) Soak the glass capillary in deionized water and ultrasonically clean it twice, each time for 10 minutes;

[0073] (7) Place the ultrasonicated glass capillary in a 90°C oven for 4 hours to dry out the moisture on the glass capillary;

[0074] (8) After the dried glass capillary cools to room temperature, it can be used to draw glass nanopores.

[0075] (9) Fix the pretreated glass capillary tube on the guide rail of MODEL P-2000, making sure that both ends of the glass tube are in the grooves on the guide rail;

[0076] (10) Cover the protective cover, enter the corresponding program, and set the corresponding parameters: heat is set to 630, filament value is 4, velocity value is 61, delay value is 150, and pull value is 155;

[0077] (11) After the parameters are set, press the PULL key on the keyboard. The indicator light in the protective cover turns red. After a short delay of a few seconds, the glass capillary is pulled into two identical glass nanopores.

[0078] (12) Inject 100 μL of electrolyte solution into a 1.5 mL centrifuge tube in advance, insert the drawn glass nanopore into the centrifuge tube, and ensure that the tip of the glass nanopore enters the liquid surface;

[0079] (13) The glass nanopore is fixed by a specially made device, and an electrolyte solution is injected into the inner wall of the glass nanopore using an injector;

[0080] (14) The filled glass nanopore was centrifuged at 5000 rpm for 10 min to remove bubbles at the tip of the glass nanopore and ensure that the electrolyte solution fully filled the tip of the quartz glass nanopore.

[0081] Example 3 Glass Slide Modification and Gap DNA Fixation

[0082] 1. Glass modification:

[0083] Glass has good chemical stability and is suitable as a substrate for nanomanipulation experiments. However, the surface of the bare glass substrate is prone to adsorption of nonspecific protein molecules and lacks directional fixation sites for biomolecules. In subsequent nanomanipulation experiments, glass nanopores are used to detect DNA whose bottom is fixed to the glass slide. Therefore, it is necessary to modify the glass substrate so that the DNA scaffold has a fixed site on the glass slide. The specific experimental steps are as follows:

[0084] (1) Place the glass slide into the slot, add Decon90 solution, and soak the glass slide overnight. Decon90 is an alkaline cleaning solution that can remove organic residues, inorganic salt deposits, and biological contaminants on the surface of the glass slide.

[0085] (2) Ultrasonicate in a staining jar containing Decon90 for 10 minutes, rinse the glass slide with ddH2O, and then ultrasonicate in ddH2O twice for 10 minutes each time to rinse;

[0086] (3) Acetone is effective in removing organic pollutants. Use acetone to clean the glass surface again. Because acetone is volatile, add enough acetone to cover the glass. Ultrasonicate for 30 minutes and rinse with water.

[0087] (4) Add methanol to the staining jar until the glass slide is covered, ultrasonicate for 30 minutes, rinse with water, drain as much water as possible, and place in a 90°C oven to evaporate all the water on the surface of the glass slide;

[0088] (5) Place the glass slide in piranha solution (98% concentrated sulfuric acid: 30% hydrogen peroxide = 3:1) and incubate in a 90°C oven for 2 hours. Rinse the slide and drain as much water as possible. Remove the slide and blow dry with nitrogen.

[0089] (6) Place the glass slide in sodium ethoxide (35 mL of anhydrous ethanol, 15 mL of ddH2O, 2 g of NaOH, and ultrasonically accelerate the dissolution of NaOH) and ultrasonicate for 15 minutes. Then place it in ddH2O and ultrasonicate for 15 minutes. Rinse the glass slide with water, blow dry it with high-purity nitrogen, and place it in a staining jar. Sodium ethoxide is a strong alkaline reagent that not only cleans the glass but also activates the glass surface. The main component of glass is silicon dioxide, and the surface contains a large number of silanol groups (-Si-OH). The alkalinity of sodium ethoxide can promote the deprotonation of silanol groups to form more -Si-O-, thereby enhancing the reaction activity of the surface and providing active sites for APTES silanization.

[0090] (7) 3-Aminopropyltriethoxysilane (APTES) treatment: 29 mL of methanol, 1.5 mL of acetic acid, and 0.3 mL of APTES were mixed and added to the staining jar, sealed with Parafilm sealing film, incubated at room temperature for 1 hour, ultrasonicated with ddH2O for 5 minutes, and the glass slide was removed and blown dry with high-purity nitrogen. APTES is a silane coupling agent that can introduce amino groups (-NH2) on the surface of the glass substrate. The ethoxy group (-OCH2CH3) of APTES will undergo a hydrolysis-condensation reaction with the silanol group on the glass surface to form a Si-O-Si bond, thereby fixing the amino group on the glass surface. After the sodium ethoxide treatment, the glass surface has more activated hydroxyl groups, which is more conducive to the binding of APTES;

[0091] (8) PEG treatment: 10 glass slides were treated at a time. 300 μL of 100 mM NaHCO3, which had been sterilized at high temperature, was used to dissolve 30 mg of methoxypolyethylene glycol succinimidyl ester (mPEG-SVA) and 1 mg of Biotin-PEG-NHS. PEG-SVA and Biotin-PEG-NHS reacted with the amino groups through NHS ester to form a covalent bond, thereby fixing PEG and biotin on the glass surface. In a container filled with ddH2O, two glass slides were sandwiched with 50 μL of the mixed PEG solution to form a pair. The mixture was incubated in a clean bench at room temperature in the dark for 2 hours. This completed the modification of the glass substrate, facilitating the subsequent fixation of the double-stranded DNA scaffold on the glass slide.

[0092] 2. DNA fixation:

[0093] After the glass substrate is modified, streptavidin is modified on the glass slide. The DNA scaffold is fixed to the glass slide through the high affinity and strong specific binding properties of biotin at the 5' end of the double-stranded DNA scaffold and streptavidin. The interaction between biotin and streptavidin is the strongest non-covalent bond known to date. This binding system has excellent stability and highly specific recognition ability and is not easily affected by multiple interfering factors such as reagent concentration fluctuations, changes in external environmental conditions, pH gradient changes, or chemical denaturants and organic solvents. There are four biotin-binding sites on streptavidin

[104] . The double-stranded DNA is fixed to the glass slide through the specific binding between the two.

[0094] This experiment used glass slides with a PEG:Biotin ratio of 30:1 (mPEG-SVA:Biotin-PEG-NHS = 30:1). The specific experimental steps are as follows:

[0095] (1) Wash the PEG-modified glass slide with fresh deionized water;

[0096] (2) Drop 10 μL of 10 μg / mL streptavidin on a glass slide, cover the glass slide with another PEG-modified glass slide from one edge, avoid and remove bubbles as much as possible, and incubate at room temperature for 15 minutes;

[0097] (3) Rinse again with deionized water several times to remove excess streptavidin on the glass slide;

[0098] (4) Preparation of protein samples for nanomanipulation detection;

[0099] (5) Wash off excess unbound DNA on the glass slide with 1% PBS solution;

[0100] (6) Place the glass slide in a culture dish filled with buffer solution for subsequent nanomanipulation testing.

[0101] Example 4 CEA protein sample detection

[0102] The nanomanipulation system consists of three main modules (such as Figure 1 As shown): probe module, displacement control module and signal acquisition module.

[0103] The probe module primarily consists of a glass nanopore, a holder for securing the nanopore, a glass slide modified with the double-stranded DNA scaffold, and a stage filled with an electrolyte buffer solution. The quartz glass nanopore serves as a probe for capturing the double-stranded DNA scaffold and nanomanipulation. Its tip is filled with electrolyte buffer solution and mounted on a pre-designed holder, allowing the nanopore to be fixed and aligned directly in the center of the stage. The double-stranded DNA scaffold is bound to the surface of a polyethylene glycol-modified quartz glass substrate via a sandwich reaction involving biotin-streptavidin-biotin binding. The polyethylene glycol effectively prevents the DNA molecules from adsorbing to the glass surface due to electrostatic interactions.

[0104] The displacement control module consists of a three-axis motorized stage and a piezoelectric system. The three-axis motorized stage roughly controls the relative position between the glass slide and the glass nanopore at the micrometer level, while the piezoelectric system precisely controls the capture and manipulation of DNA molecules by the glass nanopore with nanometer-level movement accuracy.

[0105] The signal acquisition system consists of a patch-clamp signal amplifier and a digital-to-analog converter. These components are connected to the glass nanopore and the glass patch via Ag / AgCl electrodes in an electrolyte buffer solution. A Faraday cage shields the system from external electromagnetic noise. All equipment is placed on a vibration-proof table to minimize the impact of physical vibrations on nanomanipulation of the glass nanopore.

[0106] 1. Sample preparation for nanomanipulation detection of CEA:

[0107] 5 μL of 1.6 μM CEA protein solution with an amino acid sequence as shown in SEQ ID NO: 5, 1 μL of 2 μM S5CEA (5'-TCAGCGAATTCACTGATCGTCGGGATGACAGCCCTCCTCCATACCAGCTTATTCAATT-3': SEQ ID NO: 3) solution, wherein the CEA aptamer sequence in S5CEA is ATACCAGCTTATTCAATT (SEQ ID NO: 11), and 1 μL of 2 μM S3AFP (5'-TCAGCGGATCCAGTGCTTGCCGCGATGACGACCTCCTCCGTGACGCTCCTAACGCTGACTCAGGTGCAGTTCTCGACTCGGTCTTGATGTGGGTCCTGTCCGTCCGAACCAATC-3': SEQ ID NO:4) solution, wherein the AFP aptamer sequence in S3AFP is GTGACGCTCCTAACGCTGACTCAGGTGCAGTTCTCGACTCGGTCTTGATGTGGGTCCTGTCCGTCCGAACCAATC (SEQ ID NO:12); 3 μL of 10 nM B4-Gap solution, 1 μL of 10 mM EDTA solution, and 4 μL of 1xPBS solution were mixed and incubated at 37°C for 2 hours. The double-stranded DNA scaffold solution was evenly dropped onto a glass slide, which was covered with Parafilm sealing film to avoid and expel bubbles as much as possible, and incubated at room temperature for 1.5 hours. The aptamer binds to the protein mainly through electrostatic attraction and hydrogen bonds, and simultaneously forms a tertiary structure, binding to the target protein molecule with high specificity and high affinity.

[0108] 2. Nanopore Capture: Data were recorded using Clampex software with the "gap-free" mode selected. The culture dish with the glass slide was fixed to the sample stage, and the glass nanopore was fixed directly above the glass slide. The patch clamp system was connected via an Ag / AgCl electrode, with a 300mV bias voltage output at the trans end. The sampling frequency was set to 25kHz, the low-pass filter frequency to 1kHz, the step size of the piezoelectric ceramic motor to 5nm / ms, the delay to 100ms, and the actual motor movement speed to 50nm / s. The displacement of the glass nanopore was controlled by nanomanipulation technology and gradually approached the glass slide. When the glass nanopore entered the 2M LiCl, 10mM Tris, pH 7.4 buffer solution above the glass slide, the patch clamp system collected a stable ionic current. The distance between the nanopore and the glass slide was controlled to reach the critical point. The nanomanipulation system was then used to scan a 5μm×5μm plane around the critical point until the double-stranded DNA was successfully captured.

[0109] 3. Protein molecule recognition: Use a nanomanipulation system to slowly move the glass nanopore upward from the bottom of the double-stranded DNA. After detecting the protein molecule, the data is processed and the time it takes for the protein molecule to pass through the nanopore, the amplitude of the ion current change, and the area of ​​the ion current trajectory change are analyzed.

[0110] The target ion current trajectory was filtered using the built-in Bessel filter of the Clampfit software to reduce interference, with a filtering frequency of 2.5 Hz.

[0111] Calculate the area of ​​the region where the ionic current trajectory (after Bessel filtering) changes when a structure or substance passes through the tip of a glass nanopore. Because the data is discrete and the trajectory is an irregular curve that is not closed, Matlab's built-in polyarea function is used to calculate the area of ​​the closed region formed by the ionic current trajectory curve when detecting substances in nanomanipulation.

[0112] Before calculating the area, the data range needs to be determined. A certain percentage change in the baseline before and after the structure or substance enters the glass nanopore is used as a benchmark, representing the starting point of the structure or substance's passage through the nanopore tip. The ion current trajectory data, including the time and corresponding ion current amplitude, is exported from the Clampfit software. The current trajectory begins with a period of steady current before the structure or substance passes through the nanopore tip and ends with a period of steady current after it exits the nanopore, with the time periods arranged in ascending order. Therefore, data filtering is necessary. A program was written using Matlab to take the average of the first 10% of the steady current data before the structure or substance entered the glass nanopore and the last 10% of the steady current data after the structure or substance left the nanopore as the baseline current amplitude, recorded as A and B respectively. A and B were then multiplied by a certain percentage, recorded as C and D respectively. The data starting from the first 10% of the data and ending at the first value equal to C was deleted, and the data from the last 10% of the data to the first D was deleted. While deleting the data, it was ensured that the time of the data left at the end started from 0, that is, after cutting off the head and tail and taking the middle, the ionic current trajectory data of the structure or substance from entering to leaving the glass nanopore was obtained.

[0113] Based on the noise of the ionic current, a baseline drop of 0.01% before and after CEA enters the glass nanopore was used as the starting point for CEA to enter the nanopore tip. Using the time and current from the time CEA passes through the glass nanopore as the baseline, the time it takes for CEA to pass through the glass nanopore tip is 15.96s, the area of ​​the ionic current trajectory change when CEA passes through the glass nanopore tip is 110.54, the ionic current blockade amplitude is 24.61pA, and ΔI / IO = 0.46%. Figure 3 As shown in the figure, the area of ​​the ion current trajectory change when CEA enters the glass nanopore tip is 110.54.

[0114] Based on the noise of the ionic current, a 0.01% drop in the baseline before and after CEA detachment from the glass nanopore was used as the starting point for CEA detachment from the nanopore tip. Using the time and current from the time CEA passes through the glass nanopore as the starting point, the time it takes for CEA to pass through the glass nanopore tip is 16.56 s, the ionic current blockade amplitude is 23.27 pA, and ΔI / IO = 0.41%. Figure 3 As shown, the area of ​​the ion current trajectory change region when CEA detaches from the glass nanopore tip is 90.58.

[0115] Combine Figure 2 It can be seen that in the nanomanipulation detection, the entry and exit of CEA into the glass nanopores are highly symmetrical and consistent.

[0116] Example 5 AFP protein sample detection

[0117] 1. Sample preparation for AFP nanomanipulation detection:

[0118] 3 μL of 3.8 μM AFP protein solution, the amino acid sequence of which is shown in SEQ ID NO: 6, 1 μL of 2M S5CEA (5'-TCAGCGAATTCACTGATCGTCGGGATGACAGCCCTCCTCCATACCAGCTTATTCAATT-3': SEQ ID NO: 3), the CEA aptamer sequence in S5CEA is ATACCAGCTTATTCAATT (SEQ ID NO: 11), and 1 μL of 2 μM S3AFP

[0119] (5'-TCAGCGGATCCAGTGCTTGCCGCGATGACGACCTCCTCCGTGACGCTCCTAACGCTGACTCAGGTGCAGTTCTCGACTCGGTCTTGATGTGGGTCCTGTCCGTCCGAACCAATC-3': SEQ ID NO: 4), the AFP aptamer sequence in S3AFP is

[0120] GTGACGCTCCTAACGCTGACTCAGGTGCAGTTCTCGACTCGGTCTTGATGTGGGTCCTGTCCGTCCGAACCAATC (SEQ ID NO: 12), 3 μL of 10 nM B4-Gap, 1 μL of 10 mM EDTA, and 4 μL of 1x PBS were mixed and incubated at 37°C for 2 hours. The double-stranded DNA scaffold solution was evenly dropped onto a glass slide, which was covered with Parafilm sealing film to avoid and expel bubbles as much as possible. The aptamer was incubated at room temperature for 1.5 hours. The aptamer binds to the protein mainly through electrostatic attraction and hydrogen bonds, and forms a tertiary structure, binding to the target protein molecule with high specificity and high affinity.

[0121] 2. Nanopore Capture: Data were recorded using Clampex software with the "gap-free" mode selected. The culture dish with the glass slide was fixed to the sample stage, and the glass nanopore was fixed directly above the glass slide. The patch clamp system was connected via an Ag / AgCl electrode, with a 300mV bias voltage output at the trans end. The sampling frequency was set to 25kHz, the low-pass filter frequency to 1kHz, the step size of the piezoelectric ceramic motor to 5nm / ms, the delay to 100ms, and the actual motor movement speed to 50nm / s. The displacement of the glass nanopore was controlled by nanomanipulation technology and gradually approached the glass slide. When the glass nanopore entered the 2M LiCl, 10mM Tris, pH 7.4 buffer solution above the glass slide, the patch clamp system collected a stable ionic current. The distance between the nanopore and the glass slide was controlled to reach the critical point. The nanomanipulation system was then used to scan a 5μm×5μm plane around the critical point until the double-stranded DNA was successfully captured.

[0122] 3. Protein molecule recognition: Use a nanomanipulation system to slowly move the glass nanopore upward from the bottom of the double-stranded DNA. After detecting the protein molecule, the data is processed and the time it takes for the protein molecule to pass through the nanopore, the amplitude of the ion current change, and the area of ​​the ion current trajectory change are analyzed.

[0123] The target ion current trajectory was filtered using the built-in Bessel filter of the Clampfit software to reduce interference, with a filtering frequency of 2.5 Hz.

[0124] Calculate the area of ​​the region where the ionic current trajectory (after Bessel filtering) changes when a structure or substance passes through the tip of a glass nanopore. Because the data is discrete and the trajectory is an irregular curve that is not closed, Matlab's built-in polyarea function is used to calculate the area of ​​the closed region formed by the ionic current trajectory curve when detecting substances in nanomanipulation.

[0125] Before calculating the area, the data range needs to be determined. A certain percentage change in the baseline before and after the structure or substance enters the glass nanopore is used as a benchmark, representing the starting point of the structure or substance's passage through the nanopore tip. The ion current trajectory data, including the time and corresponding ion current amplitude, is exported from the Clampfit software. The current trajectory begins with a period of steady current before the structure or substance passes through the nanopore tip and ends with a period of steady current after it exits the nanopore, with the time periods arranged in ascending order. Therefore, data filtering is necessary. A program was written using Matlab to take the average of the first 10% of the steady current data before the structure or substance entered the glass nanopore and the last 10% of the steady current data after the structure or substance left the nanopore as the baseline current amplitude, recorded as A and B respectively. A and B were then multiplied by a certain percentage, recorded as C and D respectively. The data starting from the first 10% of the data and ending at the first value equal to C was deleted, and the data from the last 10% of the data to the first D was deleted. While deleting the data, it was ensured that the time of the data left at the end started from 0, that is, after cutting off the head and tail and taking the middle, the ionic current trajectory data of the structure or substance from entering to leaving the glass nanopore was obtained.

[0126] Based on the noise of the ionic current, a baseline drop of 0.01% before and after the AFP enters the glass nanopore was used as the starting point for the AFP to enter the nanopore tip. The time and current when the AFP passes through the glass nanopore were used as the baseline. The time when the AFP passes through the glass nanopore tip is 13.61s, the ionic current blockade amplitude is 55.65pA, and ΔI / IO = 1.06%. Figure 5 As shown, the area of ​​the ion current trajectory change region when AFP enters the glass nanopore tip is 145.26.

[0127] Based on the noise of the ionic current, a baseline drop of 0.01% before and after the AFP leaves the glass nanopore was used as the starting point of the AFP's departure from the nanopore tip. Using the time and current when the AFP passes through the glass nanopore as the benchmark, the time it takes for the AFP to pass through the glass nanopore tip is 13.63s, the area of ​​the ionic current trajectory change when the AFP passes through the glass nanopore tip is 94.95, the ionic current blockade amplitude is 55.60pA, and ΔI / IO = 1.06%. Figure 5 As shown, the area of ​​the ion current trajectory change region when AFP passes through the glass nanopore tip is 94.95.

[0128] Combine Figure 4 It can be seen that in the nanomanipulation detection, the situation of AFP entering and exiting the glass nanopore has high symmetry and consistency.

[0129] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not limiting. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention can be modified or replaced by equivalents without departing from the purpose and scope of the technical solutions, which should all be included in the scope of the claims of the present invention.

Claims

1. A protein detection system based on glass nanopores and nanomanipulation, characterized by: The protein detection system includes a DNA chip and a glass nanopore. The glass surface of the DNA chip is connected to double-Gap double-stranded DNA, which contains two segments of Gap single-stranded sequences. The Gap single-stranded sequences bind to the protein to be detected through an aptamer. The inner wall diameter of the glass nanopore is 10-17nm. The glass nanopore is connected to the positive electrode of the patch clamp, and the nanopore is filled with an electrolyte buffer solution. The negative electrode is placed in the DNA chip solution. The glass nanopore is moved by a nanomanipulation platform to capture and detect the double-Gap double-stranded DNA and protein.

2. The protein detection system based on glass nanopore and nanomanipulation according to claim 1, characterized in that: The nucleic acid sequence of the double-Gap double-stranded DNA is shown in SEQ ID NO: 2, and the nucleic acid sequences of the Gap complementary strands are shown in SEQ ID NO: 7 and SEQ ID NO:

8.

3. The method for preparing a protein detection system based on glass nanopores and nanomanipulation according to claim 1, characterized in that: S1: Using circular plasmid PET28-N809 as a template, PCR amplification was performed using a biotin-labeled primer pair to obtain biotin-labeled double-stranded DNA; S2: using Nt.BbvCI enzyme to digest the biotin-labeled double-stranded DNA to form a single-stranded nick at the 5'-CCTCAGC-3' site, and then adding the Gap complementary chain described in claim 2 to promote the shedding of the short chain to generate double-stranded DNA containing double Gap; S3: After the enzyme digestion in step S2, BamHI enzyme was added to double-strand the undigested double-stranded DNA for double-strand cut, and the digestion was carried out at 37°C for 1 hour; S4: Separate and purify double-gap double-stranded DNA by electrophoresis; S5: The glass sheet of the DNA chip is modified with PEG and streptavidin, the 3' or 5' end of the double-Gap double-stranded DNA is modified with biotin, and the double-Gap double-stranded DNA is fixed on the surface of the glass sheet through the specific binding of streptavidin and biotin.

4. The method for preparing a protein detection system based on glass nanopores and nanomanipulation according to claim 3, characterized in that: In step S1, the biotin-labeled primer pair is as follows: the nucleic acid sequence of primer 1 is shown in SEQ ID NO: 9, and the nucleic acid sequence of primer 2 is shown in SEQ ID NO: 10, and the 5' end of primer 1 is biotin-labeled.

5. The method for preparing a protein detection system based on glass nanopores and nanomanipulation according to claim 3, characterized in that: The reaction conditions in step S2 are: 37°C, 3 hours; 90°C, 1 minute; 72°C, 5 minutes; 55°C, 5 minutes; 37°C, 20 minutes; 90°C to 37°C for a total of 4 cycles.

6. The method for preparing a protein detection system based on glass nanopores and nanomanipulation according to claim 3, characterized in that: The nucleic acid sequence of the plasmid PET28-N809 is shown in SEQ ID NO:

1.

7. Use of the protein detection system based on glass nanopore and nanomanipulation according to claim 1 in detecting proteins.

8. Use of the protein detection system based on glass nanopores and nanomanipulation in protein detection according to claim 6, characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO: 5 and SEQ ID NO: 6.

Images