Application of apolipoprotein L2 (APOL2) and modulator thereof

By regulating APOL2 levels and activity, APOL2 regulators are used to enhance the effect of tumor immunotherapy, solving the problem of CD8+ T cell death in tumor treatment, and achieving tumor growth inhibition and improved patient prognosis.

CN120501869APending Publication Date: 2025-08-19INSTITUTE OF BASIC MEDICAL SCIENCES CHINESE ACADEMY OF MEDICAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510639230.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-16
Publication Date
2025-08-19

AI Technical Summary

Technical Problem

There is a lack of drugs or methods for effectively regulating cell death in the prior art, especially in tumor treatment, which leads to the death of CD8+ T cells in the acidic tumor microenvironment, affecting the effect of tumor immunotherapy.

Method used

By regulating the level and activity of apolipoprotein L2 (APOL2), the use of APOL2 modulators to enhance immune cell function in tumor immunotherapy, including the use of APOL2 promoters or inhibitors, to regulate APOL2 expression in tumor cells or immune cells, enhance anti-tumor effects and overcome anti-PD-1/PD-L1 treatment resistance.

Benefits of technology

It improves the effect of tumor immunotherapy, enhances the activity of anti-tumor immune cells, inhibits tumor growth, overcomes the resistance to anti-PD-1/PD-L1 treatment, and improves the prognosis of patients.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005407828550000011
    Figure HDA0005407828550000011
  • Figure HDA0005407828550000012
    Figure HDA0005407828550000012
  • Figure HDA0005407828550000021
    Figure HDA0005407828550000021
Patent Text Reader

Abstract

The present disclosure provides uses of apolipoprotein L2 (APOL2) and modulators thereof. The invention particularly relates to application of an APOL2 modulator in preparation of drugs for immunoregulation, tumor treatment and / or tumor adjuvant therapy. The APOL2 modulator can be used for providing or improving the tumor treatment effect. The disclosure also provides treated immune cells and / or tumor cells with an up-regulated or down-regulated APOL2 level and / or activity, methods of cell treatment, and uses of assessing a subject's response and / or prognosis to tumor immunotherapy and / or selecting a tumor treatment regimen using APOL2 levels and / or activity. Provided herein are novel targets and pathways for tumor treatment.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and medicine. Specifically, the present invention relates to the application of apolipoprotein L2 (APOL2) and its regulators, especially in the prevention and treatment of tumors. Background Art

[0002] Programmed cell death (PCD) is an autonomous, orderly, and genetically controlled form of cell death that is crucial for the development and homeostasis of organisms. Uncontrolled cell death can lead to a variety of human diseases, including cancer, neurodegenerative disorders, autoimmune diseases, and infectious diseases. Targeting the PCD pathway is an important area of anti-tumor drug development. Currently, a number of compounds with anti-tumor activity have been developed by targeting the PCD pathway, including the apoptosis inducer ABT-1992, the necroptosis inducer CBL01373, and the pyroptosis inducer DMB4.

[0003] Cancer cells produce a large amount of lactic acid through aerobic glycolysis, which promotes the formation of an acidic tumor microenvironment and induces CD8 + T cell death. Given that CD8 + The important role of T in tumor immunotherapy is to intervene in CD8 + It is a key regulatory molecule for T cell death and is expected to provide a new strategy for tumor immunotherapy.

[0004] APOL2 belongs to the apolipoprotein L family, which is primarily responsible for lipid transport and has various physiological and pathological functions. For example, APOL1 acts as a trypanolytic factor, leading to trypanosome lysis. APOL3 kills intracellular pathogens by targeting anionic lipids highly enriched on bacterial membranes. APOL6 is a BH3-only protein involved in apoptosis. APOL2 is upregulated by various proinflammatory signaling molecules and participates in various pathological processes. For example, after viral infection, APOL2 can colocalize with mitochondria; TGF-β upregulates APOL2, triggering endoplasmic reticulum stress and contributing to liver fibrosis.

[0005] In summary, there is still an urgent need in the art for drugs that can regulate cell death for the treatment of diseases (especially tumors) or auxiliary drugs that can improve the effects of existing anti-tumor drugs. Summary of the Invention

[0006] This application demonstrates for the first time the correlation between APOL2 and cell death, the tumor microenvironment, and immunotherapy. It also provides information on the role of APOL2 modulators in tumor immunotherapy and their synergistic and even synergistic effects with anti-tumor drugs. This application also provides methods for assessing the efficacy and / or prognosis of tumor immunotherapy based on APOL2 levels. Furthermore, this application provides methods and related products for enhancing immune cell efficacy by modulating APOL2 levels in immune cells.

[0007] In some aspects of the present application, use of an APOL2 modulator in preparing a product for immunomodulation, tumor therapy, and / or adjuvant tumor therapy is provided. In some aspects of the present application, a method for immunomodulation, tumor therapy, and / or adjuvant tumor therapy is provided, comprising administering an APOL2 modulator to a subject in need thereof. In some aspects of the present application, an APOL2 modulator for use in immunomodulation, tumor therapy, and / or adjuvant tumor therapy is provided. In some embodiments, the APOL2 modulator is a small molecule compound that targets APOL2.

[0008] In some embodiments, an APOL2 modulator is an APOL2 promoter that targets tumor cells or the tumor microenvironment. A product containing such an APOL2 modulator can be a drug or pharmaceutical composition for tumor treatment or adjuvant therapy. In some embodiments, such a product is a drug or pharmaceutical composition that contains a PD-1 / PD-L1 inhibitor or is used in combination with a PD-1 / PD-L1 inhibitor. In some embodiments, an APOL2 modulator is a small molecule compound that targets APOL2.

[0009] In some embodiments, the APOL2 modulator is an APOL2 inhibitor targeting anti-tumor immune cells in vivo, and a product comprising the APOL2 modulator can be a drug or pharmaceutical composition for tumor treatment or adjuvant tumor treatment or treatment of immunosuppression-related diseases.

[0010] In some embodiments, the APOL2 modulator is an APOL2 promoter targeting immune cells in vivo, and a product comprising the APOL2 modulator can be a drug or pharmaceutical composition for immunosuppressive therapy. In some embodiments, the product comprising the APOL2 modulator can be used to treat diseases associated with immune hyperactivity (e.g., autoimmune diseases).

[0011] In some embodiments, the APOL2 modulator is an APOL2 inhibitor or promoter for in vitro or ex vivo immune cells, and a product containing the APOL2 modulator can be an immune cell production product for improving the function of the immune cells (eg, anti-tumor).

[0012] In some aspects of the present application, a reagent for determining the level and / or activity of APOL2 in a tumor sample obtained from a subject is provided for use in preparing a kit for assessing the subject's response to tumor immunotherapy and / or prognosis, and / or selecting a tumor immunotherapy regimen. In some aspects of the present application, a method for assessing a subject's response to tumor immunotherapy and / or prognosis, and / or selecting a tumor immunotherapy regimen is provided, the method comprising determining the level and / or activity of APOL2 in a tumor sample obtained from a subject. In some aspects of the present application, a product for measuring the level and / or activity of APOL2 is provided, which is used to assess a subject's response to tumor immunotherapy and / or prognosis, and / or select a tumor immunotherapy regimen.

[0013] In some embodiments, a lower APOL2 level and / or activity in a tumor sample obtained from a subject than a control level indicates that the subject has a poor response and / or prognosis to tumor immunotherapy, or that the tumor immunotherapy regimen used is inadequate; conversely, a higher APOL2 level and / or activity in a tumor sample obtained from a subject than a control level (e.g., the APOL2 level in a paracancerous sample, normal tissue, pre-treatment sample, or non-cancerous subject sample of the subject) indicates that the subject has a good response and / or prognosis to tumor immunotherapy, or that the tumor immunotherapy regimen used is effective.

[0014] In some aspects of the present application, a treated immune cell is provided, wherein the APOL2 level and / or activity in the immune cell is upregulated or downregulated (for example, downregulated to 50%, 40%, 30%, 20%, 10% or 0% of the APOL2 level and / or activity in untreated immune cells).

[0015] In some embodiments, the immune cell is an anti-tumor immune cell for anti-tumor immunotherapy. In some embodiments, the immune cell further comprises an anti-tumor element or has anti-tumor activity, for example, it comprises a tumor-targeting CAR element, a TCR element, or is a tumor infiltrating lymphocyte (TIL) or a cytokine-induced killer cell (CIK).

[0016] In some aspects of the present application, a method for treating an immune cell is provided, the method comprising upregulating or downregulating the level and / or activity of APOL2 in the immune cell by treatment. In some embodiments, the immune cell is an anti-tumor immune cell for anti-tumor immunotherapy.

[0017] Those skilled in the art may arbitrarily combine the above technical solutions and technical features without departing from the inventive concept and protection scope of the present invention. Other aspects of the present invention will be obvious to those skilled in the art due to the disclosure herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] The present invention will be further described below with reference to the accompanying drawings, wherein these drawings are only for illustrating the embodiments of the present invention and are not intended to limit the scope of the present invention.

[0019] Figure 1 :APOL2 is associated with cell death——APOL2 is a mediator of lactate-induced cell death:

[0020] A: CD8 in WT and Apol2 knockout mice (Apol2 KO) + Cell death rate of T cells after 24 h of lactate treatment (****, p≤0.0001);

[0021] B: Cell death rates of vector-expressing and APOL2-knockout Jurkat human T cells after 24 h of lactate treatment (****, p≤0.0001).

[0022] C: Cell death rates of vector and Apol2 KO B16-F10 mouse melanoma cells after 24 h of lactate treatment (****, p≤0.0001).

[0023] D: Cell death rates of vector and APOL2 KO A375 human melanoma cells after 24 h of lactate treatment (****, p≤0.0001).

[0024] Figure 2 Conditional knockout of APOL2 in T cells enhances CD8 + T cell killing ability - CD8 + Knockout of Apol2 in T cells inhibits tumor growth and prolongs survival in mice

[0025] A: Apol2 in B16-F10 melanoma-bearing mice fl / fl and Apol2 fl / fl Cd8 cre Tumor growth curves of mice (**, p≤0.01; ****, p≤0.0001);

[0026] B: Melanoma tumor-bearing Apol2 fl / fl and Apol2 fl / fl Cd8 cre Survival curve of mice (***,

[0027] p≤0.001;);

[0028] C: Melanoma tumor-bearing Apol2 fl / fl and Apol2 fl / fl Cd8 creFigure 3 Immune cell infiltration in tumors of mice (*, p≤0.05; **, p≤0.01).

[0029] Figure 3 :Apol2 knockout enhances the anti-tumor effect of CAR-T cells:

[0030] A: Tumor growth curve of B16-F10-CD19 melanoma-bearing C57BL / 6J mice treated with human CD19-targeted CAR-T cells (CART-19) (**, p≤0.01);

[0031] B: Survival curve of C57BL / 6J mice bearing B16-F10-CD19 melanoma after treatment with CART-19 cells (*, p≤0.05);

[0032] C: Tumor growth curve of B16-F10-CD19 melanoma-bearing NSG mice after treatment with CART-19 cells (***, p≤0.001);

[0033] D: Flow cytometry of CAR-T cell infiltration in B16-F10-CD19 melanoma-bearing NSG mice after treatment with CART-19 cells (****, p≤0.0001).

[0034] Figure 4 :APOL2 expression is positively correlated with cancer patient survival time:

[0035] A: Survival curve analysis of APOL2 expression and survival time of patients with cutaneous melanoma;

[0036] B: Survival curve analysis of APOL2 expression and survival time of patients with invasive breast cancer.

[0037] Figure 5 :Intratumoral delivery of APOL2-overexpressing adenoviral vector inhibits tumor growth and prolongs mouse survival:

[0038] A: Western blot of APOL2 expression in B16-F10 mouse melanoma cells infected with APOL2 adenovirus (Ad-APOL2);

[0039] B: Tumor growth curve of B16-F10 melanoma-bearing mice after treatment with Ad-APOL2 (****, p≤0.0001);

[0040] C: Survival curve of B16-F10 melanoma-bearing mice treated with Ad-APOL2 (***, p≤0.001);

[0041] D: Flow cytometry of immune cell infiltration in tumors of B16-F10 melanoma-bearing mice treated with Ad-APOL2 (*, p≤0.05; **, p≤0.01; ***, p≤0.001).

[0042] Figure 6 :Intratumoral delivery of APOL2-overexpressing adenoviral vector overcomes anti-PD-1 therapy resistance:

[0043] A: Tumor growth curves of B16-F10 melanoma-bearing mice treated with Ad-APOL2 (APOL2 adenovirus) and anti-PD-1 alone or in combination (**, p ≤ 0.01);

[0044] B: Survival curve of B16-F10 melanoma-bearing mice after treatment with Ad-APOL2 and anti-PD-1 alone or in combination (***, p≤0.001). DETAILED DESCRIPTION

[0045] This application demonstrates for the first time the correlation between APOL2 and the tumor microenvironment and immunotherapy, and provides insights into the role of APOL2 inhibitors or promoters in tumor immunotherapy, as well as their potential to enhance and even synergize with anti-tumor drugs. This application also provides methods for predicting the efficacy and prognosis of tumor immunotherapy based on APOL2 levels and / or activity.

[0046] Specifically, in-depth research has revealed that APOL2 is abnormally expressed in tumors. In various solid tumors, elevated APOL2 expression is significantly positively correlated with patient prognosis and survival. Furthermore, we have found that APOL2 mediates the death of various immune cells and tumor cells in both humans and mice. Therefore, inducing tumor cell death by overexpressing APOL2 / Apol2 in cancer cells, or reducing anti-tumor immune cell death by specifically knocking out APOL2 / Apol2 in anti-tumor immune cells (such as CD8+ T cells or anti-tumor CAR-T cells), could have the potential to inhibit tumor growth, overcome resistance to anti-PD-1 / PD-L1 therapy, and enhance the efficacy of CAR-T cells against solid tumors. Furthermore, increasing the level and / or activity of APOL2 in immune cells to enhance immune cell death has the potential to suppress immune-mediated diseases, such as autoimmune diseases.

[0047] All numerical ranges provided herein are intended to expressly include all values falling between the endpoints of the ranges and ranges therebetween. Features described herein or in the embodiments may be combined. All features disclosed herein may be used in any combination, and any feature disclosed herein may be replaced by any alternative feature that serves the same, equivalent, or similar purpose. Therefore, unless otherwise specified, the features disclosed are intended only to be general examples of equivalent or similar features.

[0048] As used herein, “containing,” “having,” or “including” encompasses “comprising,” “mainly consisting of,” “substantially consisting of,” and “consisting of”; “mainly consisting of,” “substantially consisting of,” and “consisting of” are subordinate concepts of “containing,” “having,” or “including.”

[0049] APOL2 gene and its encoded protein (polypeptide)

[0050] As used herein, the terms "APOL2 / Apol2 gene," "APOL2 encoding molecule / sequence," or "APOL2 protein encoding molecule / sequence" are used interchangeably to refer to a sequence encoding the APOL2 protein or polypeptide described herein. The terms "encoding molecule" and "polynucleotide encoding a polypeptide" may encompass a polynucleotide encoding the polypeptide or a polynucleotide further comprising coding and / or non-coding sequences. In some embodiments, the APOL2 encoding molecule may comprise the nucleotide sequence set forth in SEQ ID NO:7 or 8, or a homologous sequence thereof, or may be a derivative polynucleotide derived from such sequences by substitution, deletion, or addition of one or more nucleotides, encoding a polynucleotide having a pro-cell death effect.

[0051] It should be understood that the APOL2 protein referred to herein is preferably obtained from humans or mice. Other APOL2 proteins obtained from other animals that are highly homologous to the human or mouse APOL2 protein (e.g., having a sequence identity of 50% or more, preferably 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, and more preferably 85% or more, such as 85%, 90%, 95%, 98% or even 99% or more) are also within the preferred equivalent scope of the present invention.

[0052] The APOL2 / Apol2 gene herein can be selected, for example, from human APOL2 or mouse Apol2 gene sequences or their CDS sequences, molecules that hybridize to these sequences under stringent conditions, or family gene molecules highly homologous to these molecules. As disclosed herein, expression of these genes in tumor cells promotes tumor cell death. For example, the gene herein can be the human APOL2 gene with gene ID: 23780, or the mouse Apol2 gene with gene ID: 239552.

[0053] As used herein, the term "stringent conditions" refers to: (1) hybridization and elution at relatively low ionic strength and relatively high temperature, such as 0.2×SSC, 0.1% SDS, 60°C; or (2) the addition of a denaturing agent during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42°C; or (3) hybridization occurs only when the identity between two sequences is at least 50%, preferably 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90%, and more preferably 95% or more. For example, the sequence may be the complement of the sequence defined in (a).

[0054] The full-length nucleotide sequences of the genes of the present invention or fragments thereof can generally be obtained by PCR amplification, recombinant methods, or synthetic methods. For PCR amplification, primers can be designed based on the nucleotide sequences disclosed herein, particularly the open reading frame sequences, and commercially available cDNA libraries or cDNA libraries prepared by conventional methods known to those skilled in the art can be used as templates to amplify the relevant sequences. When the sequences are long, two or more PCR amplifications are often required, followed by splicing the fragments amplified in the correct order.

[0055] It should be understood that the genes of the present invention are preferably obtained from humans or mice. Other genes obtained from other animals that are highly homologous to the human APOL2 or mouse Apol2 genes, for example, having a sequence identity of 40% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, and more preferably 85% or more, such as 85%, 90%, 95%, 98%, or even 99% or more, and having similar functions and activities to the APOL2 proteins encoded by the human or mouse genes, are also preferably considered equivalent to the present invention. Methods and tools for comparing sequence identity are also well known in the art, such as BLAST.

[0056] As used herein, the terms "APOL2 (polypeptide)", "APOL2 protein (polypeptide)", and "APOL2" are used interchangeably. APOL2 is a member of the apolipoprotein L family naturally present in the human liver and kidneys, playing an important role in maintaining cholesterol metabolism, lipid transport, and lipid metabolism. This application discloses for the first time the correlation between the APOL2 polypeptide and cell death, thereby providing methods and products for treating cancer or improving immune function by regulating APOL2 polypeptide levels in cells.

[0057] The APOL2 protein may be encoded by the human APOL2 gene sequence or its CDS sequence, or may be a homologous sequence thereof (for example, a homologous sequence of APOL2 may be obtained through databases or alignment software known in the art), a variant or a modified form thereof having the same cell death-promoting effect.

[0058] For example, the APOL2 protein can be selected from: (a) a protein encoded by the aforementioned human APOL2 or mouse Apol2 gene sequence or its CDS sequence, or a homologous sequence thereof; (b) a polypeptide having the amino acid sequence set forth in SEQ ID NO: 5 or 6, or a homologous sequence thereof; or (c) a derivative protein or polypeptide having a cell death-promoting effect by substitution, deletion, or addition of one or more amino acids in the amino acid sequence defined in (a) and (b). In some embodiments, the APOL2 protein can be the human APOL2 protein with uniprot ID Q9BQE5, or a homologous protein thereof. In some embodiments, the APOL2 protein can be the mouse APOL2 protein with uniprot ID A2VDH7, or a homologous protein thereof.

[0059] It should be understood that the APOL2 protein referred to herein is preferably obtained from humans or mice. Other APOL2 proteins obtained from other animals that are highly homologous to the human or mouse APOL2 protein (e.g., having a sequence identity of 50% or more, preferably 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, and more preferably 85% or more, such as 85%, 90%, 95%, 98% or even 99% or more) are also within the preferred equivalent scope of the present invention.

[0060] APOL2 regulators

[0061] The present application relates to APOL2 modulators, which include substances that can positively regulate the level or activity of APOL2 protein or its encoding molecule (promoters) or negatively regulate the level or activity of APOL2 protein (promoters). In a broad sense, the term APOL2 modulator also includes various technologies and methods related to the regulation of APOL2 level and / or activity.

[0062] Inhibitors of APOL2 protein or its encoding molecule

[0063] This application refers to "inhibitors" of APOL2 or its encoding molecules. As used herein, the terms "inhibitor," "inhibitor," "inhibitor / substance of APOL2 or its encoding molecules," or "substance having an inhibitory effect on APOL2 protein" are used interchangeably to refer to substances that can reduce or even eliminate the level or activity of APOL2 protein or its encoding molecules.

[0064] APOL2 inhibitors can regulate APOL2 at various levels, such as the gene level, transcriptional level, post-transcriptional level, translational level, and / or post-translational level. In some embodiments, APOL2 inhibitors include, but are not limited to, antibodies, siRNA, shRNA, miRNA, antisense oligonucleotides, gene knockout tools (such as various methods and guide RNA for CRISP / Cas knockout), protein degraders, and small molecule chemical antagonists or blockers targeting APOL2 or its encoding molecules. Broadly speaking, the term also includes various methods for reducing APOL2 levels or activity, such as gene interference, gene silencing, and expression inhibition at the transcriptional and post-translational levels using post-translational modifications or epigenetic regulation, as well as inhibition of APOL2 enzymatic function using enzyme activity inhibitors.

[0065] Specific inhibitors of APOL2 can be designed and obtained based on its sequence and structural characteristics, such as designing and obtaining siRNA, shRNA, and antisense oligonucleotides targeting the APOL2 gene; gRNA for CRISP / Cas; screening and obtaining antibodies targeting the APOL2 protein, etc.

[0066] In some embodiments, siAPOL2 molecules or derivatives thereof targeting APOL2 can be used. In some embodiments, gRNA targeting APOL2 can be used to knock out the APOL2 gene via CRISP / Cas manipulation, wherein the gRNA can have one or more sequences selected from the group consisting of SEQ ID NO: 1, 2, 3, or 4. In some embodiments, monoclonal antibodies or derivatives thereof targeting APOL2 can be obtained using conventional methods, such as chimeric antibodies, humanized antibodies, human antibodies, antibody fragments, and multivalent antibodies targeting APOL2.

[0067] APOL2 inhibitors can be designed and / or obtained, and their effects verified, using commonly used websites, databases, suppliers, or methods known in the art.

[0068] According to the present application, APOL2 inhibitors can reduce target cell death by inhibiting APOL2, thereby enhancing the function of the target cells. For example, using an APOL2 inhibitor or method to reduce APOL2 expression in anti-tumor immune cells can reduce anti-tumor immune cell death, thereby enhancing their anti-tumor effects and even producing a synergistic therapeutic effect with other anti-tumor active substances.

[0069] As used herein, the term "synergistic effect" refers to the combined action of one or more tumor therapeutic agents and at least one APOL2 inhibitor disclosed herein to produce a simple additive effect that is greater than the effect of each agent administered alone. Synergistic effects can be calculated using appropriate methods, such as the Sigmoid-Emax equation (Holford, NHG and Scheiner, LB, Clin. Pharmacokinet. 6:429-453 (1981)), the Loewe additivity equation (Loewe, S. and Muischnek, H., Arch. Exp. Pathol Pharmacol. 114:313-326 (1926)), and the median effect equation (Chou, TC and Talalay, P., Adv. Enzyme Regul. 22:27-55 (1984)). Each of these equations can be applied to experimental data to generate corresponding graphs to assist in evaluating the efficacy of drug combinations. Corresponding graphs associated with the above equations include concentration-effect curves, isobolograms, and combination index curves.

[0070] Promoter of APOL2 protein or its encoding molecule

[0071] This application refers to "promoters" of APOL2 or its encoding molecules. As used herein, the terms "promoter," "enhancer," "promoter of APOL2 or its encoding molecule," or "substance that has a promoting effect on APOL2 protein" are used interchangeably to refer to substances that can increase the level or activity of APOL2 or its encoding nucleic acid molecule.

[0072] APOL2 promoters can regulate APOL2 at various levels, such as the gene level, transcriptional level, post-transcriptional level, translational level, and / or post-translational level. In some embodiments, promoters useful in the present disclosure include, but are not limited to: exogenous APOL2 polypeptides; APOL2 expression or overexpression vectors and / or RNA; host cells containing APOL2 expression or overexpression vectors; naked DNA and / or RNA containing APOL2 coding sequences; liposome-encapsulated DNA and / or RNA encoding APOL2 molecules; APOL2 precursor proteins, conjugates, or complexes that can be converted to APOL2 in vivo; and chemical small molecule activators. Broadly speaking, the term also encompasses various means of increasing APOL2 levels or activity, such as gene activation, gene overexpression, and expression promotion at the transcriptional and post-translational levels using post-translational modifications or epigenetic regulatory approaches.

[0073] Specific promoters of APOL2 can be designed and obtained based on the sequence and structural characteristics of APOL2, for example, overexpression vectors and saRNA targeting the APOL2 gene can be designed and obtained.

[0074] In some embodiments, saAPOL2 molecules or derivatives thereof targeting APOL2 may be used. In some embodiments, expression or overexpression vectors targeting APOL2 may be used. APOL2 expression or overexpression vectors may include, but are not limited to, bacterial plasmids, bacteriophages, yeast plasmids, animal cell viruses, mammalian cell virus vectors, such as adenovirus expression vectors. In some embodiments, chemical small molecule agonists targeting APOL2 may be used.

[0075] APOL2 promoters can be designed and / or obtained, and their effects verified, using commonly used websites, databases, suppliers, or methods known in the art.

[0076] According to the present application, APOL2 promoters can increase target cell death by increasing APOL2 levels and / or activity, thereby treating hyperproliferative diseases associated with target cells. For example, increasing APOL2 expression in tumor cells using an APOL2 promoter or method can increase tumor cell death, thereby exerting an anti-tumor effect and even producing a synergistic therapeutic effect with other anti-tumor active substances.

[0077] Vectors, hosts, and transgenic animals

[0078] The present disclosure also relates to a vector comprising the Apol2 gene, a host cell produced by genetic engineering using the vector, and a transgenic animal highly expressing APOL2 obtained by gene transfer.

[0079] The coding sequence disclosed herein can be used to express or produce recombinant APOL2 protein using conventional recombinant DNA technology (Science, 1984; 224: 1431). Generally, the following steps are involved:

[0080] (1) transforming or transducing a suitable host cell with the polynucleotide encoding the APOL2 protein (or variant) disclosed herein, or with a recombinant expression vector containing the polynucleotide;

[0081] (2) host cells cultured in a suitable culture medium;

[0082] (3) Isolate and purify proteins or peptides from culture medium or cells.

[0083] The recombinant vector, host cell, or APOL2 protein produced therefrom can also be administered to a subject in need thereof to alter the level of APOL2 encoding molecules or APOL2 protein in the subject.

[0084] In this disclosure, the terms "vector" and "recombinant expression vector" are used interchangeably to refer to bacterial plasmids, bacteriophages, yeast plasmids, animal cell viruses, mammalian cell viruses, or other vectors well known in the art. The term is used broadly to encompass both expression vectors and overexpression vectors, unless the context clearly indicates that only one or more expression vectors are being referred to. Various plasmids and vectors capable of replication and stability in a host can be used. An important feature of an expression vector is that it typically contains an origin of replication, a promoter, a marker gene, and translation control elements.

[0085] Methods well known to those skilled in the art can be used to construct expression vectors containing the APOL2 coding sequence and appropriate transcriptional / translational control signals. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombination techniques, and the like. The DNA sequence can be operably linked to an appropriate promoter in the expression vector to direct mRNA synthesis. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.

[0086] In addition, the expression vector preferably contains one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green fluorescent protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for Escherichia coli.

[0087] Vectors containing the appropriate DNA sequences described above and appropriate promoters or control sequences can be used to transform appropriate host cells to express proteins or polypeptides. Host cells can be prokaryotes, such as bacterial cells; lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as animal cells. Representative examples include Escherichia coli, Streptomyces, and Agrobacterium; fungal cells, such as yeast; and animal cells. In the present disclosure, mammalian cells are preferably used, such as HEK293 cells, CHO cells, NSO cells, BHK cells, and PER-C6 cells.

[0088] When the polynucleotides of the present disclosure are expressed in higher eukaryotic cells, transcription can be enhanced if an enhancer sequence is inserted into the vector. Enhancers are cis-acting DNA elements, typically about 10 to 300 base pairs, that act on promoters to increase gene transcription. Those skilled in the art are well aware of how to select appropriate vectors, promoters, enhancers, and host cells.

[0089] In the present disclosure, the terms "transgenic animals" or "transformed animals" are used interchangeably, and both refer to cells, organs, tissues or individuals that have been obtained by transgenic methods and into which the Apol2 gene of the present disclosure has been transferred and whose expression has been regulated.

[0090] The recombinant polypeptide in the above method can be expressed intracellularly or on the cell membrane or secreted extracellularly. If necessary, the recombinant protein can be isolated and purified by various separation methods utilizing its physical, chemical, and other properties. These methods are well known to those skilled in the art. Examples of these methods include, but are not limited to, conventional renaturation treatment, treatment with a protein precipitant (salting out method), centrifugation, osmotic sterilization, ultrafiltration, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography, and various other liquid chromatography techniques and combinations of these methods.

[0091] Drug, pharmaceutical composition or kit

[0092] Also provided herein is a medicament, pharmaceutical composition, or kit comprising an effective amount of an APOL2 modulator of the present invention and a pharmaceutically or immunologically acceptable carrier. As used herein, the term "active substance" refers to a modulator of the APOL2 protein or APOL2 gene or a precursor thereof, as well as other drugs that work together with the modulator to exert a therapeutic effect (e.g., an anti-tumor effect).

[0093] As used herein, the terms "comprising" or "including" encompass "including," "consisting essentially of," and "consisting of." As used herein, the term "pharmaceutically acceptable" ingredients are substances that are suitable for use in humans and / or animals without excessive adverse side effects (such as toxicity, irritation, and allergic reactions), that is, substances with a reasonable benefit / risk ratio. As used herein, the term "effective amount" refers to an amount that can produce a function or activity in humans and / or animals and is acceptable to humans and / or animals.

[0094] As used herein, the term "pharmaceutically acceptable carrier" refers to a carrier for administering a therapeutic agent, including various excipients and diluents. The term refers to pharmaceutical carriers that are not themselves essential active ingredients and are not unduly toxic upon administration. Suitable carriers are well known to those of ordinary skill in the art. A comprehensive discussion of pharmaceutically acceptable excipients can be found in Remington's Pharmaceutical Sciences (Mack Pub. Co., NJ 1991).

[0095] The pharmaceutically acceptable carrier in the composition may contain a liquid such as water, saline, glycerol, and ethanol. In addition, these carriers may also contain auxiliary substances such as fillers, disintegrants, lubricants, glidants, effervescent agents, wetting agents or emulsifiers, flavoring agents, pH buffering substances, etc. Generally, these substances can be formulated in a non-toxic, inert, and pharmaceutically acceptable aqueous carrier medium, wherein the pH is generally about 5-8, preferably, about 6-8.

[0096] The active substance in the composition of the present invention accounts for 0.001-99.9 wt% of the total weight of the composition, preferably 1-95 wt%, more preferably 5-90 wt%, and even more preferably 10-80 wt%, with the remainder being pharmaceutically acceptable carriers and other additives.

[0097] As used herein, the term "unit dosage form" refers to a dosage form for single administration of the composition of the present invention for ease of administration, including but not limited to various solid dosage forms (such as tablets), liquid dosage forms, capsules, and sustained-release dosage forms.

[0098] The effective dosage of an active substance, such as an APOL2 protein or gene modulator, may vary depending on the severity of the condition being administered or treated. The specific dosage is determined based on the individual circumstances of the subject (e.g., weight, age, physical condition, and desired effect), and is within the judgment of a skilled physician.

[0099] The composition of the present invention may be in solid form (e.g., granules, tablets, lyophilized powder, suppositories, capsules, sublingual tablets) or liquid form (e.g., oral solution) or other suitable forms. The administration routes may include: (1) direct naked DNA or protein injection; (2) linking APOL2 cDNA, mRNA, and protein inhibitors to transferrin / poly-L-lysine complexes to enhance their biological effects; (3) forming complexes of DNA, RNA, and protein inhibitors with positively charged lipids to overcome the difficulty of crossing the cell membrane caused by the negative charge of the phosphate backbone; (4) encapsulating DNA, RNA, and protein active substances in liposomes and mediating their entry into cells, which is beneficial for the smooth entry of macromolecules and protects them from hydrolysis by various extracellular enzymes; (5) in vitro transfection of DNA, RNA, and protein active substances into transfer cells (e.g., fibroblasts) can also effectively load APOL2 inhibitor-related drugs into target cells; and (8) electroporation, i.e., introducing DNA, RNA, and proteins into target cells with the help of electric current.

[0100] When the methods and products of the present application are used for tumor treatment or adjuvant therapy, the following approaches can be adopted: (a) using an APOL2 promoter to target (e.g., target) tumor entities, tumor cells or their microenvironment, for example, to increase the APOL2 level and / or activity of tumor cells, thereby inducing tumor cell death; (b) using an APOL2 inhibitor to target (e.g., target) anti-tumor immune cells, such that the APOL2 level of anti-tumor immune cells is reduced or even APOL2 is not expressed, or APOL2 is inactivated, thereby promoting the survival and anti-tumor function of anti-tumor immune cells; (c) using a combination of approaches (a) and (b); or (d) further combining approaches (a), (b) or (c) with other tumor treatment drugs or approaches.

[0101] Method (b) also includes anti-tumor immune cells obtained after treatment with an APOL2 inhibitor, in which APOL2 levels are reduced or even not expressed, or APOL2 is inactivated. The treated anti-tumor immune cells can be used in adoptive cell therapy.

[0102] Other tumor treatment drugs or methods in method (d) may include but are not limited to: commonly used anti-tumor drugs in clinical practice; immune checkpoint inhibitors (ICI), such as PD1 / PDL1 inhibitors, such as PD1 antibodies, pembrolizumab; oncolytic viruses; tumor vaccines; adoptive cell immunotherapy; immunomodulatory drugs targeting T cells; surgery; radiotherapy; traditional Chinese medicine treatment, etc.

[0103] Tumors that can be treated with the methods and products of the present application include, but are not limited to, melanoma, breast cancer, lung cancer (such as non-small cell lung cancer), ovarian cancer, prostate cancer, liver cancer, kidney cancer, intestinal cancer, head and neck cancer, skin cancer, bladder cancer, pancreatic cancer, and non-solid tumors.

[0104] The methods and products of the present application can also be used to treat immune hyperactivity diseases. APOL2 promoters can be used to target (e.g., target) immune cells that cause immune hyperactivity, thereby increasing the APOL2 level or activity of the cells, thereby inducing cell death or weakening their function. Immune hyperactivity diseases may include autoimmune diseases, such as systemic lupus erythematosus, rheumatoid arthritis, scleroderma, hyperthyroidism, juvenile diabetes, idiopathic thrombocytopenic purpura, autoimmune hemolytic anemia, ulcerative colitis, polyneuritis, graft-versus-host disease, psoriasis, atopic dermatitis, etc.

[0105] Tumor immunotherapy response and / or prognosis assessment, regimen selection, and related products

[0106] In some aspects herein, provided is the use of a reagent for determining the level of APOL2 in a sample obtained from a subject in the preparation of a kit for assessing the response and / or prognosis of the subject to tumor immunotherapy.

[0107] In some aspects herein, a method for assessing a subject's response and / or prognosis to tumor immunotherapy is provided, comprising measuring the level of APOL2 protein in a sample obtained from the subject; if the level is lower than a control level, it indicates that the subject's response and / or prognosis to tumor immunotherapy is poor, or the treatment regimen used is inadequate; conversely, the response and / or prognosis is good, or the tumor treatment regimen used is effective.

[0108] The method may include, for example: (a) detecting the expression level and / or activity of APOL2 in a tumor sample of a subject; (b) comparing the APOL2 expression level and / or activity detected in (a) with a control value; and (c) if the detection result shows that the APOL2 level and / or activity in the tumor sample is lower than that of a normal control, it indicates that the subject of the biological sample has a poor response to tumor immunotherapy and / or prognosis and / or is not suitable for tumor treatment using the immunotherapy regimen used; conversely, it indicates that the subject has a good response to tumor immunotherapy and / or prognosis and / or is suitable for tumor immunotherapy using the immunotherapy regimen used.

[0109] In some embodiments, the control level is selected from the group consisting of: APOL2 levels and / or activity in a sample adjacent to the cancerous tissue, normal tissue, pre-treatment sample, or non-cancerous sample from the subject. In some embodiments, the control is selected from the group consisting of: APOL2 levels and / or activity in a healthy subject (e.g., the average level of a healthy population), the subject's own normal tissue (e.g., normal tissue adjacent to a lesion), and previously measured levels in the subject (e.g., before treatment or at a prior stage of treatment). In some embodiments of the present invention, APOL2 DNA levels, mRNA levels, and / or protein levels are measured. In some embodiments of the present invention, APOL2 levels and / or activity are measured using one or more of the following methods: immunohistochemistry, chemiluminescence, radioisotope analysis, fluorescence (e.g., immunofluorescence), enzyme-linked immunosorbent assay, colloidal gold assay, real-time quantitative reverse transcription PCR, biochip assay, Southern blotting, Northern blotting, in situ hybridization, and Western blotting.

[0110] As used herein, the term "detection reagent" refers to a reagent that is specific for the APOL2 molecule and can be used to directly or indirectly detect the presence and / or amount of the molecule.

[0111] Since the sequence of APOL2 is known in the art, those skilled in the art can prepare reagents specific for APOL2 using conventional methods or obtain them commercially. For example, detection reagents useful in the present invention include, but are not limited to, antibodies, probes, gene chips, or protein chips that are specific for APOL2.

[0112] To facilitate detection, the detection reagent of the present invention may also carry a detectable label, which includes but is not limited to: radioactive isotopes, fluorophores, chemiluminescent moieties, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, dyes, metal ions, ligands (such as biotin or haptens), etc.

[0113] As used herein, the term "test product" refers to a product comprising a substance for detecting APOL2 in a biological sample, which can be used to predict a subject's response to tumor immunotherapy, assess a subject's prognosis for tumor immunotherapy, and / or select a tumor immunotherapy regimen. The products of the present invention include, but are not limited to, test kits, test strips, test cards, test pens, test instruments, or any combination thereof. The products of the present invention may further comprise one or more substances selected from the group consisting of a container, a buffer, an adjuvant, a solvent, a positive control, a negative control, and instructions for use.

[0114] Exemplary embodiments of the present application

[0115] The following exemplary embodiments are provided in this application:

[0116] In some aspects, use of an APOL2 modulator in preparing a product for immunomodulation, tumor therapy, and / or adjuvant tumor therapy is provided. In some aspects, a method for immunomodulation, tumor therapy, and / or adjuvant tumor therapy is provided, comprising administering an effective amount of an APOL2 modulator to a subject in need of immunomodulation, tumor therapy, and / or adjuvant tumor therapy. In some aspects, an APOL2 modulator for use in immunomodulation, tumor therapy, and / or adjuvant tumor therapy is provided.

[0117] In some embodiments, the APOL2 modulator is capable of modulating the level and / or activity of APOL2, which is the level and / or activity of an APOL2 polypeptide or a nucleic acid molecule encoding the same.

[0118] In some embodiments, the APOL2 modulator is one or more selected from the group consisting of:

[0119] (a) an APOL2 promoter targeting tumor cells or tumor microenvironment, wherein the APOL2 promoter increases the level and / or activity of APOL2 in tumor cells or tumor microenvironment relative to control tumor cells or tumor microenvironment without APOL2 regulation;

[0120] (b) an APOL2 inhibitor directed against anti-tumor immune cells, wherein the APOL2 inhibitor reduces the level and / or activity of APOL2 in the anti-tumor immune cells relative to control immune cells that are not APOL2-regulated;

[0121] (c) An APOL2 promoter for immune cells, wherein the APOL2 promoter increases the level and / or activity of APOL2 in the immune cells relative to control immune cells not regulated by APOL2.

[0122] In some embodiments, the APOL2 polypeptide is selected from:

[0123] (i) a polypeptide having the amino acid sequence shown in SEQ ID NO: 5 or SEQ ID NO: 6; or

[0124] (ii) a polypeptide that is homologous or has sequence identity to the amino acid sequence of SEQ ID NO: 5 or homologous or has sequence identity to the amino acid sequence of SEQ ID NO: 6 (e.g., greater than 80% homologous or having sequence identity, such as 80%, 85%, 90%, 95%, 98%, 99%), and has the function of the polypeptide described in (i); or

[0125] (iii) A polypeptide in which one or more amino acids are substituted, deleted or added in the amino acid sequence of (i) or (ii), and which has the function of the polypeptide described in (i).

[0126] In some embodiments, the APOL2 encoding molecule is selected from:

[0127] (i') a nucleic acid molecule having the nucleotide sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8; or

[0128] (ii') a molecule that hybridizes under stringent conditions to the nucleotide sequence defined in (i);

[0129] (iii') a nucleic acid molecule that is homologous or has sequence identity (e.g., greater than 80% homologous or having sequence identity, such as 80%, 85%, 90%, 95%, 98%, or 99%) to the nucleotide sequence of SEQ ID NO: 7 or SEQ ID NO: 8, and encodes a protein or polypeptide having cell death-promoting activity;

[0130] (iv') A nucleic acid molecule encoding a protein or polypeptide having cell death-promoting activity, wherein one or more nucleotides are substituted, deleted or added to the nucleotide sequence of (i'), (ii') or (iii').

[0131] In some embodiments, the APOL2 promoter is selected from: a substance that increases the expression level and / or activity of APOL2; for example, the substance is one or more selected from the following group: an exogenous APOL2 polypeptide; an APOL2 expression or overexpression vector; a host cell comprising an APOL2 expression or overexpression vector; naked DNA and / or RNA comprising an APOL2 coding sequence; liposome-encapsulated DNA and / or RNA encoding an APOL2 molecule; an APOL2 precursor protein, conjugate, or complex that can be converted into APOL2 in vivo; a compound that can increase the level and / or function of APOL2 protein in vivo, such as a small molecule compound agonist.

[0132] In some embodiments, the APOL2 inhibitor is selected from: substances that inhibit the expression level and / or activity of APOL2; for example, the substance is one or more substances selected from the following group targeting APOL2 or its encoding nucleic acid molecule: anti-APOL2 antibodies (preferably monoclonal antibodies), gene knockout or knockdown tools, protein degradation tools, APOL2 antagonistic or blocking compounds, such as small molecule compound inhibitors.

[0133] In some embodiments, the APOL2 expression or overexpression vector is selected from bacterial plasmids, bacteriophages, yeast plasmids, animal cell viruses, mammalian cell virus vectors, such as adenovirus expression vectors.

[0134] In some embodiments, the APOL2 gene knockout or knockdown tool is selected from: the CRISP / Cas9 system, for example, a gRNA used in the system, such as an sgRNA selected from the nucleotide sequences shown in SEQ ID NO: 1, 2, 3 and 4; the TALEN system; the ZFN system; the homologous recombination system; siRNA; shRNA; miRNA; and antisense oligonucleotides.

[0135] In some embodiments, the APOL2 modulator is an APOL2 promoter targeting tumor cells or the tumor microenvironment, and the product is a drug or pharmaceutical composition for tumor treatment or adjuvant tumor treatment (for example, the product is a drug or pharmaceutical composition comprising a PD-1 / PD-L1 inhibitor, a chemotherapy drug and / or an oncolytic virus, or a combination of one or more of the foregoing drugs).

[0136] In some embodiments, the APOL2 modulator is an APOL2 inhibitor targeting anti-tumor immune cells in vivo, and the product is a drug or pharmaceutical composition for tumor treatment or adjuvant tumor treatment.

[0137] In some embodiments, the APOL2 modulator is an APOL2 promoter targeting immune cells in vivo, and the product is a drug or pharmaceutical composition for treating immunosuppression (eg, for treating diseases related to immune hyperactivity (eg, inflammatory and autoimmune diseases)).

[0138] In some embodiments, the APOL2 modulator is an APOL2 inhibitor or promoter for in vitro or ex vivo immune cells, and the product is an immune cell production product for improving the function of the immune cells (eg, anti-tumor).

[0139] In some embodiments, the APOL2 modulator is an APOL2 inhibitor that acts on immune cells in vivo or in vitro. Compared with immune cells not treated with the APOL2 inhibitor, the APOL2 level and / or activity in the immune cells treated with the APOL2 inhibitor is reduced, and the immune function of the immune cells is enhanced.

[0140] In some embodiments, the immune cells are selected from: T cells (e.g., αβT cells, γδT cells, NKT cells, Treg cells, Th cells), NK cells, macrophages, and the cells contain or do not contain chimeric antigen receptors (CARs), such as CAR-T cells, CAR-NK cells, and CAR-M cells. In some embodiments, the immune cells are selected from: in vivo immune cells, ex vivo immune cells, and in vitro immune cells; for example, autologous or allogeneic CAR-T cells, TCR-T, or TILs for adoptive cell therapy.

[0141] In some embodiments, the subject of administration of the product of the present application is a mammal or mammalian cells, wherein the mammal is selected from, for example, primates, rodents, livestock, pets, etc., preferably humans, rats, mice, dogs, horses, cows, rabbits, monkeys, apes, and gorillas.

[0142] In some embodiments, the tumor is selected from melanoma, breast cancer, lung cancer (such as non-small cell lung cancer), ovarian cancer, prostate cancer, liver cancer, kidney cancer, colon cancer, head and neck cancer, skin cancer, bladder cancer, pancreatic cancer, and non-solid tumors.

[0143] In some embodiments, the product of the present application further comprises one or more other active ingredients selected from the following group or is used in combination with one or more other active ingredients selected from the following group: chemotherapy, oncolytic virus, anti-tumor vaccine, adoptive cell immunotherapy, immunomodulatory drugs targeting T cells, immune checkpoint inhibitors (ICI), such as PD1 / PDL1 inhibitors (such as anti-PD1 antibodies, pembrolizumab).

[0144] In some embodiments, the product of the present application is suitable for administration by a route selected from the group consisting of: enteral administration, parenteral administration, such as intravenous, mucosal, nasal, intraperitoneal, intracranial, intratumoral, sublingual, buccal, transdermal (such as iontophoresis), etc., for example, administration by a route selected from the group consisting of: direct injection of liposome-encapsulated DNA, gold-coated DNA gene gun bombardment, replication-defective bacteria carrying plasmid DNA, and viral vectors carrying target DNA.

[0145] In some embodiments, the product of the present application is selected from: a drug, a pharmaceutical composition, a kit, a medical device, or a combination thereof.

[0146] In some aspects, a treated immune cell is provided, wherein the level and / or activity of APOL2 in the immune cell is upregulated or downregulated (e.g., downregulated to 50%, 40%, 30%, 20%, 10% or 0% of the level and / or activity of APOL2 in an untreated immune cell).

[0147] In some embodiments, the immune cell is an anti-tumor immune cell for anti-tumor immunotherapy. In some embodiments, the immune cell is selected from: T cells (e.g., αβT cells, γδT cells, NKT cells, Treg cells, Th cells), NK cells, macrophages, and the cells contain or do not contain chimeric antigen receptors (CAR), such as CAR-T cells, CAR-NK cells, and CAR-M cells. In some embodiments, the immune cell is selected from: in vivo immune cells, ex vivo immune cells, and in vitro immune cells; for example, autologous or allogeneic CAR-T cells, TCR-T, or TIL for adoptive cell therapy. In some embodiments, the immune cell is an immune cell for anti-tumor immunotherapy, for example, the immune cell further comprises an anti-tumor element or has anti-tumor activity, for example, it comprises a tumor-targeting CAR element, a TCR element, or is a tumor-infiltrating lymphocyte (TIL) or a cytokine-induced killer cell (CIK).

[0148] In some aspects, a method of treating an immune cell is provided, the method comprising upregulating or downregulating the level and / or activity of APOL2 in the immune cell by treatment (e.g., downregulating to 50%, 40%, 30%, 20%, 10% or 0% of the level and / or activity of APOL2 in an untreated immune cell).

[0149] In some embodiments, the immune cells are selected from: T cells (e.g., αβT cells, γδT cells, NKT cells, Treg cells, Th cells), NK cells, macrophages, and the cells contain or do not contain chimeric antigen receptors (CAR), such as CAR-T cells, CAR-NK cells, and CAR-M cells. In some embodiments, the immune cells are selected from: in vivo immune cells, ex vivo immune cells, and in vitro immune cells; for example, autologous or allogeneic CAR-T cells, TCR-T, or TIL for adoptive cell therapy. In some embodiments, the immune cells are anti-tumor immune cells for anti-tumor immunotherapy, for example, the immune cells further contain anti-tumor elements or have anti-tumor activity, for example, they contain tumor-targeting CAR elements, TCR elements, or are tumor-infiltrating lymphocytes (TIL) or cytokine-induced killer cells (CIK).

[0150] In some embodiments, the treating comprises treating the immune cells with one or more APOL2 modulators described herein.

[0151] In some aspects, a reagent for determining the level and / or activity of APOL2 in a tumor sample obtained from a subject is provided for use in preparing a kit for evaluating the subject's response to tumor immunotherapy and / or prognosis, and / or selecting a tumor immunotherapy regimen. In some aspects, a method for evaluating a subject's response to tumor immunotherapy and / or prognosis, and / or selecting a tumor immunotherapy regimen is provided, the method comprising determining the level and / or activity of APOL2 in a tumor sample obtained from the subject. In some aspects, a reagent or product for testing the level and / or activity of APOL2 for evaluating the subject's response to tumor immunotherapy and / or prognosis, and / or selecting a tumor immunotherapy regimen is provided.

[0152] In some embodiments, the sample is selected from a subject's tumor tissue or tumor cells. In some embodiments, a lower APOL2 level and / or activity in a tumor sample obtained from a subject than a control level indicates that the subject has a poor response to tumor immunotherapy and / or prognosis, or that the used tumor immunotherapy regimen is inadequate; conversely, a higher APOL2 level and / or activity in a tumor sample obtained from a subject than a control level indicates that the subject has a good response to tumor immunotherapy and / or prognosis, or that the used tumor immunotherapy regimen is effective. In some embodiments, the control level is selected from: the APOL2 level and / or activity in a paracancerous sample, normal tissue, a pre-treatment sample, or a sample from a non-cancerous subject.

[0153] Example

[0154] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended only to illustrate the present invention and are not intended to limit the scope of the present invention. Those skilled in the art may make appropriate modifications and variations to the present invention, and these modifications and variations are within the scope of the present invention.

[0155] For experimental procedures in the following examples where specific conditions are not specified, conventional methods in the art may be employed, for example, as described in Molecular Cloning: A Laboratory Manual (3rd ed., Cold Spring Harbor Laboratory Press, New York, 1989) or according to the conditions recommended by the supplier. DNA sequencing methods are conventional in the art and are also available from commercial companies.

[0156] Unless otherwise indicated, percentages and parts are by weight. Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein can be used in the present invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0157] I. Materials and Methods

[0158] animal

[0159] 6-8 week old C57BL / 6J mice and NSG mice were purchased from Beijing Weitonglihua Laboratory Animal Technology Co., Ltd. Apol2 knockout mice, Cd8Cre mice and Apol2 flox / flox (Apol2 fl / fl ) Mice were purchased from Shanghai Model Animal Center Co., Ltd. All mice were housed in a sterile facility at Nankai University, and all animal experiments were approved by the Experimental Animal Welfare and Ethical Review Committee of Nankai University (2021-SYDWLL-000355).

[0160] cell lines

[0161] Mouse CD8 + EasySep for T cells TM Mouse CD8 + T Cell Isolation Kit (STEMCELL Technologies, 19858) was used to isolate single cells from the spleen and then activated using a coating containing 10 μg / mL anti-CD3 (Biolegend, 100359) and 5 μg / mL anti-CD28 (Biolegend, 102121). HEK293 cells were purchased from ATCC and cultured in complete DMEM (Corning, 10-013-CV) supplemented with 10% fetal bovine serum (Gibco, 10099-1441C) and 1% penicillin-streptomycin (Gibco, 15140122). Jurkat cells and B16-F10 cells were purchased from the Cell Resource Center of Peking Union Medical College and cultured in RPMI 1640 (Corning, 10-040-CV) supplemented with 10% fetal bovine serum (Gibco, 10099-1441C) and 1% penicillin-streptomycin (Gibco, 15140122). A375 cells were purchased from the Cell Resource Center of Peking Union Medical College and cultured in DMEM supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin. B16-F10-CD19 cells are a monoclonal mouse melanoma cell line constructed by conventional methods that stably expresses human CD19 protein on its cell membrane. They were cultured in RPMI 1640 supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin.

[0162] Gene knockout cell construction

[0163] Two sgRNAs targeting the Apol2 / APOL2 coding sequence were cloned into the PX458 (Addgene, 48138) plasmid. Lipofectamine 3000 (Invitrogen, L3000015) was then used to co-transfect the two sgRNAs targeting Apol2 / APOL2 into cells to generate Apol2 / APOL2 knockout cells. Cells transfected with Vector (PX458) served as controls, and the knockout efficiency was verified by Western blotting. The sgRNA sequences for each gene are shown below:

[0164] mApol2-sgRNA1 (SEQ ID NO:1): CATGGACCCTTCAGACTGCG

[0165] mApol2-sgRNA2 (SEQ ID NO:2): TTGTGTAGTCCCACGATCCCAG

[0166] hAPOL2-sgRNA1(SEQ ID NO:3):ACGAGCCCAAGCCCGCAACT

[0167] hAPOL2-sgRNA2 (SEQ ID NO:4): GGGGCATACGCTCCTAACTG.

[0168] Cell viability assay

[0169] For suspension cells, after 24 hours of treatment with 20 mM lactate (Sigma, L6402), 10 μL of the cell suspension was mixed with 10 μL of AO / PI dye (Counstar, RE010212), added to a cell counting plate, and analyzed using an automated fluorescence cell analyzer. For adherent cells, after 24 hours of lactate treatment, the culture medium was removed and 100 μL of complete culture medium containing 10 μL of CCK8 (Beyotime, C0041) was added. The cells were incubated for 1 hour, and then the absorbance at 450 nm was measured using a multi-function microplate reader. Cell mortality (%) was calculated according to the following formula:

[0170] Calculation formula for adherent cell death rate (%):

[0171] Adherent cell death rate (%) = 1-(OD 测试 -OD 空白 ) / (OD DMSO -OD 空白 )×100%;

[0172] The calculation formula for the death rate of suspended cells (%) is:

[0173] Suspension cell death rate % = PI + Cell number / total cell number × 100%

[0174] Western Blot

[0175] Cells were lysed for 30 minutes in RIPA lysis buffer (Beyotime, P0013B) supplemented with protease inhibitors (MedChemExpress, HY-K0011), PMSF (Beyotime, ST506), and a sirtuin inhibitor (Beyotime, P1112). Protein lysates were added to 5× SDS-PAGE loading buffer (GenStar, E153-10), boiled for 5 minutes, and separated by SDS-PAGE. The samples were transferred to a 0.45 μm nitrocellulose membrane (Cytiva, 10600002) and blocked with 5% skim milk powder (BBI, A600669-0250) at room temperature for 1 hour. The membrane was then incubated with anit-APOL2 (Biorbyt, orb215097) and anti-Tubulin (PTM Biolabs, PTM-5442) diluted in 5% BSA (Sigma-Aldrich, V900933-100G) overnight at 4°C. After washing three times with TBST, the membrane was incubated with goat anti-Rabbit IgG-HRP (Absin, abs20040) diluted in 5% BSA for 1 hour at room temperature. ECL chemiluminescent substrate (Thermo Fisher Scientific, A43840) was added and the membrane was exposed using an imager.

[0176] Adenovirus preparation

[0177] The specific process for preparing adenovirus is as follows:

[0178] Apol2 cDNA was cloned into the GV135 plasmid (Genechem) and then co-transfected into HEK293 cells using Lipofectamine 2000 (Invitrogen, 11668-019) along with the packaging plasmid pBHG loxΔE1,3Cre (Genechem). 10-15 days after transfection, cells were harvested by low-speed centrifugation and subjected to three freeze-thaw cycles at -70°C / 37°C. Subsequently, viral supernatant was collected by centrifugation at 7000 g for 5 minutes at 4°C and purified using Adeno-X TM The virus was purified using a virus purification kit (Clontech, 631533) and stored at -70°C. 48 hours after the cells were infected with adenovirus, the expression efficiency of the cells was detected by Western Blot.

[0179] CAR-T cell construction and use

[0180] To prepare CAR-NC and CAR-19 retroviruses, TransIT was used. TM HEK293T cells were co-transfected with either CAR-NC or CAR-19 expression plasmids targeting human CD19 and the packaging plasmid PcL-Eco (Addgene, 12371) using -293 Transfection Reagent (Mirus MIR2704). Fresh medium was replaced after 8 hours. Virus-containing culture medium was collected after 48 and 72 hours, centrifuged at 300g for 5 minutes, and the supernatant was collected and stored in aliquots at -80°C. To prepare CART-NC, CART-19, Apol2 KO CART-NC, and Apol2 KO CART-19 cells, CAR-NC or CAR-19 retrovirus was used to infect primary CD8+ T cells isolated from normal C57BL / 6J mice (WT) and CD8+ T cells isolated from Apol2 knockout mice (Apol2 knockout) in the presence of 10 μg / ml polybrene (Sigma-Aldrich, TR 1003), and the infection efficiency was confirmed by flow cytometry 48 hours later.

[0181] For CAR-T therapy, we will use 5×10 5 B16-F10-CD19 cells were resuspended in 100 μL PBS and then subcutaneously injected into the right abdomen of C57BL / 6J mice or NSG mice to establish a subcutaneous tumor model. On the 8th day of tumor bearing, the C57BL / 6J mice were myeloablated with 5 Gy. On the 9th day and 16th day of tumor bearing, the myeloablated C57BL / 6J mice and NSG mice were intravenously injected with 3×10 6 CAR-T therapy with CART-NC, CART-19, Apol2 KO CART-NC or Apol2 KO CART-19 cells was performed when the tumor size reached 120-180 mm. 3 The tumor volume was measured every 3 days.

[0182] Establishment of subcutaneous tumor model

[0183] To establish a subcutaneous tumor model, 5×10 5 Each B16-F10 cell was resuspended in 100 μL PBS and then injected subcutaneously into control mice (Apol2 fl / fl ) and CD8 + T cell-specific knockout of Apol2 mice (Apol2 fl / fl Cd8 Cre) on the right side of the abdomen. When the tumor size reaches 120-180mm 3 The tumor volume was measured every 3 days, and the tumor volume was calculated by the formula: length × width 2 / 2.

[0184] In vivo evaluation of the anti-tumor effect of APOL2 adenovirus

[0185] To evaluate the anti-tumor effect of APOL2 adenovirus (Ad-NC) in vivo, we used C57BL / 6J mice to establish a B16-F10 mouse subcutaneous tumor model. When the tumor volume reached 120-180 mm 3 The animals were randomly divided into Ad-NC group and Ad-APOL2 group, with 6 animals in each group. 9 The dose of PFU / mouse was intratumorally injected for three consecutive days. Tumor volume was measured every three days. The tumor volume was calculated by the formula: length × width 2 / 2.

[0186] Flow cytometry detection of immune cells in tumors

[0187] When the tumor volume reaches 1500 mm 3 At 4 hr, mice were sacrificed by cervical dislocation, and tumor tissue was removed. Tumor tissue was minced in 1640 medium containing 0.3 mg / mL type I collagenase (Gibco, 17018029), 1 mg / mL type IV collagenase (Gibco, 17104019), and 1 mg / mL DNase I (Sigma-Aldrich, DN25). The tissue was digested at 37°C for 60 minutes and filtered through a 40 μm cell strainer to obtain a single-cell suspension. Red blood cell lysis buffer (Invitrogen, 00-4333-57) was added to the single-cell suspension to remove red blood cells, and anti-CD16 / 32 (BioLegend, 101320) was then added and incubated at 4°C for 10 minutes to block nonspecific staining. Then, the cells were incubated with analytical antibodies at 4°C for 30 minutes and analyzed by flow cytometry. The analytical antibodies included: Zombie-Aqua (BioLegend, 423102), APC / Cyanine7 anti-CD45 (BioLegend, 103116), PerCP / Cyanine5.5 anti-CD3 (BioLegend, 100218), Brilliant Violet 605 TManti-CD8 (BioLegend, 100744), PE anti-GZMB (BioLegend, 372208), FITC anti-Perforin (BioLegend, 154310), Brilliant Violet 650 TM anti-CD45 (BioLegend, 103151), PE / Cyanine7 anti-CD11c (BioLegend, 117318), APC / Cyanine7 anti-IA / IE (BioLegend, 107628), Dye eFluor 506 (eBioscience, 65-0866-14), Super Bright 702 anti-CD8a (eBioscience, 67-0081-82).

[0188] Combination of APOL2 adenovirus and anti-PD-1

[0189] To evaluate the role of Ad-APOL2 in enhancing the therapeutic effect of anti-PD-1, we used B16-F10 cells to establish a subcutaneous tumor-bearing mouse model. When the tumor volume reached 120-180 mm 3 The mice were randomly divided into the following groups: IgG group, anti-PD-1 group, Ad-APOL2 group, Ad-APOL2+IgG group and Ad-APOL2+anti-PD-1 group. 9 PFU / mouse were injected intratumorally for three consecutive days. IgG (BioXCell, BE0089) and anti-PD-1 (BioXCell, BE0273) (administered on the same day as Ad-APOL2) were intraperitoneally administered at a dose of 200 μg / mouse every three days for two consecutive doses. Tumor volume was measured every three days and calculated using the formula: length × width. 2 / 2.

[0190] Survival analysis

[0191] The database TIMER2.0 (TIMER2.0 (cistrome.org)) was used to analyze the relationship between APOL2 and the prognosis of cancer patients.

[0192] Example 1: Knockout of Apol2 / Apol2 protects against lactate-induced death of immune cells and tumor cells in vitro

[0193] We isolated WT and Apol2 KO CD8 + Apol2 knockout was found to be resistant to lactate-induced CD8 T cells.+ T cell death ( Figure 1 A). We then used CRISPR to construct APOL2-knockout Jurkat human T cells, Apol2-knockout B16-F10 mouse melanoma cells, and APOL2-knockout A375 human melanoma cells. We found that Apol2 / APOL2 knockout also protected these cells from lactate-induced cell death ( Figure 1 B-1D).

[0194] The above results indicate that APOL2 is a mediator of lactate-induced cell death, which can mediate the death of immune cells and tumor cells respectively.

[0195] Example 2: Knockout of CD8 + Apol2 in T cells can inhibit tumor growth and prolong mouse survival in vivo

[0196] We used Apol2 gene conditional knockout mice to construct a B16-F10 mouse subcutaneous tumor model. The results showed that compared with the control mice (Apol2 fl / fl ) compared to CD8 + Mice with Apol2 knockout in T cells (Apol2 fl / fl Cd8 Cre ) tumor growth was significantly inhibited ( Figure 2 A), the survival of mice was significantly prolonged ( Figure 2 B) CD8 infiltrating in tumors + Flow cytometry analysis of T cells revealed that CD8 + T cell death was significantly reduced, CD8 + The number and activity of T cells increased significantly.

[0197] The above results suggest that CD8 + APOL2 in T cells can mediate the death of these immune cells, thereby reducing CD8 + The number of T cells is increased, and Apol2 gene knockout can resist the death of such immune cells, thereby overcoming immunosuppression.

[0198] Example 3: Knocking out Apol2 improves the therapeutic effect of CAR-T cells

[0199] CAR-T cell therapy is an important means of cancer treatment. Its treatment of solid tumors depends largely on the survival and function of CAR-T cells in the tumor. As previously shown, Apol2 knockout can inhibit CD8 +Based on this finding, we further constructed WT and Apol2 knockout CAR-T cells (CART-19) targeting human CD19, and infused them back into B16-F10-CD19 subcutaneous tumor-bearing mice. CAR-T cell infusion therapy was performed on the 9th and 16th days after tumor inoculation, and the experimental endpoint was the 24th day after tumor inoculation. The results showed that Apol2 knockout significantly improved the anti-tumor effect of CART-19, increased the survival rate of mice and prolonged the survival of mice ( Figure 3 A-3C). Flow cytometry analysis of CART-19 infiltrating tumors revealed that Apol2 knockout significantly promoted the infiltration of CART-19 ( Figure 3 D).

[0200] The above results indicate that APOL2 knockout can significantly improve the therapeutic effect of CAR-T cells on solid tumors and can be used as an important inhibitory target to promote CAR-T function.

[0201] Example 4: APOL2 expression is positively correlated with cancer patient survival time

[0202] We used the database to analyze the relationship between APOL2 and patient survival and found that APOL2 expression levels were positively correlated with the prognosis of melanoma and breast cancer. The higher the APOL2 expression level, the better the patient's prognosis ( Figure 4 A and Figure 4 B).

[0203] These results suggest that APOL2 levels in tumor cells can serve as a prognostic marker for cancer patients, with its expression positively correlated with prognosis. Furthermore, increased APOL2 expression in tumor cells may have a positive impact on cancer patient prognosis, potentially related to APOL2-mediated cell death in tumor cells. Therefore, APOL2 in tumor cells may be an effective target for improving tumor prognosis.

[0204] Example 5: APOL2 adenovirus inhibits tumor growth and prolongs mouse survival in vivo

[0205] To study the effect of APOL2 overexpression on tumor growth in cancer cells, we constructed an adenovirus expressing APOL2. The experimental results showed that APOL2 adenovirus could induce the expression of APOL2 in B16-F10 cells in vitro ( Figure 5 A). Further in vivo experimental results showed that APOL2 adenovirus can significantly inhibit tumor growth and prolong the survival of mice ( Figure 5 B and Figure 5 C) Flow cytometry analysis of tumor-infiltrating immune cells revealed that APOL2 adenovirus significantly promoted the proliferation of DCs and CD8 + T cell infiltration and increased CD8 + The function of T cells ( Figure 5 D).

[0206] The above results indicate that increasing the expression level of APOL2 in tumor cells in vivo can improve the tumor immunosuppressive microenvironment in tumor cells, inhibit tumor growth, and prolong survival.

[0207] Example 6: APOL2 adenovirus overcomes anti-PD-1 therapy resistance and improves anti-PD-1 therapy sensitivity

[0208] Considering that some tumor cells (such as melanoma) are resistant to anti-PD-1 therapy, and APOL2 adenovirus can improve the tumor immunosuppressive microenvironment, we evaluated the effect of APOL2 adenovirus on anti-PD-1 therapy. The results showed that APOL2 adenovirus overcame anti-PD-1 therapy resistance and significantly prolonged the survival of mice ( Figure 6 A and Figure 6 B).

[0209] The above results indicate that increasing the APOL2 level in tumor cells in vivo can improve the tumor immunosuppressive microenvironment, increase the sensitivity of anti-PD-1 treatment, promote the efficacy of anti-PD-1 treatment, and play an excellent promoting role in tumor immunotherapy.

[0210] All documents mentioned in this application are incorporated herein by reference, just as if each document were incorporated herein by reference individually. It should also be understood that after reading the above teachings of the present invention, those skilled in the art may make various changes or modifications to the present invention, and that such equivalents also fall within the scope of the claims appended hereto.

[0211] Attachment: Sequence information

[0212] SEQ ID NO: 1: mApol2-sgRNA1

[0213] CATGGACCCTTCAGACTGCG

[0214] SEQ ID NO: 2: mApol2-sgRNA2

[0215] TGTGTAGTCCACGATCCCAG

[0216] SEQ ID NO: 3: hAPOL2-sgRNA1

[0217] ACGAGCCCAAGCCCGCAACT

[0218] SEQ ID NO:4: hAPOL2-sgRNA2

[0219] GGGGCATACGCTCCTAACTG

[0220] SEQ ID NO: 5: Human APOL2 protein

[0221] MNPESSIFIEDYLKYFQDQVSRENLLQLLTDDEAWNGFVAAAELPRDEADELRKALNKLASHMVMKDKNRHDKDQQHRQWFLKEFPRLKRELEDHIRKLRALAEEVEQVHRGTTIANVVSNSVGTTSGILTLLGLGLAPFTEGISFVLLDTGMGLGAAAAVAGITCSVVELVNKLRARAQARNLDQSGTNVAKVMKEFVGGNTPNVLTLVDNWYQVTQGIGRNIRAIRARANPQLGAYAPPPHVIGRISAEGGEQVERVVEGPAQAMSRGTMIVGAATGGILLLLDVVSLAYESKHLLEGAKSESAEELKKRAQELEGKLNFLTKIHEMLQPGQDQ

[0222] SEQ ID NO: 6: Murine APOL2 protein

[0223] MDPSDCEDAPGDRTFIEEAAAEYLQHTSGREDLRLLLTEDGAWEAFVAEAELSRADADTLRDALHALTANLAVEDQERLQRDLQDMERFMDAFPQVKLELEGHIGKLRTLADKVDKVHRDCTISKLVAGSTSTVSGILTLLGLTVPVTAGISLVLLATGMGLGAAAAVTSVSSGIVDYTSRSLAKTEASHLVSTGMAKVKMVADAVVHSGPQVLSLSENCCRVLRCIEQSIYAIKLTKANPALAASAMGSTSAQSGKHVKKAFKGTALAISRRRARIMGIATAGVSLVGDVISLVKQSKNLHKGTKAKSAEELRQQARELEEKLEALIQMYEGLQAGSRR

[0224] SEQ ID NO: 7: Human APOL2 protein encoding molecule

[0225]

[0226] SEQ ID NO: 8: Mouse APOL2 protein encoding molecule

[0227]

Claims

1. Use of APOL2 modulators in the preparation of products for immune regulation, tumor treatment and / or adjuvant tumor treatment.

2. The use according to claim 1, wherein The APOL2 modulator is capable of modulating the level and / or activity of APOL2, wherein the level and / or activity of APOL2 is the level and / or activity of an APOL2 polypeptide or a nucleic acid molecule encoding the same; and / or Wherein, the APOL2 regulator is one or more selected from the following group: (a) an APOL2 promoter targeting tumor cells or tumor microenvironment, wherein the APOL2 promoter increases the level and / or activity of APOL2 in tumor cells or tumor microenvironment relative to control tumor cells or tumor microenvironment without APOL2 regulation; (b) an APOL2 inhibitor directed against anti-tumor immune cells, wherein the APOL2 inhibitor reduces the level and / or activity of APOL2 in the anti-tumor immune cells relative to control immune cells that are not APOL2-regulated; (c) An APOL2 promoter targeting immune cells, wherein the APOL2 promoter increases the level and / or activity of APOL2 in the immune cells relative to control immune cells not regulated by APOL2.

3. The use according to claim 2, wherein: The APOL2 polypeptide is selected from: (i) a polypeptide having the amino acid sequence shown in SEQ ID NO: 5 or SEQ ID NO: 6; or (ii) a polypeptide that is homologous or has sequence identity to the amino acid sequence of SEQ ID NO: 5 or homologous or has sequence identity to the amino acid sequence of SEQ ID NO: 6 (e.g., greater than 80% homologous or having sequence identity greater than 80%, such as 80%, 85%, 90%, 95%, 98%, 99%), and has the function of the polypeptide described in (i); or (iii) A polypeptide in which one or more amino acids are substituted, deleted or added in the amino acid sequence of (i) or (ii), and which has the function of the polypeptide described in (i).

4. The use according to claim 2, wherein: The APOL2 promoter is selected from: substances that increase the expression level and / or activity of APOL2; for example, the substance is one or more selected from the following group: exogenous APOL2 polypeptide; APOL2 expression or overexpression vector; host cell containing APOL2 expression or overexpression vector; naked DNA and / or RNA containing APOL2 coding sequence; liposome-encapsulated DNA and / or RNA of APOL2 coding molecule; APOL2 precursor protein or conjugate or complex that can be converted into APOL2 in vivo; compound that can increase APOL2 protein level and / or function in vivo, such as small molecule compound agonist; The APOL2 inhibitor is selected from: substances that inhibit the expression level and / or activity of APOL2; for example, the substance is one or more substances selected from the following group targeting APOL2 or its encoding nucleic acid molecule: anti-APOL2 antibodies (preferably monoclonal antibodies), gene knockout or knockdown tools, protein degradation tools, APOL2 antagonistic or blocking compounds, such as small molecule compound inhibitors.

5. The use according to claim 4, wherein: The APOL2 expression or overexpression vector is selected from bacterial plasmids, bacteriophages, yeast plasmids, animal cell viruses, mammalian cell virus vectors, such as adenovirus expression vectors; and / or The APOL2 gene knockout or knockdown tool is selected from: the CRISP / Cas9 system, for example, a gRNA used in the system, such as an sgRNA selected from the nucleotide sequences shown in SEQ ID NOs: 1, 2, 3 and 4; a TALEN system; a ZFN system; a homologous recombination system; siRNA; shRNA; miRNA; and antisense oligonucleotides.

6. The use according to claim 1, wherein The APOL2 regulator is an APOL2 promoter targeting tumor cells or the tumor microenvironment, and the product is a drug or pharmaceutical composition for tumor treatment or adjuvant tumor treatment (for example, the product is a drug or pharmaceutical composition comprising a PD-1 / PD-L1 inhibitor, a chemotherapy drug and / or an oncolytic virus, or a combination of one or more of the foregoing drugs); The APOL2 regulator is an APOL2 inhibitor targeting anti-tumor immune cells in vivo, and the product is a drug or pharmaceutical composition for tumor treatment or adjuvant tumor treatment; The APOL2 regulator is an APOL2 promoter targeting immune cells in vivo, and the product is a drug or pharmaceutical composition for treating immunosuppression (e.g., for treating diseases related to immune hyperactivity (e.g., inflammatory and autoimmune diseases)); or The APOL2 regulator is an APOL2 inhibitor or promoter for in vitro or ex vivo immune cells, and the product is an immune cell production product for improving the function of the immune cells (eg, anti-tumor).

7. The use according to claim 1, wherein The APOL2 modulator is an APOL2 inhibitor that acts on immune cells in vivo or in vitro, and compared with immune cells not treated with the APOL2 inhibitor, the APOL2 level and / or activity in the immune cells treated with the APOL2 inhibitor is reduced, and the immune function of the immune cells is enhanced; and / or The immune cells are selected from: T cells (e.g., αβT cells, γδT cells, NKT cells, Treg cells, Th cells), NK cells, macrophages, and the cells may or may not contain a chimeric antigen receptor (CAR), such as CAR-T cells, CAR-NK cells, CAR-M cells; and / or The immune cells are selected from the group consisting of in vivo immune cells, ex vivo immune cells and in vitro immune cells; for example, autologous or allogeneic CAR-T cells, TCR-T or TIL for adoptive cell therapy.

8. The use according to claim 1, wherein: The product is administered to a mammal or mammalian cell, wherein the mammal is selected from, for example, primates, rodents, livestock, pets, etc., preferably humans, rats, mice, dogs, horses, cows, rabbits, monkeys, apes, and gorillas; and / or The tumor is selected from the group consisting of melanoma, breast cancer, lung cancer (such as non-small cell lung cancer), ovarian cancer, prostate cancer, liver cancer, kidney cancer, intestinal cancer, head and neck cancer, skin cancer, bladder cancer, pancreatic cancer, and non-solid tumors; and / or The product further comprises one or more other active ingredients selected from the group consisting of chemotherapy, oncolytic viruses, anti-tumor vaccines, adoptive cellular immunotherapy, immunomodulatory drugs targeting T cells, immune checkpoint inhibitors (ICIs), such as PD1 / PDL1 inhibitors (such as anti-PD1 antibodies, pembrolizumab); and / or The product is suitable for administration by a route selected from the group consisting of: enteral administration, parenteral administration, such as intravenous, mucosal, nasal, intraperitoneal, intracranial, intratumoral, sublingual, buccal, transdermal (such as iontophoresis), etc., for example, administration by a route selected from the group consisting of: direct injection of liposome-encapsulated DNA, gold-coated DNA gene gun bombardment, plasmid DNA carried by reproduction-defective bacteria, and target DNA carried by viral vectors; and / or. The product is selected from the group consisting of: a drug, a pharmaceutical composition, a kit, a medical device, or a combination thereof.

9. A treated immune cell, wherein: The APOL2 level and / or activity in the immune cells is upregulated or downregulated (eg, downregulated to 50%, 40%, 30%, 20%, 10% or 0% of the APOL2 level and / or activity in untreated immune cells).

10. The treated immune cell according to claim 9, wherein The immune cells are anti-tumor immune cells used for anti-tumor immunotherapy; and / or The immune cells are selected from: T cells (e.g., αβT cells, γδT cells, NKT cells, Treg cells, Th cells), NK cells, macrophages, and the cells may or may not contain a chimeric antigen receptor (CAR), such as CAR-T cells, CAR-NK cells, CAR-M cells; and / or The immune cells are selected from the group consisting of in vivo immune cells, ex vivo immune cells and in vitro immune cells; for example, autologous or allogeneic CAR-T cells, TCR-T or TIL for adoptive cell therapy; and / or The immune cells are immune cells used for anti-tumor immunotherapy, for example, the immune cells further comprise anti-tumor elements or have anti-tumor activity, for example, they comprise tumor-targeting CAR elements, TCR elements, or are tumor-infiltrating lymphocytes (TIL) or cytokine-induced killer cells (CIK).

11. A method for treating immune cells, the method comprising upregulating or downregulating the level and / or activity of APOL2 in the immune cells by treatment (e.g., downregulating the level and / or activity of APOL2 to 50%, 40%, 30%, 20%, 10% or 0% of the level and / or activity of APOL2 in untreated immune cells).

12. The method of claim 11, wherein: The immune cells are selected from: T cells (e.g., αβT cells, γδT cells, NKT cells, Treg cells, Th cells), NK cells, macrophages, and the cells may or may not contain a chimeric antigen receptor (CAR), such as CAR-T cells, CAR-NK cells, CAR-M cells; and / or The immune cells are selected from the group consisting of in vivo immune cells, ex vivo immune cells and in vitro immune cells; for example, autologous or allogeneic CAR-T cells, TCR-T or TIL for adoptive cell therapy; and / or The immune cells are anti-tumor immune cells for anti-tumor immunotherapy, for example, the immune cells further comprise anti-tumor elements or have anti-tumor activity, for example, they comprise tumor-targeting CAR elements, TCR elements, or are tumor-infiltrating lymphocytes (TIL) or cytokine-induced killer cells (CIK); and / or The treatment comprises treating immune cells with the APOL2 modulator as claimed in any one of claims 2 to 5 .

13. Use of a reagent for determining the level and / or activity of APOL2 in a tumor sample obtained from a subject in the preparation of a kit for evaluating the subject's response to tumor immunotherapy and / or prognosis, and / or selecting a tumor immunotherapy regimen.

14. The use according to claim 13, wherein: The sample is selected from tumor tissue or tumor cells of a subject; and / or A lower APOL2 level and / or activity in a tumor sample obtained from a subject than a control level indicates that the subject has a poor response and / or prognosis to tumor immunotherapy, or that the tumor immunotherapy regimen used is inadequate; conversely, a higher APOL2 level and / or activity in a tumor sample obtained from a subject than a control level indicates that the subject has a good response and / or prognosis to tumor immunotherapy, or that the tumor immunotherapy regimen used is effective; and / or The control level is selected from the group consisting of: APOL2 level and / or activity in a paracancerous sample, normal tissue, pre-treatment sample, or non-cancerous subject sample of the subject.