Regulation and control method of affinity of nucleic acid aptamer and application of regulation and control method

Abstract

The invention belongs to the technical field of nucleic acid aptamers, and relates to a method for regulating and controlling affinity of nucleic acid aptamers and application of the nucleic acid aptamers. The invention provides a method for regulating and controlling the affinity of a nucleic acid aptamer. According to the method, the affinity of the aptamer and a target is precisely regulated and controlled through a length-adjustable flexible single chain and the gap width of a molecular tweezer region. Based on the regulation and control method, the nucleic acid aptamer with high affinity is constructed, and the nucleic acid aptamer shows excellent stability after being combined with a target.

Description

Technical Field

[0001] The invention belongs to the technical field of nucleic acid aptamers and relates to a method for regulating the affinity of nucleic acid aptamers and an application thereof. Background Art

[0002] Aptamers are a type of single-stranded DNA or RNA molecules that are screened from a random sequence library through in vitro screening technology (SELEX, Systematic Evolution of Ligands by Exponential Enrichment). They can specifically bind to proteins, small molecules, cells and microorganisms. The molecular recognition of aptamers is based on the three-dimensional spatial conformation formed by the folding of its single-stranded nucleic acid molecules, which achieves high-affinity binding to the target through intermolecular forces such as hydrogen bonds and hydrophobic interactions. The high specificity and high affinity of aptamers enable them to bind to specific molecules through a highly specific three-dimensional conformation, and the affinity can be as high as nanomolar (nM) or picomolar (pM) levels. The aptamer dissociation constant (K d ), or the binding constant, is an important indicator for determining the binding affinity between an aptamer and its target molecule. The smaller the aptamer's dissociation constant, the stronger its binding affinity to the target molecule.

[0003] The Nucleic Acid Force Clamp (NAFCL), also known as a molecular clamp, is a nanotechnology tool designed based on the structure of nucleic acid molecules. Its core function is to analyze the dynamic behavior and mechanism of action of biomolecules under microscopic force fields through mechanical manipulation and measurement at the single-molecule level. This technology leverages the specific binding capabilities of nucleic acid molecules (such as base pairing) and their programmable mechanical response properties (such as stretching, torsion, and bending) to precisely apply or monitor force signals in the piconewton (pN) range, thereby revealing key mechanical characteristics of biological processes such as protein folding and DNA-protein interactions. The basic structure of a NAFCL typically consists of two rigid double-stranded nucleic acid molecules and one flexible single-stranded nucleic acid molecule. The two rigid double-stranded nucleic acid molecules are connected by a flexible single-stranded nucleic acid molecule to form a clamp-like structure. By controlling the distance between the two rigid double-stranded nucleic acid molecules, tiny forces can be applied and measured on the flexible single-stranded nucleic acid molecule. The basic principle of the NAFCL is to apply force on the flexible single-stranded nucleic acid molecule by changing the distance between the rigid double-stranded nucleic acid molecules. Summary of the Invention

[0004] The present invention aims to achieve precise control of the affinity and entropy of nucleic acid aptamers. To this end, the present invention provides a method for controlling the affinity of nucleic acid aptamers and its application to address this need in the art.

[0005] In one aspect, the present invention relates to a method for regulating the affinity of a nucleic acid aptamer, characterized in that it comprises:

[0006] The nucleic acid aptamer to be adjusted is composed of chain A and chain B, wherein chain A consists of a specific aptamer sequence corresponding to the target and complementary sequences at both ends, and chain B and the complementary sequences completely hybridize to form a circular internal stress molecule;

[0007] Changing at least two of the length of the molecular tweezers, the length of the flexible single chain, and the width of the gap of the molecular tweezers to regulate the binding constant between the nucleic acid aptamer to be adjusted and the target and the entropy of the system after binding;

[0008] The complementary sequences at both ends of the aptamer sequence are molecular clamps, and changing the length of the molecular clamps can regulate the binding constant and the entropy value;

[0009] Constructing a flexible single strand by keeping the sequence of chain A unchanged and sequentially deleting at least 2 bases at both ends of chain B to obtain a flexible single strand with a length of at least 2 nt. Changing the length of the flexible single strand controls the binding constant and the entropy value.

[0010] The gap width of the molecular clamp is constructed by adding at least one non-complementary base to the chain A in the middle region of the chain B, corresponding to a gap of the molecular clamp with a width of at least 1 nt. Changing the gap width of the molecular clamp regulates the binding constant and the entropy value.

[0011] Furthermore, in the method for regulating the affinity of nucleic acid aptamers provided by the present invention, the length of the molecular tweezers is 16-24 nt, the length of the flexible single chain is 2-6 nt, and the gap width of the molecular tweezers is 1-3 nt.

[0012] Furthermore, in the method for regulating the affinity of nucleic acid aptamers provided by the present invention, the length of the molecular tweezers is negatively correlated with the binding constant, the length of the flexible single chain is negatively correlated with the binding constant, and the gap width of the molecular tweezers reduces the binding constant.

[0013] Furthermore, in the method for regulating the affinity of nucleic acid aptamers provided by the present invention, the length of the molecular tweezers is negatively correlated with the binding constant, the length of the flexible single chain is negatively correlated with the binding constant, and the gap width of the molecular tweezers reduces the binding constant.

[0014] Furthermore, in the method for regulating the affinity of nucleic acid aptamers provided by the present invention, the length of the molecular tweezers is negatively correlated with the entropy value, the length of the flexible single chain is negatively correlated with the entropy value, and the gap width of the molecular tweezers reduces the entropy value.

[0015] On the other hand, the present invention relates to a nucleic acid aptamer, which is obtained by using the method for regulating the affinity of nucleic acid aptamers.

[0016] In another aspect, the present invention relates to a nucleic acid aptamer, wherein the nucleic acid aptamer is composed of chain A and chain B;

[0017] The sequence of the chain A is 5′-R1-SAM aptamer-R2-3′, and the sequence of the basic chain B is 5′-R3-R4-3′;

[0018] The SAM aptamer is a specific aptamer sequence corresponding to the target;

[0019] The R1 and the R2 are each independently a random sequence with a GC content of 40 to 60%, the R1 and the R2 are identical in length and are 8 to 12 nt, and the R3 and the R4 are completely hybridized with the R1 and the R2 to form a circular internal stress molecule;

[0020] The sequence of chain B is 5′-R5-R6-3′;

[0021] R5 is the sequence of R3 with 1 to 3 nt bases removed from the 5' or 3' end and 1 to 3 nt T bases inserted at non-terminal ends;

[0022] The R6 is a sequence obtained by reducing 1 to 3 nt bases at the 5′ end or the 3′ end of the R4 and inserting 1 to 3 nt T bases at non-terminal ends.

[0023] Furthermore, in the nucleic acid aptamer provided by the present invention, the target is sulfadimethoxine, the sequence of the SAM aptamer is shown in SEQ ID NO: 1, the sequence of the chain A is shown in SEQ ID NO: 2, and the sequence of the chain B is shown in SEQ ID NO: 3.

[0024] SEQ ID NO: 1 specifically: AAGGGCAAGGAGGGTTCCTAGA;

[0025] SEQ ID NO: 2 specifically: TGATGCGTAAGGGCAAGGAGGGTTCCTAGATGCTGTGA;

[0026] SEQ ID NO: 3 is specifically: ACGCATCATTTCACAGCA.

[0027] On the other hand, the present invention relates to a biosensor for detecting sulfadimethoxine, wherein the biosensor comprises the nucleic acid aptamer.

[0028] On the other hand, the present invention relates to the application of the method for regulating the affinity of nucleic acid aptamers in improving the binding constant and entropy value between nucleic acid aptamers and targets.

[0029] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages:

[0030] Based on DNA molecular clamp technology, the regulatory strategy of this application successfully achieved precise regulation of the affinity of the SDM aptamer. First, applying molecular clamps at both ends of the aptamer effectively changed the conformation of the aptamer, causing the binding affinity between the aptamer and the target to change, and this effect gradually became significant as the length of the molecular clamp became shorter. At the same time, the special structure of the double-stranded molecular clamp also ensures the stable binding of the aptamer to the target to a certain extent. Further, in order to enhance the flexibility of regulation, this application introduces flexible single chains (2 to 6 nt) with adjustable lengths at both ends of the aptamer. This design not only makes the adjustment of the aptamer affinity more refined and flexible, but also this fine-tuning process shows a high degree of predictability of the results. In addition, the experiment further regulates the affinity of the aptamer by changing the gap width of the molecular clamp region. Within the range of 0 to 3 nucleotide gap widths, this regulatory strategy exhibits extraordinary precision. It is worth noting that the regulatory strategy proposed in this application not only has excellent precision and flexibility, but also the predictability of the results is satisfactory. The strategy of this application successfully achieved the SDM aptamer binding constant K d Flexible adjustment within the range of 0.602~66.08μM. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0032] Figure 1 The construction and detection mechanism of magnetic bead sensors based on stress aptamer molecules.

[0033] Figure 2 Schematic diagram of the construction principle of stress aptamer molecules (SAMs), where a is the construction of stress aptamer molecules SAMs: chain A contains the M5 aptamer (yellow part) in the middle, and the random sequences on both sides (blue and green parts) are complementary to chain B; b is time-lapse gel electrophoresis: determining the critical molecular clamp length Nc; c is introducing a flexible single chain and changing the width of the molecular clamp gap: keeping chain A unchanged, adding a non-complementary base T in the middle region of chain B to increase the width of the SAMs gap; keeping chain B unchanged, shortening the bases on both sides of chain A, and extending the flexible single chain.

[0034] Figure 3 The time-lapse gel spectra of stress aptamer molecules SAMs. Among them, a~d are stress aptamer molecules SAMs 18-18 、SAM 20-20 、SAM 22-22 、SAM 24-24 Time-lapse gel spectrum. d Indicates the length of the molecular clamp (unit: bp), N c represents the critical length of the molecular clamp (unit: bp).

[0035] Figure 4 The line shape of the Heat Rate–t curve under different concentration titration systems. Among them, C1 to C6 represent the titration concentration of SDM (1.5 to 9.0 mM).

[0036] Figure 5 Isothermal titration calorimetry results. a is SDM titration of M5 aptamer; b is SDM titration of SAM 20-20 .

[0037] Figure 6 isothermal titration calorimetry results of molecular tweezers of different lengths. Where a is the binding constant K of the stress aptamer molecule d ; b is the molar enthalpy change ΔH.

[0038] Figure 7 In order to introduce the flexible single-chain stress aptamer molecules SAMs (N d =22bp) isothermal titration calorimetry results. Wherein, a is the binding constant K of the stress aptamer molecule d ; b is the molar enthalpy change ΔH.

[0039] Figure 8 In order to introduce the flexible single-chain stress aptamer molecules SAMs (N d =20bp) isothermal titration calorimetry results. Where a is the binding constant K of the stress aptamer molecule d ; b is the molar enthalpy change ΔH.

[0040] Figure 9 In order to introduce the soft core single chain stress aptamer molecules SAMs (N d =18bp) isothermal titration calorimetry results. Wherein, a is the binding constant K of the stress aptamer molecule d ; b is the molar enthalpy change ΔH.

[0041] Figure 10 isothermal titration calorimetry results of stress aptamer molecules with varying gap widths. Where a is the binding constant K of the stress aptamer molecule. d ; b is the molar enthalpy change ΔH.

[0042] Figure 11 Stress aptamer molecule SAM 16-18 (Gap=2) and circular dichroism spectra of M5 and SDM.

[0043] Figure 12 The sensitivity and selectivity of the sensors SAM-MC and M5-MC are shown in Figure 1. (a) shows the standard curve for the dissolution of sulfadimethoxine (SAM); (b) shows the sensitivity of the stress aptamer-based magnetic bead sensor; and (c) shows the selectivity of the stress aptamer-based magnetic bead sensor. DETAILED DESCRIPTION

[0044] The technical solutions of the present invention are described below with reference to the following examples. However, the present invention is not limited to the following examples. The experimental and detection methods described in each example are conventional methods unless otherwise specified. The reagents and materials described are commercially available unless otherwise specified. The percentages in the following examples are percentages by mass unless otherwise specified. The ratios in the following examples are ratios by mass unless otherwise specified.

[0045] Example

[0046] This embodiment provides a method for regulating the affinity of nucleic acid aptamers.

[0047] The nucleic acid sequences used in this experiment are shown in Tables 1-3. All were synthesized by Shanghai Bioengineering Co., Ltd. and purified by high-performance liquid chromatography. The synthesized DNA powder was dissolved in deionized water to prepare a 100 μM stock solution and stored at 4°C. As shown in Table 1, two types of nucleic acid sequences were designed for this experiment: chain A and chain B. Chain A consists of the M5 aptamer sequence (in bold) and complementary sequences at both ends. Chain B can completely hybridize with the complementary sequences in chain A to form a circular internal stress molecule. In the first group, the sequences at both ends of chain A were randomly generated with a GC content of 54.3%. Based on the first group, one base was removed from each of the left and right ends to form the second to fourth groups of sequences. The sequences listed in Table 2 are based on the sequences designed in Table 1, with one base removed from each of the left and right ends of chain B, while the corresponding chain A sequences remained unchanged. The sequences listed in Table 3 are based on the sequences designed in Table 1, with a T base added to the middle region of chain B to increase the gap width. The thermodynamic properties of all sequences were analyzed using Primer Premier 5 and DINAMelt software to ensure successful hybridization of double-stranded DNA.

[0048] Table 1 Oligonucleotide chains used to construct stress aptamer molecules

[0049]

[0050] Table 2 Nucleotide sequences for constructing SAMs by introducing flexible single chains

[0051]

[0052]

[0053] Table 3 Nucleotide sequences of SAMs constructed by changing gap width

[0054]

[0055] The synthesized chains A and B were centrifuged separately at 5000 rpm for 30-60 seconds. Dissolve the mixture in an appropriate amount of enzyme-free deionized water, vortex for a few seconds, and then centrifuge again at 5000 rpm for 30-60 seconds. Chain A was mixed with an equimolar amount of chain B and diluted to a final concentration of 5 μM in hybridization buffer (10 mM Tris, 5 mM MgCl2, 100 mM NaCl, pH 7.9) in a final volume of 100 μL. The mixture was then incubated in a BIORADT100™ Thermal Cycler (95°C for 10 minutes) and then cooled linearly (~0.1°C / min) to room temperature to ensure proper conformation.

[0056] Prepare 10x hybridization buffer. Ingredients: 100mM Tris, 50mM MgCl2, 1M NaCl, pH 7.9. First, add 5mL of 1M MgCl2 to a beaker, followed by 10mL of 5M NaCl, then 5mL of pH 7.9 Tris solution, and finally 30mL of deionized water. Vortex to mix thoroughly. 10% ammonium persulfate solution. Ingredients: 10% (w / v) ammonium persulfate. First, accurately weigh 100mg of ammonium persulfate powder into a 1.5mL centrifuge tube. Then, add 0.9mL of deionized water and vortex until completely dissolved. Finally, make up to 1mL with deionized water and vortex again for 30 seconds. Prepare a 0.16M sulfadimethoxine stock solution. Accurately weigh 0.05g of sulfadimethoxine standard and dissolve thoroughly in 1mL of 1M NH3·H2O to prepare the stock solution.

[0057] The previously prepared sulfadimethoxine stock solution was diluted with hybridization buffer to obtain sulfadimethoxine preparative solutions with concentrations of 1.5 mM, 3 mM, 4.5 mM, 6 mM, 7.5 mM, and 9 mM, respectively, and ultrasonicated at 37°C for 2 h to ensure that no sulfadimethoxine was precipitated.

[0058] In the process of constructing stress aptamer molecules, the intervention of molecular tweezers precisely regulates the conformation of the aptamer, making it present in the unfolded and folded states. When chain A and chain B undergo hybridization reaction, since the polymerization inevitably reduces the entropy of the system, a dynamic conversion balance is always maintained between the monomer and the dimer. And this delicate balance state is still maintained during the subsequent gel electrophoresis analysis. In order to intuitively demonstrate this conversion balance phenomenon, a series of experiments were designed to construct a clamp length N d Stress aptamer molecules (SAMs) of 18 to 24 base pairs (bp) 18-18 、SAM 20-20 、SAM 22-22 、SAM 24-24 ). Subsequently, 5% polyacrylamide gel electrophoresis (PAGE) was used to perform delayed gel electrophoresis analysis under non-denaturing conditions in order to accurately determine the critical molecular clamp length that enables the effective unfolding of the sulfadimethoxine aptamer. The specific operation is: at a constant voltage of 80V, the samples are sequentially loaded into different lanes of the gel every 10 minutes, ensuring that samples with the same clamp length are electrophoresed for 55 minutes, 45 minutes, 35 minutes, 25 minutes, and 15 minutes respectively. Observe the delayed gel spectrum, and the clamp length of the stress aptamer molecule corresponding to the group of monomer band splitting is the critical clamp length N. c .

[0059] In order to verify the allosteric regulation of DNA molecular clamp on the affinity of SDM aptamer, isothermal titration calorimetry was used to determine the K of stress aptamer molecules SAMs. d Value. The experiment chose to titrate stress aptamer molecules SAMs with activated SDM. 15μM stress aptamer molecule solution and SDM solutions of different concentrations were prepared using 1× hybridization buffer solution. Then 300μl of 15μM stress aptamer molecules were titrated with 50μl of SDM of different concentrations, and 300μl of hybridization buffer was titrated with 50μl of corresponding SDM as background heat subtraction. 300μl of 15μM activated M5 aptamer was titrated with 50μl of SDM of the same concentration as a control. Point-to-point model was used for fitting, with a stirring rate of 250RPM and a temperature setting of 25°C.

[0060] The application of the molecular clamp will cause the Sulfamethoxazole aptamer to change its conformation, and this change will change with the change of the molecular clamp length. In the construction, it is expected that two single chains will extend from both ends of the aptamer. The two single chains will act as flexible single chains to fine-tune the conversion of the aptamer conformation caused by the molecular clamp. The specific operation is: sequentially delete the bases at both ends of chain B, keep the length of chain A unchanged, and construct stress aptamer molecules SAM with flexible single chains of different lengths. 22-20 、SAM 22-18 、SAM 22-16 、SAM20-18 、SAM 20-16 、SAM 18-16 Isothermal titration calorimetry experiments were performed to compare the changes in binding affinity of stress aptamer molecules (SAMs) with flexible single chains of different lengths.

[0061] When constructing stress aptamer molecules SAMs, a gap will appear in the double-stranded region of the molecular clamp due to the hybridization of chain A and chain B. DNA gaps play a key role in the bending and release of mechanical stress of double-stranded DNA, which means that the change in mechanical stress caused by the change in gap width cannot be ignored. Molecular clamps put the aptamer in an unfolded or folded state by applying mechanical stress to both ends of the aptamer. Therefore, changes in the gap width will affect the conformational equilibrium of the sulfadimethoxine aptamer, thereby causing changes in target binding affinity. Experiments on stress aptamer molecules SAMs 16-16 On the basis of the molecular clamp, the gap width was gradually increased from 0 to 3 nt, and the SAM was constructed. 16-17 、SAM 16-18 、SAM 16-19 Then, the K of each stress aptamer SAMs was determined by isothermal titration calorimetry. d value.

[0062] The stability of the stress aptamer molecule (SAM) constructed based on the molecular tweezers was verified by circular dichroism experiments. The specific operation was as follows: First, 100 μM M5 stock solution was diluted with hybridization buffer solution to prepare 10 μM M5 aptamer solution and stress aptamer molecule SAM. 16-18 Then, 100 μL of 10 μM sulfadimethoxine standard solution was mixed with 100 μL of 10 μM SAM 16-1 The solution was mixed with the M5 aptamer solution to obtain M5-SDM and SAM 16-18 -SDM two groups of mixed samples, and then the two mixed samples were placed at room temperature for 30 minutes. After the incubation, the M5-SDM, SAM 16-18 -SDM two groups of mixed samples were tested, and the scanning wavelength range was set at 200-300 nm.

[0063] In order to demonstrate the practical application of the affinity regulation mechanism based on molecular tweezers in biosensing, two magnetic bead sensors were constructed. Figure 1As shown, the magnetic bead-based sensing system is based on the "competitive displacement-signal release" principle. Binding of SDM to the aptamer M5 disrupts the hybridization stability of the complementary SA strand. Dissociated SA single strands enter the solution phase, and their A260 values ​​are positively correlated with target concentration. A branched hybrid structure is introduced by the gap2-SA complex, allowing a single target binding event to trigger the release of multiple strands. Based on this principle, the stress aptamer-based magnetic bead sensors SAM-MC and M5-MC were constructed.

[0064] (1) Construction of molecular hybridization system

[0065] Through precise sequence design, two functionalized complexes were constructed.

[0066] M5-SA complex: The 5'-end biotin-modified SA complementary chain (10 μM, 5 μL) and the aptamer M5 (10 μM, 5 μL) were mixed in 1× hybridization buffer (10 mM Tris-HCl, 50 mM NaCl, 1 mM EDTA, pH 7.4) to a final volume of 50 μL.

[0067] Gap2-SA complex: SA complementary chain (5 μL) was mixed with Gap-2-A and Gap-2-B (5 μL each, 10 μM) at a molar ratio of 1:1:1 to a final volume of 50 μL.

[0068] (2) Optimization of hybridization conditions

[0069] A gradient annealing program (95°C for 10 min, followed by a linear temperature decrease of 0.1°C / min) was used to promote specific hybridization, and the purity of the complex was verified by native PAGE (band mobility RSD < 5%).

[0070] (3) Magnetic bead immobilization and target capture

[0071] Take 100 μL Dynabeads TM M-270 magnetic beads (10 mg / mL, Thermo Fisher) were washed three times with 1× binding buffer (0.1 M sodium phosphate, 0.15 M NaCl, pH 7.4) and resuspended to a final concentration of 5 mg / mL.

[0072] The M5-SA and gap2-SA complexes were mixed with pretreated magnetic beads at a molar ratio of 1:20 (final volume 200 μL) and incubated with shaking at 25°C for 30 min. Unbound complexes were removed by magnetic separation and washed three times with wash buffer (0.01% Tween-20 in PBS) to obtain immobilized magnetic bead probes.

[0073] SDM standards (0-100 nM) were added to the immobilized magnetic bead system in a gradient manner and incubated at 37°C for 45 min. Specific binding of the target molecule to the aptamer resulted in the dissociation of the complementary chain SA (competitive displacement efficiency >85%).

[0074] (4) Signal detection and quantitative analysis

[0075] The supernatant was collected by magnetic separation (2 min, 10,000×g), and the ultraviolet absorbance (A260) of free SA was measured at 260 nm using NanoDrop OneC (ThermoScientific).

[0076] (5) Quality control

[0077] Negative control: absorbance fluctuation of the buffer system without SDM is <5%;

[0078] Repeatability: Each experiment was performed with three biological replicates (CV < 8%).

[0079] Specificity verification: Cross-testing of structural analogues such as sulfamethoxazole, sulfachlorpromazine, and kanamycin (cross-reaction rate <3%).

[0080] The construction of molecular clamps requires the design of two types of oligonucleotide sequences: chain A and chain B. The bold part in chain A is the sequence of the M5 aptamer, and the two ends are complementary sequences to chain B. Therefore, the hybridization of chain A and chain B will produce a partially double-stranded circular molecule, which is called a "stress aptamer molecule" (SAM). Its structure is as follows Figure 2 As shown in Figure a. In this experiment, the sulfadimethoxine aptamer (M5) was used as the research target. The M5 aptamer is a 22-nt single-stranded nucleic acid with the sequence 5′-AAGGGC AAG GAG GGT TCC TAG A-3′. Its structure contains a double strand and a stem-loop structure, and it has a strong affinity for the target. Figure 2 b is time-lapse gel electrophoresis: determining the critical molecular clamp length Nc; c is introducing a flexible single chain and changing the molecular clamp gap width

[0081] In order to further explore the affinity regulation mechanism based on molecular tweezers, the experiment introduced flexible single chains and changed the gap width on the basis of constructing stress aptamer molecules (SAM) to achieve allosteric regulation of the affinity of the M5 aptamer. Specifically, the sequence length of chain A is kept unchanged, and the bases on both sides of chain B are deleted in sequence. In this way, as chains A and B hybridize, two oligonucleotide single chains will appear between the molecular tweezers and the M5 aptamer. These two oligonucleotide single chains will act as "hinges", thereby allosterically regulating the M5 aptamer. Similarly, the sequence length of chain A is kept unchanged, and the base T is added or subtracted in the middle region of chain B. In this way, the hybridization of chain A and chain B will expand the gap in the double-stranded region of the molecular tweezers, thereby affecting the mechanical stress stored in the double-stranded region. Its structure is as shown below. Figure 2 As shown in c.

[0082] A series of stress aptamer molecules (SAMs) with different molecular clamp lengths were constructed. 18-18 、SAM 20-20 、SAM 22-22 、SAM 24-24 , and 5% polyacrylamide time-lapse gel electrophoresis was performed. By comparing the four groups of time-lapse gel spectra, it was found that the molecular clamp length N d 18 bp ( Figure 3 a), 22bp( Figure 3 c), 24bp( Figure 3 In the time-lapse gel spectra of d), there is only one band in the 25-50 bp range of the 55 min channel. d For a set of time-lapse gel spectra of 20 bp, two adjacent molecular bands of the same size appeared in the 25-50 bp interval of the 55-min, 45-min, and 35-min channels ( Figure 3 b). At the same time, a wide band appeared around 100 bp in the 55 min channel in all experimental groups ( Figure 3 ).

[0083] N d = 20 bp. The appearance of two adjacent bands indicates that the SDM aptamer is in the unfolded state at the same time under this molecular clamp length. 20-20 SAM in monomeric and folded states 20-20 Monomer, that is, to determine the critical molecular clamp length N c =20bp( Figure 3b) Conformational transitions between aptamers are related to factors such as the ligand and aptamer's structural flexibility and functional groups. However, after the application of the molecular clamp, these conformational transitions are primarily constrained by the mechanical stress exerted by the clamp, even though the secondary structures of the HD22 and M5 aptamers differ significantly. Because aggregation between monomeric stress aptamer molecules reduces the entropy of the reaction, a constant equilibrium of monomer-dimer conversion exists throughout the time-lapse gel electrophoresis process, explaining that the wider band in the chromatogram represents the dimer of the stress aptamer molecule.

[0084] By systematically optimizing the relationship between the titrant (SDM) and the titrant (M5 aptamer / SAM 20-20 ) concentration ratio, successfully obtained an S-shaped binding curve with a significant inflection point, and achieved a binding constant (K d The experimental results showed that the initial concentration system (SDM: 150μM, 300μL; M5 aptamer / SAM 20-20 :15μM,50μL) Due to insufficient titrant concentration, the inflection point of the binding curve is blurred and the data cannot be effectively fitted. By increasing the SDM concentration gradient to 1.5-9.0mM and keeping the titrant concentration constant (15μM), it was found that when the SDM concentration reached 7.5mM and 9.0mM, the curve of Corrected HeatRate changing with time showed an ideal S-shaped feature, indicating that the system has reached the stoichiometric equilibrium point at this time and can meet the requirement of binding site saturation ( Figure 4 From the perspective of economic benefits, 7.5 mM SDM was finally selected as the optimized concentration because it reduced reagent consumption costs while ensuring data quality.

[0085] The optimization strategy of this experiment emphasizes the key role of concentration ratio in the reliability of isothermal titration results: when the titrant concentration is insufficient, the binding sites cannot be fully occupied, resulting in the disappearance of the inflection point; while excessive concentration can enhance the signal, it may interfere with data analysis due to nonspecific adsorption or thermal effects introduced by excessive titrant. The 7.5mM SDM and 15.0μM titrant system selected in this application achieves an effective balance between achieving signal saturation and avoiding background noise, providing a standardized experimental framework for subsequent studies on the effect of molecular clamp length on aptamer-SDM interactions ( Figure 5 ).

[0086] The isothermal titration results showed that the binding constant K of the activated M5 aptamer to the target sulfadimethoxine was d 1.878μM( Figure 6 a), the molar enthalpy change ΔH is -100 kJ / mol, and the entropy value ΔS of the reaction is -244.9 kJ / mol ( Figure 6b) This indicates that the binding reaction between the M5 aptamer and the target sulfadimethoxine is spontaneous and the disorder of the system is reduced after the reaction. 24-24 、SAM 22-22 、SAM 20-20 、SAM 18-18 The binding constant K d The binding constant K of the stress aptamer molecule is 2.107μM, 2.62μM, 2.863μM, and 4.023μM, respectively. The length of the molecular clamp is in the range of 24 to 18bp. When the length is shortened by two base pairs, the binding constant K of the stress aptamer molecule is 2.107μM, 2.62μM, 2.863μM, and 4. d There was a small change, the range of which was only 0.243 to 1.16 μM. However, as the length of the molecular clamp was shortened to 16 bp, the binding constant K d (54.55μM) showed a significant change ( Figure 6 ).

[0087] The binding affinity between the aptamer and the target is mainly determined by the binding constant K d This key parameter reflects that the binding constant K of the stress aptamer molecule to the target is greater after applying molecular clamps at both ends of the M5 aptamer compared to when no molecular clamps are applied. d The overall trend is downward ( Figure 6 a). However, when the molecular clamp length is reduced to 16 bp, SAM 16-16 The binding constant K d (54.55μM) significantly increased. Binding constant K d The significant change can be explained by the fact that as the length of the molecular clamp double chain continues to decrease, the elastic energy inside the molecular clamp increases to a peak value, the mechanical tension acting on the aptamer increases, and the binding state of the aptamer and the target changes significantly. In addition, as the length of the molecular clamp decreases, the entropy ΔS of each titration reaction changes from SAM to ΔS. 24-24 (-96.26 J / mol·k) gradually increased to SAM 16-16 (29.92 J / mol·k), the gradual increase in entropy indicates that the disorder of the system is increasing ( Figure 6 b).

[0088] In order to explore the regulatory effect of flexible single chains on molecular clamps, this application constructs stress aptamer molecules (SAMs) with different molecular clamp lengths and flexible single chain lengths. 22-20 、SAM 22-18 、SAM 22-16 、SAM 20-18 、SAM 20-16 、SAM 18-16 ) and performed isothermal titration calorimetry experiments.

[0089] In N d=22bp stress aptamer molecules, the sequence of chain A was kept unchanged, and 2 to 6 bases were deleted from both ends of the random sequence chain B to obtain stress aptamer molecules SAM with flexible single chain lengths of 2nt, 4nt, and 6nt respectively. 22-20 、SAM 22-18 、SAM 22-16 Isothermal titration calorimetry results showed that SAM 22-20 、SAM 22-18 、SAM 22-16 The binding constant K d They were 2.789μM, 3.502μM, 20.89μM ( Figure 7 a) It is worth noting that when the length of the flexible single chain increases to 6 nt, the binding constant K d By SAM 22-22 (2.62μM) rapidly increased to SAM 22-16 (20.89μM). From the perspective of system entropy, the stress aptamer molecule SAM without the introduction of flexible single chain 22-22 The entropy ΔS of the system is -102.1 J / mol·k, while the entropy ΔS of the stress aptamer molecules SAMs after the introduction of the flexible single chain are -139.7 J / mol·k, -231.2 J / mol·k, and -245.8 J / mol·k, respectively. The entropy of the system is significantly reduced ( Figure 7 b).

[0090] In N d =20bp stress aptamer molecules, the sequence of chain A was kept unchanged, and 2 to 4 bases were deleted from both ends of the random sequence chain B to obtain stress aptamer molecules SAM with flexible single chain lengths of 2nt and 4nt respectively. 20-18 、SAM 20-16 Isothermal titration calorimetry results showed that SAM 20-18 、SAM 20-16 The binding constant K d are 3.755×10 -6 M, 5.162×10 -5 M( Figure 8 a) Compared with SAM 20-20 (2.863×10 -6 M), the binding constant K of the stress aptamer molecule d As the length of the flexible single chain increases, the stress aptamer molecule SAM with flexible single chain lengths of 2nt and 4nt increases. 20-18 、SAM 20-16 The entropy values ​​ΔS of the system in the titration reaction were -207.5 J / mol·k and -249.6 J / mol·k, which were significantly different from those of the SAM without the addition of the flexible single chain. 20-20(-76.87 J / mol·k) and the entropy of the system is also reduced ( Figure 8 b).

[0091] In N d =18bp stress aptamer molecule, the sequence of chain A is kept unchanged, and two bases are deleted at both ends of the random sequence chain B to obtain a stress aptamer molecule SAM with a flexible single chain length of 2nt 18-16 Isothermal titration calorimetry results showed that SAM 18-16 The binding constant K d is 6.608×10 -5 M( Figure 9 a) Stress aptamer molecule SAM without flexible single chain 18-18 (4.023×10 -6 M) compared with the binding constant ( Figure 9 a). And after the reaction, SAM 18-16 The entropy of SAM is -117.1 J / mol·k, which is similar to that of SAM without flexible single chain. 18-18 (-43.40 J / mol·k) The entropy of the system also changed significantly ( Figure 9 b).

[0092] In the process of regulating the binding affinity of stress aptamer molecules by introducing flexible single chains, the most significant feature is that when the double-stranded component of the molecular clamp is shortened to 16 bp, the binding constant K of all stress aptamer molecules is d The present application believes that this binding constant K d The mutation is consistent with the cause when no flexible single chain is introduced, that is, the rapid increase in the elastic energy of the double-stranded region of the molecular clamp triggers the conversion of the SDM aptamer conformation. At the same time, under the premise of keeping the length of the double-stranded component unchanged, as the length of the flexible single chains at both ends of the aptamer gradually increases, the binding constant K of the stress aptamer molecule to the target increases. d is also gradually decreasing. This shows that the presence of the flexible single chain does, to a certain extent, partially release the mechanical stress exerted by the double-stranded molecular clamp on the SDM aptamer. In addition, some studies have considered that internal energy and entropy are key factors affecting polymer stretching after simulating the relationship between energy and entropy distribution during DNA stretching. In the experiments of this application, the entropy value ΔS of several sets of titration reactions with the introduction of flexible single chains obviously decreases with the increase of the length of the flexible single chain. And the entropy value ΔS of several sets of titration reactions with the introduction of flexible single chains are all less than zero as a whole and are less than the stress aptamer molecules without the introduction of flexible single chains. It should be noted that in the process of introducing flexible single chains to regulate the affinity of the aptamer, the binding of the aptamer to the target depends to a large extent only on the changes in the length of the molecular clamp double chain and the flexible single chain. Therefore, after changing the length of the flexible single chain by only 2 to 4 nt, the binding constant K d There are minor changes, but this also reflects the accuracy of the regulation.

[0093] In order to explore the effect of the change of the gap width of the molecular tweezers on the affinity of the sulfadimethoxine aptamer, this application constructed stress aptamer molecules SAM with different gap widths. 16-17 (gap=1), SAM 16-18 (gap=2), SAM 16-19 (gap=3), and the binding constants K of several groups of stress aptamer molecules were determined using isothermal titration calorimetry. d and other thermodynamic parameters.

[0094] Isothermal titration results showed that when the gap width increased from 0 to 3 nt, the binding constant K d From SAM 16-16 (54.55μM) reduced to SAM 16-17 (3.721μM), SAM 16-18 (0.602μM), SAM 16-19 (2.654μM)( Figure 10 a). The increase in the width of the molecular clamp gap increases the binding constant K of the stress aptamer molecule. d Gradually decreases, that is, the binding affinity of the target sulfamethoxazole to the aptamer increases. Different from the fine regulation of the affinity of the SDM aptamer by the flexible single chain, the binding constant of the stress aptamer molecule changes significantly when the width of the gap in the double-stranded region of the molecular clamp is changed by only 1 to 3 bases. This shows that the increase in the width of the gap effectively releases the elastic energy stored in the double-stranded region of the molecular clamp. In addition, as the width of the gap increases, the entropy value ΔS of the system changes from SAM to 16-16 (29.92 J / mol·k) quickly decreases to SAM 16-18 (-254.6 J / mol·k), showing an overall downward trend ( Figure 10 b) The significant decrease in entropy ΔS indicates that the disorder level of the entire reaction system is decreasing.

[0095] In summary, in the process of precise regulation of the affinity of the sulfadimethoxine aptamer based on molecular tweezers, the binding of the aptamer to the target is mainly determined by the length of the double-stranded molecular tweezers and the flexible single chain. When the length of the molecular tweezers is in the range of 24 to 18 bp, the binding of the stress aptamer molecule to the target weakens as the length of the molecular tweezers decreases. In this range, the introduction of the flexible single chain flexibly adjusts the binding of the stress aptamer molecule to the target. However, when the length of the molecular tweezers is shortened to 16 bp, the double-stranded molecular tweezers dominates, that is, at this time, the binding of the stress aptamer molecule to the target is mainly restricted by the double-stranded molecular tweezers. In addition, the present application also releases the elastic energy stored in the double-stranded region of the molecular tweezers to a great extent by changing the width of the gap in the double-stranded region, resulting in a reduction in the mechanical stress acting on the aptamer, enhancing the binding of the aptamer to the target sulfadimethoxine, and improving the binding affinity. It is worth noting that, despite the combined action of the double-stranded molecular tweezers and the flexible single chain, the binding affinity of the aptamer M5 has decreased slightly. However, this application believes that this situation will not affect the practicality of the corresponding strategy. Because the molecular clamp structure is adjustable, this adjustability can make the precise regulation of aptamer affinity more flexible, and the affinity can be appropriately adjusted according to actual needs. At the same time, the special double-stranded structure of the molecular clamp further improves the stability of the binding between the aptamer and the target, which overall ensures the effectiveness of this strategy in practical applications.

[0096] Figure 11 The results of the circular dichroism spectrum clearly show that the complex formed by the M5 aptamer and SDM presents an obvious absorption peak at 216nm. 16–18 After (Gap=2), the intensity of the CD peak increased significantly, accompanied by a red shift, indicating that the application of the molecular clamp stabilized the binding of the M5 aptamer to the target SDM.

[0097] The effectiveness of the two sensors in detecting different concentrations of SDM was compared. By comparing the ultraviolet absorption of the supernatant at 260nm, it was found that the ultraviolet absorption of the supernatant of the molecular tweezers SAM-MC sensor was significantly higher than that of the aptamer-based M5-MC sensor. This means that the complementary chain SA replaced in the supernatant of the SAM-MC sensor is more than that of the M5-MC sensor, which further proves that the SAM-MC sensor is more sensitive to the target SDM than the M5-MC sensor. In addition, when the concentration of the target SDM dropped to 10μM, the supernatant of the molecular tweezers SAM-MC sensor can still detect a relatively obvious ultraviolet absorption ( Figure 12 b).

[0098] At the same time, the present application also explored the selectivity of the sensor SAM-MC for different targets. By comparing the ultraviolet absorption of the supernatants of different targets at 260nm, the results showed that only the target sulfadimethoxine group showed obvious signal detection, while the other groups had only weak signals or no obvious signal output, which shows that the sensor of the present application has good selectivity ( Figure 12 c).

[0099] This application focuses on the sulfadimethoxine (SDM) aptamer and achieves precise control of its affinity through DNA molecular clamp technology. The study first determined the critical molecular clamp length N by time-lapse gel electrophoresis. c It was found that when the length of the molecular clamp was in the range of 24 to 18 bp, the binding constant K d It gradually increases with the shortening of the molecular clamp, but the change range is small (2.107~4.023μM). However, when the length of the molecular clamp is reduced to 16bp, K d The value increased significantly to 54.55 μM, indicating that the elastic energy of the molecular tweezers reached a threshold, leading to a significant change in the aptamer conformation. This nonlinear change reveals the threshold effect of mechanical stress on the aptamer conformation.

[0100] To ease the rigid constraints of the molecular clamp, the study introduced 2-6 nt flexible single chains at both ends of the aptamer. The results showed that the introduction of flexible single chains can partially release mechanical stress and reduce the system entropy. For example, in the 22 bp molecular clamp system, when the flexible chain increases from 0 to 6 nt, K d The K value increased from 2.62 μM to 20.89 μM, and ΔS decreased from -102.1 to -245.8 J / mol·K. Similarly, in the 20 / 18 bp system, the introduction of the flexible chain also significantly reduced the K value. d This suggests that the flexible single chain can act as a "molecular spring" to fine-tune the affinity by adjusting the relationship between mechanical stress and conformational flexibility.

[0101] In addition, the study further regulated the affinity of the aptamer by changing the gap width in the double-stranded region of the molecular clamp. The results showed that increasing the gap width significantly improved the binding ability of the aptamer to the target. For example, when the gap width increased from 0 to 2 nt, K d The kinetics of the aptamer were significantly decreased from 54.55 μM to 0.602 μM, and ΔS decreased from 29.92 to -254.6 J / mol·K. This magnitude change was attributed to the fact that the gap released the elastic energy stored in the double-stranded region, reducing the conformational tension of the aptamer. However, when the gap width increased to 3 nt, K d It rebounded to 2.654 μM, suggesting that there is an optimal gap size (2 nt in this application). A gap that is too large may destroy the structural stability of the molecular tweezers.

[0102] This application successfully constructed a multi-dimensional regulatory system based on DNA molecular clamps, realizing the SDM aptamer K d Precise regulation within the range of 0.602 to 66.08 μM was achieved. To verify that this regulatory mechanism is superior to sensing mechanisms relying solely on aptamers, this application developed a molecular tweezer-mediated magnetic bead biosensor. Experimental results demonstrated that the detection sensitivity of the molecular tweezer-mediated magnetic bead biosensor was superior to that of traditional strand-displacement magnetic bead biosensors.

[0103] As described above, the basic principles, main features and advantages of the present invention are well described. The above embodiments and descriptions are merely descriptions of preferred embodiments of the present invention, and the present invention is not limited to the above embodiments. Various changes and improvements made to the technical solutions of the present invention by those skilled in the art without departing from the spirit and scope of the present invention should fall within the scope of protection determined by the present invention.

Claims

1. A method for regulating the affinity of a nucleic acid aptamer, characterized in that: include: The nucleic acid aptamer to be adjusted is composed of chain A and chain B, wherein chain A consists of a specific aptamer sequence corresponding to the target and complementary sequences at both ends, and chain B and the complementary sequences completely hybridize to form a circular internal stress molecule; Changing at least two of the length of the molecular tweezers, the length of the flexible single chain, and the width of the gap of the molecular tweezers to regulate the binding constant between the nucleic acid aptamer to be adjusted and the target and the entropy of the system after binding; The complementary sequences at both ends of the aptamer sequence are molecular clamps, and changing the length of the molecular clamps can regulate the binding constant and the entropy value; Constructing a flexible single strand by keeping the sequence of chain A unchanged and sequentially deleting at least 2 bases at both ends of chain B to obtain a flexible single strand with a length of at least 2 nt. Changing the length of the flexible single strand controls the binding constant and the entropy value. The gap width of the molecular clamp is constructed by adding at least one non-complementary base to the chain A in the middle region of the chain B, corresponding to a gap of the molecular clamp with a width of at least 1 nt. Changing the gap width of the molecular clamp regulates the binding constant and the entropy value.

2. The method for regulating nucleic acid aptamer affinity according to claim 1, characterized in that: The length of the molecular tweezers is 16 to 24 nt, the length of the flexible single chain is 2 to 6 nt, and the width of the gap of the molecular tweezers is 1 to 3 nt.

3. The method for regulating nucleic acid aptamer affinity according to claim 2, characterized in that: The length of the molecular tweezers is negatively correlated with the binding constant, the length of the flexible single chain is negatively correlated with the binding constant, and the gap width of the molecular tweezers reduces the binding constant.

4. The method for regulating nucleic acid aptamer affinity according to claim 2, characterized in that: The length of the molecular tweezers is negatively correlated with the binding constant, the length of the flexible single chain is negatively correlated with the binding constant, and the gap width of the molecular tweezers reduces the binding constant.

5. The method for regulating nucleic acid aptamer affinity according to claim 2, characterized in that: The length of the molecular tweezers is negatively correlated with the entropy value, the length of the flexible single chain is negatively correlated with the entropy value, and the gap width of the molecular tweezers reduces the entropy value.

6. A nucleic acid aptamer, characterized in that The method for regulating the affinity of nucleic acid aptamers according to any one of claims 1 to 5 is used to obtain the nucleic acid aptamer.

7. A nucleic acid aptamer, characterized in that The nucleic acid aptamer is composed of chain A and chain B; The sequence of the chain A is 5′-R1-SAM aptamer-R2-3′, and the sequence of the basic chain B is 5′-R3-R4-3′; The SAM aptamer is a specific aptamer sequence corresponding to the target; The R1 and the R2 are each independently a random sequence with a GC content of 40 to 60%, the R1 and the R2 are identical in length and are 8 to 12 nt, and the R3 and the R4 are completely hybridized with the R1 and the R2 to form a circular internal stress molecule; The sequence of chain B is 5′-R5-R6-3′; R5 is the sequence of R3 with 1 to 3 nt bases removed from the 5' or 3' end and 1 to 3 nt T bases inserted at non-terminal ends; The R6 is a sequence obtained by reducing 1 to 3 nt bases at the 5′ end or the 3′ end of the R4 and inserting 1 to 3 nt T bases at non-terminal ends.

8. The nucleic acid aptamer according to claim 7, characterized in that The target is sulfadimethoxine, the sequence of the SAM aptamer is shown in SEQ ID NO: 1, the sequence of the chain A is shown in SEQ ID NO: 2, and the sequence of the chain B is shown in SEQ ID NO:

3.

9. A biosensor for detecting sulfadimethoxine, characterized in that: The biosensor comprises the nucleic acid aptamer according to any one of claims 7 to 8.

10. Use of the method for regulating nucleic acid aptamer affinity according to any one of claims 1 to 5 in improving the binding constant and entropy value between nucleic acid aptamers and targets.

Images