Method for detecting rat parvovirus KRV strain through real-time fluorescent PCR and application

Through real-time fluorescence PCR technology, specific primers and TaqMan probes were designed to optimize reaction conditions, and the low sensitivity and time-consuming detection of rat parvovirus KRV strain were solved, rapid and accurate quantitative analysis was achieved, and detection efficiency and accuracy were improved.

CN120536632APending Publication Date: 2025-08-26GANNAN INST OF INNOVATION & TRANSLATIONAL MEDICINE
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510188732.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-02-20
Publication Date
2025-08-26

AI Technical Summary

Technical Problem

The existing PCR detection technology has low sensitivity to rat parvovirus KRV strains, which cannot achieve accurate quantitative analysis, and the detection process is cumbersome and takes a long time.

Method used

Real-time fluorescence PCR technology is used to design specific primer pairs and TaqMan probes, optimize reaction conditions, and sample processing and fluorescence quantitative PCR amplification are combined with Novozan's virus extraction kit to achieve rapid and accurate quantitative detection of rat parvovirus KRV strain.

Benefits of technology

High sensitivity detection of rat parvovirus KRV strain is achieved, which shortens detection time, improves detection efficiency, reduces cost, and has high accuracy and specificity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120536632A_ABST
    Figure CN120536632A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of real-time fluorescent PCR (polymerase chain reaction) detection and analysis, in particular to a method for detecting a rat parvovirus KRV strain through real-time fluorescent PCR and application of the method. The method comprises the following steps: (1) sample pretreatment: taking rat visceral organ tissues, cecum contents or excrement, blood, swabs and cell cultures as experimental animal detection samples; adding normal saline with the same volume to prepare homogenate, centrifuging, and collecting supernate for detection; blood and ascites are directly used for detection; (2) virus extraction: taking 200 [mu] L of the treated sample, carrying out virus extraction by adopting a FastPure Viral DNA / RNA Mini Kit (RC311-01) kit of the Norazan company, and taking a proper amount of final product sample virus as a subsequent template; and (3) carrying out real-time fluorescent quantitative PCR amplification by using the specific primer designed by the invention and a TaqMan probe, collecting a fluorescent signal, and carrying out analysis and judgment.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of real-time fluorescence PCR detection and analysis technology, and in particular to a method and application of real-time fluorescence PCR detection of rat parvovirus KRV strain. Background Art

[0002] The rat parvovirus (KRV) strain was first isolated by Kilham et al. in 1959 from a rat tumor. It is a small (15 to 30 nm) DNA animal virus, known as Kilham rat virus (KRV), belonging to the genus Parvovirus. KRV was originally isolated from a rat sarcoma in the late 1950s and is significantly different from other serotypes. It has been shown to be widely transmitted as a latent infection in normal rats. Injection into newborn hamsters can cause acute, fatal illness or specific growth and developmental abnormalities. Pregnant rats infected with KRV are absorbed by the fetus, leading to partial or complete fetal death. Infected rat pups develop symptoms including ataxia, jaundice, diarrhea, or sudden death. Infection in adult rats is often latent, but some may also develop symptoms such as hair stand-up, dehydration, and scrotal cyanosis. KRV is now a mandatory test item for laboratory rat virus testing in the national standard for laboratory animals, GB / T 14926.31-2022.

[0003] The current method for detecting rat parvovirus KRV in experimental animals is PCR technology. PCR technology refers to the process of amplifying and detecting specific DNA sequences or genes using PCR (polymerase chain reaction) technology. It is an in vitro method for amplifying DNA fragments, based on DNA replication and the enzymatic activity of DNA polymerase. Although PCR technology can sensitively detect and amplify target DNA sequences, its sensitivity is relatively low, requiring subsequent electrophoresis analysis to confirm the amplification results. The experiment is also time-consuming and can only provide qualitative analysis, unable to directly provide quantitative information on the amount of starting DNA template, making accurate quantitative analysis impossible and subject to numerous limitations.

[0004] Real-time fluorescence PCR, also known as quantitative real-time polymerase chain reaction (qPCR), is a molecular biology technique based on the polymerase chain reaction (PCR) principle that quantitatively analyzes specific DNA fragments by monitoring fluorescence signals in real time. Real-time fluorescence PCR is based on conventional PCR but incorporates specific fluorescent probes into the reaction system. The accumulated fluorescence signal is used to monitor the entire PCR process in real time. Fluorescence emission during each cycle indirectly reflects the amount of target gene amplified by PCR, and the amplification curve is used to qualitatively or quantitatively analyze unknown templates. qPCR utilizes fluorescently labeled DNA-binding dyes or fluorescently labeled probes to ensure that the intensity of the fluorescence signal during PCR amplification is proportional to the amount of target DNA, enabling quantitative analysis of the target DNA. Compared to PCR, qPCR is generally more sensitive and can detect lower concentrations of DNA template, which is particularly important for low-concentration samples. qPCR's ability to monitor the fluorescence signal in real time during DNA amplification allows for accurate measurement of the amount of starting DNA template and quantitative analysis, a key advantage for applications requiring precise DNA quantity measurement. At the same time, the real-time monitoring function of qPCR makes the experimental process faster and shortens the detection time. It is an efficient, sensitive and reliable molecular biology technology that can play a vital role in many fields. Therefore, finding a method for real-time fluorescence PCR detection of rat parvovirus KRV strain is a technical problem that needs to be solved urgently by technicians in this field. Summary of the Invention

[0005] In response to the deficiencies in the existing technology and actual needs, the present invention provides a method for detecting rat parvovirus KRV strain by real-time fluorescence PCR, which has the characteristics of higher sensitivity and shorter experimental time. It is a primer-probe combination and detection method suitable for large-scale sample detection in experimental rats, which can improve the work efficiency of rat parvovirus KRV strain detection, quickly and efficiently complete the detection of rat parvovirus KRV strain, save time and cost, and solve the problems of cumbersome detection methods, limitations, and low sensitivity in the existing technology.

[0006] In order to achieve the above object, the present invention provides the following technical solutions:

[0007] In one aspect of the present invention, a fluorescent quantitative PCR detection reagent for rat parvovirus KRV strain is provided, comprising a primer pair and a probe, wherein the nucleotide sequence of the primer pair is as follows:

[0008] Upstream primer (KRV-F): 5′-ATGTACCAGTCCACCAAGGG-3′;

[0009] Downstream primer (KRV-R): 5'-TTTGAATTCTGCCGCGCTTA-3'.

[0010] Furthermore, the nucleotide sequence of the probe is as follows:

[0011] 5'-FAM-TGCTCACTAGATGGCGCTCGCCCTCT-BHQ1-3'.

[0012] Furthermore, the kit also includes: a KRV-1000g positive control substance containing a KRV sequence.

[0013] Another aspect of the present invention provides a fluorescent quantitative PCR detection method for rat parvovirus KRV strain, comprising the following steps:

[0014] (1) Sample pretreatment: Rat organ tissues, cecal contents or feces, blood, swabs, and cell cultures were used as experimental animal test samples. An equal volume of physiological saline was added to the tissue sample to prepare a homogenate, which was then centrifuged and the supernatant was collected for testing. Blood and ascites were used directly for testing.

[0015] (2) Virus extraction: 200 μL of the processed sample was extracted using the FastPure Viral DNA / RNA Mini Kit (RC311-01) from Novagen. The extraction procedure was performed according to the instructions in the kit, and an appropriate amount of the final product sample virus was used as a subsequent template.

[0016] (3) Real-time fluorescence quantitative PCR amplification was performed using the specific primers designed by the present invention and TaqMan probes, and the fluorescence signals were collected and analyzed and determined.

[0017] Furthermore, the fluorescent quantitative PCR amplification system is: 10 μL of 2×AceQ U+qPCR Probe MasterMix, 0.8 μL of 10 μmol / L forward and reverse primers, 0.5 μL of 10 μmol / L TaqMan probe, 2 μL of DNA template, and 5.9 μL of ddH2O, with a total reaction system of 20 μL.

[0018] Furthermore, the reaction conditions of the fluorescent quantitative PCR amplification are as follows: decontamination at 37°C for 2 minutes; pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds; annealing at 54°C for 30 seconds; extension at 72°C for 30 seconds, and fluorescence collection for 40 cycles, and single-point fluorescence detection at 70°C.

[0019] Furthermore, the fluorescence signal analysis and judgment method: 1) if the sample to be tested has no fluorescence amplification curve, the sample is judged to be negative for rat parvovirus KRV strain nucleic acid; 2) if the sample to be tested has a fluorescence amplification curve and the Ct value should be ≤38, the sample is judged to be positive for rat parvovirus KRV strain nucleic acid; 3) if the Ct value of the sample to be tested is between 38 and 40, the real-time fluorescence PCR test should be re-performed; after re-testing, if the Ct value is ≥40, the sample is judged to be negative for rat parvovirus KRV strain nucleic acid; if the Ct value after re-testing is still between 38 and 40, the sample is judged to be suspected positive for rat parvovirus KRV strain nucleic acid, and further sequence determination is required.

[0020] The following are the sequences involved in the present invention:

[0021] Upstream primer (KRV-F): 5′-ATGTACCAGTCCACCAAGGG-3′;

[0022] Downstream primer (KRV-R): 5'-TTTGAATTCTGCCGCGCTTA-3'.

[0023] The nucleotide sequence of the probe is as follows:

[0024] 5'-FAM-TGCTCACTAGATGGCGCTCGCCCTCT-BHQ1-3'.

[0025] The nucleotide sequence of the positive control KRV-1000g is as follows:

[0026]

[0027]

[0028] Beneficial effects of the present invention:

[0029] 1. The present invention optimizes the reaction conditions of the fluorescence quantitative PCR detection method by designing specific primer pairs and TaqMan probes, thereby quickly, accurately and specifically detecting the rat parvovirus KRV strain. It can not only screen a large sample of experimental rats, but also perform real-time and precise detection and quantitative analysis of the nucleic acid of the pathogen in the sample with high accuracy, simple operation and low cost.

[0030] 2. The minimum detectable template concentration of the fluorescent quantitative PCR detection method of the present invention is 1.01×10 2The detection method and kit of the present invention have high sensitivity, strong specificity and good repeatability, and have broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art.

[0032] Figure 1 The standard curve of the TLV TaqMan fluorescent quantitative PCR detection method of Example 1 of the present invention;

[0033] Figure 2 This is a kinetic curve diagram of the TLV TaqMan probe qPCR of Example 2 of the present invention;

[0034] Figure 3 4 is a graph showing the specific results of the TLV Taqman fluorescence quantitative PCR detection method of Example 4 of the present invention;

[0035] Figure 4 This is a graph showing the clinical sample testing results of Example 5 of the present invention. DETAILED DESCRIPTION

[0036] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts shall fall within the scope of protection of the present invention.

[0037] Experimental methods without specific conditions specified in the examples were generally performed according to conventional conditions or the conditions specified by the manufacturers.

[0038] The present invention addresses the problems of cumbersome, limited, and low-sensitivity detection methods for rat parvovirus KRV strains in the prior art. A method for detecting rat parvovirus KRV strains using real-time fluorescence PCR is provided. The method has the advantages of higher sensitivity and shorter experimental time, and can improve the efficiency of rat parvovirus KRV strain detection, quickly and efficiently complete the detection of rat parvovirus KRV strains, and save time and cost. The specific implementation scheme includes the following steps:

[0039] (1) Sample pretreatment: Rat organ tissues, cecal contents or feces, blood, swabs, and cell cultures were used as experimental animal test samples. An equal volume of physiological saline was added to the tissue sample to prepare a homogenate, which was then centrifuged and the supernatant was collected for testing. Blood and ascites were used directly for testing.

[0040] (2) Virus extraction: 200 μL of the processed sample was extracted using the FastPure Viral DNA / RNA Mini Kit (RC311-01) from Novagen. The extraction procedure was performed according to the instructions in the kit, and an appropriate amount of the final product sample virus was used as a subsequent template.

[0041] (3) Real-time fluorescence quantitative PCR amplification was performed using the specific primers designed by the present invention and TaqMan probes, and the fluorescence signals were collected and analyzed and determined.

[0042] Furthermore, the fluorescent quantitative PCR amplification system is: 10 μL of 2×AceQ U+qPCR Probe MasterMix, 0.8 μL of 10 μmol / L forward and reverse primers, 0.5 μL of 10 μmol / L TaqMan probe, 2 μL of DNA template, and 5.9 μL of ddH2O, with a total reaction system of 20 μL.

[0043] Furthermore, the reaction conditions of the fluorescent quantitative PCR amplification are as follows: decontamination at 37°C for 2 minutes; pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds; annealing at 54°C for 30 seconds; extension at 72°C for 30 seconds, and fluorescence collection for 40 cycles, and single-point fluorescence detection at 70°C.

[0044] Furthermore, the fluorescence signal analysis and judgment method: 1) if the sample to be tested has no fluorescence amplification curve, the sample is judged to be negative for rat parvovirus KRV strain nucleic acid; 2) if the sample to be tested has a fluorescence amplification curve and the Ct value should be ≤38, the sample is judged to be positive for rat parvovirus KRV strain nucleic acid; 3) if the Ct value of the sample to be tested is between 38 and 40, the real-time fluorescence PCR test should be re-performed; after re-testing, if the Ct value is ≥40, the sample is judged to be negative for rat parvovirus KRV strain nucleic acid; if the Ct value after re-testing is still between 38 and 40, the sample is judged to be suspected positive for rat parvovirus KRV strain nucleic acid, and further sequence determination is required.

[0045] The following are the sequences involved in the present invention:

[0046] Upstream primer (KRV-F): 5′-ATGTACCAGTCCACCAAGGG-3′;

[0047] Downstream primer (KRV-R): 5'-TTTGAATTCTGCCGCGCTTA-3'.

[0048] The nucleotide sequence of the probe is as follows:

[0049] 5'-FAM-TGCTCACTAGATGGCGCTCGCCCTCT-BHQ1-3'.

[0050] The nucleotide sequence of the positive control KRV-1000g is as follows:

[0051]

[0052]

[0053] Example 1

[0054] The present invention provides a method for detecting rat parvovirus KRV strain using real-time fluorescence PCR. Specifically, the establishment process of the real-time fluorescence PCR detection method for rat parvovirus KRV strain is as follows:

[0055] (1) Design of primers and probes

[0056] Log in to the NCBI website, and according to the complete genome sequence of rat parvovirus KRV strain published on NCBI, select the conserved sequences of rat parvovirus KRV strain genome (KM999994.1 and AF036711) through BLAST comparison analysis, and use SnapGene software to design primers and probes. A pair of specific primers and a specific probe were designed and synthesized in the conserved region NT623-NT802. The results are shown in Table 1.

[0057] Table 1

[0058] Primer sequence (5'-3') KRV-F ATGTACCAGTCCACCAAGGG KRV-R TTTGAATTCTGCCGCGCTTA KRV-P FAM-TGCTCACTAGATGGCGCTCGCCCTCT-BHQ1

[0059] Among them, the fluorescent group modified at the 5' end is not limited to FAM, VIC, ROX, HEX, CY5, TET, etc., and the quenching group modified at the 3' end is not limited to BHQ1, BHQ2, BHQ3, DABCYL, TAMRA, etc.

[0060] (2) Preparation of standard plasmid

[0061] A KRV sequence was synthesized and inserted into the pUC57 plasmid to create plasmid KRV-1000g, which was used as a KRV plasmid standard. The concentration of the extracted plasmid was determined and the copy number per μL of plasmid was calculated. The plasmid was diluted to a concentration of 1.01×10 8 , 1.01×10 7 , 1.01×10 6 , 1.01×105 , 1.01×10 4 , 1.01×10 3 , 1.01×10 2 , 1.01×10 1 The copies / μL were measured and the Ct value was calculated as the positive standard. The results are shown in Table 2.

[0062] Table 2

[0063] Serial number Plasmid concentration copies / μL Ct value 1 <![CDATA[1.01×10 8 ]]> 13.21 2 <![CDATA[1.01×10 7 ]]> 15.42 3 <![CDATA[1.01×10 6 ]]> 20.11 4 <![CDATA[1.01×10 5 ]]> 25.43 5 <![CDATA[1.01×10 4 ]]> 30.25 6 <![CDATA[1.01×10 3 ]]> 32.91 7 <![CDATA[1.01×10 2 ]]> 35.82 8 <![CDATA[1.01×10 1 ]]> 0

[0064] The nucleotide sequence of the positive control KRV-1000g is as follows:

[0065]

[0066]

[0067] (3) Fluorescence quantitative PCR reaction system

[0068] The total reaction system of fluorescence quantitative PCR amplification was 20 μL. The specific raw materials and their dosages are shown in Table 3.

[0069] Table 3

[0070] name Dosage / Serving 2×AceQ U+qPCR Probe Master Mix 10 μL Forward primer (10 μmol / L) 0.8μL Reverse primer (10 μmol / L) 0.8μL Probe (10 μmol / L) 0.5μL DNA template 2μL ddH2O 5.9μL Total volume 20 μL

[0071] The reaction process of fluorescent quantitative PCR amplification reaction is removal of contamination, pre-denaturation, denaturation, annealing, and extension. The specific reaction conditions are shown in Table 4.

[0072] Table 4

[0073]

[0074] (4) Establishment of fluorescence quantitative PCR standard curve

[0075] The constructed KRV-1000g plasmid standard was serially diluted to a final concentration of 1.01×10 1 ~1.01×10 8 The TLV probe method TaqMan fluorescence quantitative PCR was performed, and the logarithm of the starting template concentration and the corresponding Ct value were used to draw a standard curve. The results are shown in the figure. Figure 1 , the results show that: the correlation coefficient R 2 =0.9871, which shows that there is a good linear relationship between the logarithmic values ​​of different gradient quantitative templates and the Ct value, and the standard curve has good linearity.

[0076] Example 2 Sensitivity Experiment

[0077] Using KRV-1000g plasmid standard as template, serial gradient dilutions were performed to make the final concentrations range from 1.01×10 1 ~1.01×10 8 The number of copies / μL was determined by fluorescence quantitative PCR amplification. A Ct value greater than 40 was considered negative. Three replicates were made for each concentration of the standard. Amplification curves were drawn under different concentrations of templates. The results are shown in Figure 2 The results showed that this method has high sensitivity, and the minimum detectable template concentration is 1.01×10 2 copies / μL, which is nearly 10 times higher than the conventional PCR method and is more efficient and sensitive.

[0078] Example 3 Repeatability Experiment

[0079] The optimized reaction conditions were used to prepare 1.01×10 6 and 1.01×10 4 DNA with two dilutions of 100 copies / μL was used as a template. Real-time fluorescence quantitative PCR was performed according to the above-mentioned amplification system and conditions. Three replicates were set for each concentration. Two different time points were selected for detection. The mean Ct value, standard deviation and coefficient of variation were calculated. The results are shown in Table 5.

[0080] Table 5

[0081]

[0082] Example 4 Specificity Experiment of Rat Parvovirus KRV Strain Real-time Fluorescence Quantitative PCR Method

[0083] Sendai virus, mouse hepatitis virus, mouse parvovirus, rat parvovirus H-1 strain, mycoplasma, Pseudomonas aeruginosa, Salmonella, and rat parvovirus KRV strain were tested to verify the specificity of the KRV real-time fluorescence quantitative PCR detection method. The reaction conditions and reaction system were all carried out according to the method in Example 1. The Ct value results are shown in Table 6, and the qPCR detection results are shown in Table 6. Figure 3 .

[0084] Table 6

[0085]

[0086] It can be seen from the above experimental results and data that the test results using Sendai virus, mouse hepatitis virus, mouse parvovirus, rat parvovirus H-1 strain, mycoplasma, Pseudomonas aeruginosa, and Salmonella as templates are negative, and there is no fluorescence amplification curve for the sample to be tested. However, the test result using rat parvovirus KRV strain as a template is positive, and the Ct value is 15.34, which meets the condition of Ct value ≤ 38, and there is a fluorescence amplification curve for the sample to be tested. Therefore, the results show that the established fluorescence quantitative PCR detection method has no cross reaction with other rat viral pathogens to be tested and has good specificity.

[0087] Example 5 Method Application

[0088] Ten samples of experimental animals stored in our laboratory were collected. The experimental animal test samples included rat organ tissues, cecal contents or feces, blood, swabs, and cell culture samples. The sample numbers were: ①, C, ①', P, I, B, S, ②, B', C'. The established fluorescent quantitative PCR detection method was used for detection. The specific steps of the experiment were as follows:

[0089] 1) Extraction of sample virus: 200 μL of the processed sample was extracted using the FastPure Viral DNA / RNA Mini Kit (RC311-01) from Novagens. The extraction procedure was performed according to the kit instructions, and an appropriate amount of the final product sample virus was used as a template for subsequent extraction.

[0090] 2) Real-time fluorescence quantitative PCR amplification: Real-time fluorescence quantitative PCR amplification was performed using the specific primers designed in Example 1 of the present invention and the TaqMan probe. The total reaction volume was 20 μL, including: 10 μL of 2×AceQU+qPCR Probe Master Mix, 0.8 μL of each 10 μmol / L forward and reverse primer, 0.5 μL of 10 μmol / L TaqMan probe, 2 μL of DNA template, and 5.9 μL of ddH2O. The reaction conditions were: decontamination at 37°C for 2 minutes; pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds; annealing at 54°C for 30 seconds; extension at 72°C for 30 seconds, and fluorescence acquisition for 40 cycles. Single-point fluorescence detection was performed at 70°C. The results are shown in the table. Figure 4 The results showed that there was no positive fluorescence amplification curve in the experimental animal samples, which was always a horizontal line, indicating that the rat parvovirus KRV strain in the experimental animal samples was negative and there was no KRV infection.

[0091] Finally, it should be emphasized that the above is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various changes and modifications. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A fluorescent quantitative PCR detection reagent for rat parvovirus KRV strain, characterized in that: Comprising a primer pair and a probe, the nucleotide sequence of the primer pair is as follows: Upstream primer (KRV-F): 5′-ATGTACCAGTCCACCAAGGG-3′; Downstream primer (KRV-R): 5'-TTTGAATTCTGCCGCGCTTA-3'.

2. The fluorescent quantitative PCR detection reagent for rat parvovirus KRV strain according to claim 1, characterized in that: The nucleotide sequence of the probe is as follows: 5'-FAM-TGCTCACTAGATGGCGCTCGCCCTCT-BHQ1-3'.

3. The fluorescent quantitative PCR detection reagent for rat parvovirus KRV strain according to claim 1, characterized in that: Also includes: KRV-1000g positive control containing the KRV sequence.

4. Use of the fluorescent quantitative PCR detection reagent according to any one of claims 1 to 3 in real-time fluorescent PCR detection technology for rat parvovirus KRV strain.

5. A method for detecting rat parvovirus KRV strain by real-time fluorescence PCR, characterized in that: The following steps are involved: (1) Sample pretreatment: Rat organ tissues, cecal contents or feces, blood, swabs, and cell cultures were used as experimental animal test samples. An equal volume of physiological saline was added to the tissue sample to prepare a homogenate, which was then centrifuged and the supernatant was collected for testing. Blood and ascites were used directly for testing. (2) Virus extraction: 200 μL of the processed sample was extracted using the FastPure Viral DNA / RNA Mini Kit (RC311-01) from Novagen. The extraction procedure was performed according to the instructions in the kit, and an appropriate amount of the final product sample virus was used as a subsequent template. (3) Using the primer pair and probe described in claim 1 to perform real-time fluorescence quantitative PCR amplification, collecting the fluorescence signal and performing analysis and determination.

6. The method for detecting rat parvovirus KRV strain by real-time fluorescent PCR according to claim 5, characterized in that: The fluorescent quantitative PCR amplification system is as follows: 10 μL of 2×AceQ U+qPCR Probe Master Mix, 0.8 μL of each of 10 μmol / L forward and reverse primers, 0.5 μL of 10 μmol / L TaqMan probe, 2 μL of DNA template, and 5.9 μL of ddH2O, with a total reaction system of 20 μL.

7. The method for detecting rat parvovirus KRV strain by real-time fluorescent PCR according to claim 5, characterized in that: The reaction conditions of the fluorescent quantitative PCR amplification are as follows: decontamination at 37°C for 2 minutes; pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds; annealing at 54°C for 30 seconds; extension at 72°C for 30 seconds, and fluorescence collection for 40 cycles, followed by single-point fluorescence detection at 70°C.

8. The method for detecting rat parvovirus KRV strain by real-time fluorescent PCR according to claim 5, characterized in that: The fluorescence signal analysis and judgment method includes the following steps: 1) if the sample to be tested has no fluorescence amplification curve, the sample is judged to be negative for the rat parvovirus KRV strain nucleic acid; 2) if the sample to be tested has a fluorescence amplification curve and the Ct value is ≤38, the sample is judged to be positive for the rat parvovirus KRV strain nucleic acid; 3) if the Ct value of the sample to be tested is between 38 and 40, the real-time fluorescence PCR test should be re-performed; after re-testing, if the Ct value is ≥40, the sample is judged to be negative for the rat parvovirus KRV strain nucleic acid; if the Ct value after re-testing is still between 38 and 40, the sample is judged to be suspected positive for the rat parvovirus KRV strain nucleic acid and further sequence determination is required.