CRISPR (clustered regularly interspaced short palindromic repeats) mediated red fluorescence labeled sheep fibroblast line and application thereof

By designing MSTN/sgRNA sites in the sheep genome and using the CRISPR-mediated Gal4/Cas9 system, site-directed knock-in of red fluorescent genes was achieved, solving the problems of inefficiency and insertion randomness of CRISPR gene editing research in sheep cells, and improving editing efficiency and stability.

CN120555367AActive Publication Date: 2025-08-29ACADEMY OF MILITARY MEDICAL SCIENCES
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202511052850.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-30
Publication Date
2025-08-29
Estimated Expiration
2045-07-30

AI Technical Summary

Technical Problem

In sheep cells, CRISPR gene editing research has problems such as cumbersome experimental steps, long cycles and high cost, and random insertion of red fluorescent genes may affect gene expression and p53 signaling pathway, resulting in low editing efficiency.

Method used

The MSTN/sgRNA safety sites were designed in the sheep genome, and the CRISPR-mediated Gal4/Cas9 system was used to construct a donor template containing UAS sequence to achieve site-directed knock-in of red fluorescent genes, combined with puromycin enrichment conditions, and improve the efficiency and stability of gene editing.

Benefits of technology

The efficient site-directed integration of red fluorescent genes in sheep fibroblasts was achieved, which improved gene editing efficiency, shortened the preparation cycle, and avoided interference from random insertion and p53 signaling pathway.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention relates to a CRISPR (clustered regularly interspaced short palindromic repeats)-mediated red fluorescence labeled sheep fibroblast line and application thereof in the field of variation or genetic engineering. The construction and the application of the CRISPR-mediated red fluorescence labeled sheep fibroblast line disclosed by the invention comprise the following steps: step 1, constructing a Cas9 site-directed knockout plasmid containing an MSTN gene target sequence; step 2, constructing a plasmid Donor-1 kb HA-mCherry containing a homologous arm of the MSTN (myostatin) gene; step 3, constructing a donor DNA containing a fluorescent protein mCherry expression cassette; and step 4, co-transfecting the donor DNA containing the fluorescent protein mCherry expression cassette and the fixed-point knockout plasmid in the step 1 into the sheep fibroblast cell line, so as to obtain the sheep fibroblast cell line marked by red fluorescence.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a CRISPR-mediated red fluorescently labeled sheep fibroblast cell line and its application in the field of mutation or genetic engineering. Background Art

[0002] The CRISPR / Cas9 system is a genome-directed editing technology developed in 2012. It consists of three components: the Cas9 endonuclease, CRISPR RNA (crRNA, identical to the genomic target site sequence), and a transactivating CRISPR RNA (tracrRNA). The crRNA and tracrRNA can be fused and simplified into a single-stranded guide RNA (sgRNA). Guided by the sgRNA, the Cas9 protein scans the genome for the PAM sequence (5'-NGG-3'), identifying and cleaving single-stranded DNA sequences identical to or complementary to the crRNA sequence. This induces double-strand breaks (DSBs) at the target site, activating the cell's non-homologous end joining (NHEJ) and homology-directed repair (HDR) mechanisms to achieve precise editing of the target gene. In the following years, based on Cas9, scientists successively discovered single- and double-stranded DNA editing tool enzymes such as Cas12a / Cas12b / Cas14a, as well as RNA editing tool enzymes such as Cas13a. Based on these Cas tool enzymes, they further developed a variety of derivative gene editing systems, including CBE and ABE single-base editing, PE-guided editing, CRISPRa gene activation, CRISPRi gene interference, and CRISPR whole-genome knockout / activation / interference. To this day, new Cas tool enzymes and their derivative systems are still being developed. These classic and new CRISPR systems are characterized by easy operation and high efficiency, and are widely used in research in biology, medicine, agriculture and other fields.

[0003] The advent of the CRISPR gene editing system has also greatly promoted the research and application of genetically modified large animals (sheep) in human disease models, improved production traits, disease-resistant breeding, bioreactors, and other aspects. However, in current sheep and goat gene editing research, when evaluating the gene editing efficiency of the CRISPR system, there are still pain points such as cumbersome experimental steps, long cycles, and high costs. For example, CasMINI is a recently discovered and the smallest known CRISPR system (529 aa). Compared with Cas9 and Cas12a, it is easier to be more efficiently delivered into cells through various delivery vectors such as AAV or LNP. In sheep cells, if you want to verify the gene editing effect of this new Cas tool enzyme, there are currently three main detection methods: T7E1 enzyme digestion, Sanger sequencing, and NGS. After transfecting the relevant gene targeting plasmid into sheep cells for a specific gene target in the genome, these traditional methods first require extracting the cell genome, then designing primers upstream and downstream of the target to carry out PCR amplification and DNA product purification, and finally through (1) T7E1 enzyme digestion + gel running, (2) TA cloning connection + transformation + plating + shaking + plasmid extraction + Sanger sequencing, or (3) sending to the company for deep sequencing + bioinformatics analysis and other complex experimental processes to know the precise gene editing efficiency.

[0004] Fetal skin fibroblasts are a commonly used primary tool cell in ovine CRISPR gene editing research and serve as nuclear donors for ovine somatic cell cloning. A simple, rapid, and reliable method involves site-specific knock-in of a fluorescent gene into the ovine fetal fibroblast genome (100% fluorescent cells) and evaluation of the gene editing efficacy of the CRISPR system by measuring the percentage of fluorescently labeled cells. For example, if only 60% of cells fluoresce after editing a fluorescent gene, as measured by fluorescence microscopy or flow cytometry, the editing efficiency is 40%. The teams of Professors Liu Dongjun, Wang Zhigang, and Xu Rigan at Inner Mongolia University have successfully constructed transgenic ovine and goat fetal fibroblast cell lines stably expressing red fluorescent protein (DFR) using G418 screening. However, in these positive clones, the DFR gene was randomly integrated into the genome, and due to regulatory influences from upstream and downstream genes, this randomly inserted DFR gene may be silenced. In addition, this random insertion method may affect the expression of the gene at the insertion site or the upstream and downstream genes in its signaling pathway, which brings many inconveniences to the subsequent application of red fluorescent-labeled sheep cell lines.

[0005] The applicant team previously successfully generated a monoclonal ovine fetal fibroblast cell line with the mCherry gene site-specifically integrated into the MSTN safe locus by electroporating a Cas9 plasmid and an mCherry donor template, combined with the addition of the small molecule p53 agonists RITA and Nutlin3. Under non-fluorescence and antibiotic enrichment conditions, the positive rate was 7.45%. However, this construction method has two limitations: First, the efficiency of site-specific integration of the red fluorescent gene is still not very high under non-enrichment conditions; second, the p53 gene regulates numerous cellular processes, including the cell cycle, cell proliferation, differentiation, apoptosis, and DNA damage repair, through sophisticated multi-pathway and multi-layered molecular mechanisms. Adding a p53 agonist, i.e., activating the p53 signaling pathway, could potentially affect the evaluation of gene editing efficacy using this mCherry-labeled ovine fetal fibroblast cell line using the CRISPR system (e.g., susceptibility to apoptosis and cell cycle arrest, which could affect editing efficiency). Therefore, the development of a red fluorescent ovine fetal fibroblast cell line with high gene knock-in efficiency that does not affect the normal transduction of the p53 signaling pathway remains of great research and application value.

[0006] Numerous studies have demonstrated that increasing the local concentration of donor template at the site of double-strand breaks induced by the CRISPR / Cas system is a strategy that can significantly improve HDR efficiency. Gal4 is a yeast transcriptional activator, 881 aa in size, primarily composed of a DNA binding domain (BD) and a transcriptional activation domain (AD). These two domains are structurally separable and functionally independent. The BD is a 1-147 peptide located at the N-terminus that recognizes and specifically binds to the upstream active sequence (UAS) in the promoter region of Gal4-responsive genes, such as those responsible for galactose metabolism enzymes like Gal1, Gal2, and Gal7. The UAS sequence is highly conserved, typically consisting of a 17-bp sequence: 5'-CGGRNNRCYNYNYNCNCCG-3'.

[0007] The team led by Associate Professor Xu Kun from Northwest Agriculture and Forestry University used GGS5 (five repeated GGS sequences) as a linker to fuse Gal4 / BD to the C-terminus of the Cas9 protein. Combined with the use of a donor template containing a UAS sequence (5'-AGGAAGACTCTCCTCCG-3') at the 5' end, they increased the gene knock-in efficiency of ultra-short DNA fragments (a few bp) at three gene loci in the tumor cell line 293T by 20% under puromycin-enriched conditions. Summary of the Invention

[0008] The main problem to be solved by the present invention is how to solve the problems of complicated experimental steps, long cycle and high cost when the current new CRISPR gene editing tool enzyme is used to carry out gene editing effect evaluation research at the sheep cell level; the problem of random insertion of red fluorescent genes in the research of creating stable red fluorescent sheep fibroblasts; the problem of low efficiency of site-directed knock-in of red fluorescent genes and activation of the p53 signaling pathway.

[0009] To address the above problems, the present invention provides an MSTN / sgRNA safe site for efficient site-specific knock-in of exogenous genes in the sheep genome, as well as a method for constructing a CRISPR-mediated red fluorescently labeled sheep fibroblast cell line and its application, providing tool cells for sheep CRISPR gene editing research with safe integration sites, high preparation efficiency, and no impact on the normal transduction of the p53 signaling pathway.

[0010] The present invention first provides a method for constructing a CRISPR-mediated red fluorescently labeled sheep fibroblast cell line, comprising the following steps: Step 1: Construct a site-directed knockout plasmid containing the Cas9 target sequence of the MSTN gene; Step 2: Construct the plasmid Donor-1 kb HA-mCherry containing the homology arms of the MSTN gene: The 1 kb upstream sequence of the MSTN gene is set as the left homology arm, and the 1 kb downstream sequence is set as the right homology arm; the Donor-1 kb HA-mCherry homology repair plasmid is constructed by connecting four DNA fragments, namely the left homology arm, the CMV-mCherry-pA expression structure, the right homology arm, and the pmCherry-N1 plasmid, using seamless cloning technology; The nucleotide sequence of the CMV-mCherry-pA expression construct is positions 1008-2628 of SEQ ID No: 4; Step 3: Construct donor DNA containing the fluorescent protein mCherry expression cassette: The Donor-1 kb HA-mCherry obtained in step 3 is amplified using primers to obtain a fluorescent protein mCherry expression cassette donor DNA with a UAS sequence; the nucleotide sequence of the UAS sequence is positions 3622-3638 of SEQ ID No: 5; Step 4. Preparation of red fluorescent labeled sheep fibroblast cell line: Furthermore, the sequence of the plasmid Donor-1 kb HA-mCherry is shown in SEQ ID No: 4.

[0011] Furthermore, the site-directed knockout plasmid containing the Cas9 target sequence of the MSTN gene can be pX459-MSTNsgRNA or pX330-MSTN sgRNA and pX330-Gal4 / Cas9-MSTN sgRNA.

[0012] The target sequence of the MSTN gene is: 5'-ggtttgcttggtgcacaaga-3'.

[0013] The pX459-MSTN sgRNA is used to detect the gene knockout efficiency of the MSTN gene target site. The detection step can specifically include: transfecting the pX459-MSTN sgRNA plasmid into sheep fibroblasts, extracting the genome, and detecting the knockout efficiency of the MSTN sgRNA by PCR amplification combined with TA cloning.

[0014] Furthermore, the construction method of the pX330-Gal4 / Cas9-MSTN sgRNA is as follows: steps (1) to (3): Step (1), annealing the single-stranded DNA to form double-stranded DNA; The DNA sequences shown in SEQ ID No: 2 and SEQ ID No: 3 are dissolved respectively, then mixed and placed in a PCR instrument for annealing to obtain an annealing mix; Step (2), digest the pX330-Gal4 / Cas9 plasmid with BsmBI; The pX330-Gal4 / Cas9 plasmid contains a Gal4 / BD fragment, the nucleotide sequence of which is SEQ ID No: 6; the Gal4 / BD fragment is fused to the N-terminus of the Cas9 protein via a flexible linker (32 aa: SGGS×2-XTEN-SGGS×2); Step (3): ligating the annealed Mix and the digested product of step (2) using a T4 DNA ligase kit to obtain the site-directed knockout plasmid pX330-Gal4 / Cas9-MSTN sgRNA described in step 1.

[0015] The present invention also provides the site-directed knockout plasmid described above.

[0016] The present invention also provides the Donor-1 kb HA-mCherry plasmid described in the method described above. The sequence of the Donor-1 kb HA-mCherry plasmid is shown in SEQ ID No: 4; wherein positions 8 to 1007 of SEQ ID No: 4 are the genomic upstream left homology arm sequence of the MSTN gene, positions 1008 to 2628 of SEQ ID No: 4 are the CMV-mCherry-pA expression structure, and positions 2629 to 3628 of SEQ ID No: 4 are the genomic downstream right homology arm sequence of the MSTN gene.

[0017] The present invention also provides the use of the above-mentioned method in preparing a fluorescently labeled sheep fibroblast cell line.

[0018] The present invention also provides the application of the above-mentioned method in improving the efficiency of site-specific integration of the mCherry gene in a sheep fibroblast cell line.

[0019] The present invention also provides a stably fluorescently labeled sheep fibroblast cell line constructed in the method described above.

[0020] The present invention also provides the use of the above-mentioned stably fluorescently labeled sheep fibroblast cell line in sheep gene editing research.

[0021] Screening under a fluorescence microscope, PCR identification, and sequencing verification revealed that, under conditions without fluorescence enrichment and antibiotic selection, the knock-in efficiency of the large mCherry gene in the Gal4 / Cas9 group reached 12.37% (12 / 97), a 2.42-fold increase compared to 5.10% (5 / 98) in the Cas9 group. The selected and named SFF-MSTN / mCherry monoclonal cell line remained in good condition and exhibited stable and high expression of red fluorescence at passage 20.

[0022] Using the sheep genome integration target site (MSTN / sgRNA) provided by the present invention, a sheep monoclonal cell line with site-specific knock-in of fluorescent genes can be efficiently created based on the CRISPR / Cas9-Gal4 system without affecting the normal transduction of the p53 signaling pathway, thereby improving the preparation efficiency, shortening the preparation cycle, and avoiding the risk of random insertion of exogenous genes.

[0023] The SFF-MSTN / mCherry sheep fibroblast monoclonal cell line created in the present invention has characteristics such as normal morphology and good growth status, and in particular has the advantage of high expression of red fluorescence. It can provide an important tool cell line for sheep gene editing research, such as the optimization of conditions such as gene knockout / point mutation, the verification or development of new CRISPR gene editing systems, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Schematic diagram of the ovine MSTN / sgRNA target design, pX459 plasmid structure, and gene knockout mutation types. A: Ovine MSTN gene structure and designed crRNA target site; B: Commercial pX459 plasmid structure, containing the puromycin (Puro) resistance gene; C: Target site mutation types and mutation efficiency after electroporation of the pX459-MSTN sgRNA knockout plasmid into ovine fibroblasts.

[0025] Figure 2 The commercialized pX330 and constructed pX330-Gal4 / Cas9 plasmid structures are shown below. A: The pX330 vector structure, excluding fluorescent and drug-selective markers; B: The pX330-Gal4 / Cas9 vector structure, with the Gal4BD fused to the N-terminus of the Cas9 protein via a flexible linker.

[0026] Figure 3 Schematic diagram of mCherry gene knock-in, statistics of positive single clone preparation, and PCR and sequencing verification images. A: Schematic diagram of mCherry gene knock-in. The donor template structure consists of a 1621 bp CMV-mCherry-pA fluorescent expression construct with 1000 bp left and right homology arms. The donor template for the Gal4 / Cas9 group also carries a 17 bp UAS sequence at the 3' end. B: Statistics of positive single clone preparation. The control group was transfected with pX330-MSTN sgRNA + mCherry donor template, while the experimental group was transfected with pX330-Gal4 / Cas9-MSTN sgRNA + mCherry / UAS donor template. C: PCR verification of positive 3' ends of single clones. PCR verification of the 3' ends of 8 and 17 red fluorescence-positive single clones identified in the control and experimental groups, respectively, was performed under a fluorescence microscope. D: Sanger sequencing of the MSTN knock-in site in the cell lines with positive mCherry gene knock-in single clones.

[0027] Figure 4Diagram illustrating the evaluation of the large-scale gene editing capabilities of the novel CRISPR tool enzyme CasMINI using the developed SFF-MSTN / mCherry ovine tool cell line. A: Schematic diagram of the CasMINI-Puro plasmid structure, containing the Puro resistance gene. B: Schematic diagram of large-scale gene knockout using Cas9 and CasMINI in the SFF-MSTN / mCherry ovine tool cell line. Two Cas9-mCherry sgRNAs and two CasMINI-mCherry sgRNAs were designed targeting the 5' and 3' flanks of the mCherry gene, respectively. C: Fluorescence microscopy showing the ratio of red fluorescence after Cas9 and CasMINI gene editing. Knock-in: Unedited SFF-MSTN / mCherry control group. D: Statistical diagram of large-scale gene knockout efficiency using Cas9 and CasMINI. **P<0.01. DETAILED DESCRIPTION

[0028] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0029] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0030] Unless otherwise specified, the quantitative tests in the following examples were performed three times, and the results were averaged.

[0031] The ovine primary fetal fibroblasts used in the following examples are described in: Yan Li, Di Lian, Jiahao Wang, Yue Zhao, Yao Li, Guoshi Liu, Sen Wu, Shoulong Deng, Xuguang Du, and Zhengxing Lian; MDM2 antagonists promote CRISPR / Cas9-mediated precise genome editing in sheep primary cells; Molecular Therapy - Nucleic Acids; Vol. 31, 309-323. The public may obtain this biological material from the applicant for use solely for replicating the experiments of the present invention and may not be used for any other purpose.

[0032] Example 1. CRISPR-mediated red fluorescent labeled sheep fibroblast cell line and its construction method 1. crRNA design of sheep MSTN gene Log in to the NCBI database (www.ncbi.nlm.nih.gov), search and download the sheep MSTN gene sequence (GeneID: 443449, updated on May 12, 2024). The sheep MSTN gene is 6757 bp long and consists of 3 exons and 2 introns ( Figure 1 A in the middle). Based on the sgRNA design principles such as "the length is generally 20 nt; the GC content is preferably between 40-60%, and it should not end with more than 4 Ts; if a U6 promoter-driven sgRNA expression vector is constructed, it is necessary to consider that the 5' base of the sgRNA is G or GG to improve its transcription efficiency", a crRNA with a length of 20 nt and a GC content of 50% was artificially designed for the third exon (CDS-3) of the MSTN gene. The specific sequence is crRNA: 5'-ggUUUgcUUggUgcacaaga-3' (SEQ ID No: 1) ( Figure 1 Middle A).

[0033] 2. Construction of pX459-MSTN sgRNA plasmid The primers crRNA-F: 5'-caccgggtttgcttggtgcacaaga-3' (SEQ ID No: 2) and crRNA-R: 5'-aaactcttgtgcaccaagcaaaccc-3' (SEQ ID No: 3) were sent to the company for synthesis and construction of the pX459-MSTN sgRNA gene knockout plasmid.

[0034] After synthesis, the primers were first phosphorylated. A 10 μL system consisted of: 1 μL upstream primer (100 μM), 1 μL downstream primer (100 μM), 1 μL T4 ligation buffer (10×; NEB, M0202S), 1 μL T4 PNK (NEB, M0202S), and 6 μL ddH2O. Annealing was then performed using the following conditions: 37°C for 30 min, followed by a temperature decrease from 95°C to 25°C at a rate of 5°C / min. The commercial pX459 empty plasmid (Addgene plasmid #48139, Figure 1(B) After gel excision and purification, the phosphorylated and annealed upstream and downstream primers and the pX459 empty plasmid recovered from gel excision were ligated using T4 ligase (NEB, M0202S) under the following conditions: 1 μL annealing mix, 1 μL pX459 digestion product, 1 μL T4 ligation buffer (10×), 1 μL T4 ligation, 6 μL ddH2O, and ligation in a 16°C metal bath overnight. Finally, the ligation product was transformed using DH5α competent cells (Tiangen, CB101). After 12 hours of plating, single colonies were picked and plasmids were extracted. The plasmids were sent to the company for sequencing to verify correct ligation, resulting in the pX459-MSTN sgRNA plasmid.

[0035] The structure of the pX459-MSTN sgRNA plasmid is described as follows: a recombinant vector is obtained by inserting a DNA fragment with the sequence SEQ ID No. 1 between the two BbsI restriction sites of the backbone vector pX459, while keeping the other sequences of the backbone vector pX459 unchanged.

[0036] 3. Detection of MSTN gene knockout efficiency of pX459-MSTN sgRNA plasmid in primary sheep fetal fibroblasts The constructed pX459-MSTN sgRNA plasmid was extracted using an endotoxin-free plasmid extraction kit (Tiangen, DP117). The concentration was qualified when it reached above 1000 ng / μL.

[0037] The primary sheep fetal fibroblasts preserved by our research group were revived and subcultured in DMEM / F12 (Gibco, 11320033) supplemented with 10% FBS (Gibco, A5669701) and 1% double-antibody (Gibco, 15070063). 6 cells, using Lonza Nucleofector TM 2b electroporator, A033 electroporation program, and the accompanying Basic Nucleofector ® Sheep fetal fibroblasts were electroporated with 15 μg of the pX459-MSTN sgRNA plasmid using the VPI-1002 Electroporation Kit. Forty-eight hours after electroporation, 900 ng / μL puromycin (Gibco, A1113803) was added to the culture medium. Following 72 hours of selection, the genome of the remaining adherent, viable cells was extracted using a Takara, 9765 kit.

[0038] Primers were designed upstream and downstream of MSTN crRNA (MSTN-TA-F: 5'-gaagcttttggatgggattggat-3', MSTN-TA-R: 5'-actctaggcttatagcccgtggt-3'). The genome of living cells was amplified by PCR using PrimeSTAR Max DNA Polymerase (Takara, R045A). The amplification system was as follows: 25 μL PrimeSTAR Max Premix (2×), 1 μL MSTN-TA-F, 1 μL MSTN-TA-R, 50 ng genome, and ddH2O to 50 μL. The amplification program was as follows: 98°C for 1 min 30 s, 98°C for 10 s + 56°C for 15 s + 72°C for 10 s (35 cycles), 72°C for 2 min 30 s, and 4°C ∞.

[0039] According to the instructions, the PCR product was connected to the blunt-end T vector (Adlai, CV2101) and transformed using DH5α competent cells (Tiangen, CB101). After 12 hours of plating, the bacterial plate was sent to the company to pick 37 single clones to extract the plasmid and perform Sanger sequencing.

[0040] The results showed that 18 of the 37 monoclonal clones carried MSTN gene mutation sequences ( Figure 1 Middle C), that is, the knockout efficiency of the designed MSTN / sgRNA in the sheep genome was 48.65% (18 / 37).

[0041] 4. Construction of pX330-Gal4 / Cas9 fusion co-expression plasmid, pX330-MSTN sgRNA and pX330-Gal4 / Cas9-MSTN sgRNA gene knockout plasmids, and Donor-1 kb HA-mCherry homology repair plasmid 1) Construction of pX330-Gal4 / Cas9 plasmid The Gal4BD sequence (SEQ ID No: 6, containing two BsaI restriction sites at the 3' end) was sent to the company for gene synthesis. The primers N-Gibson-LF (5'-CTTTTTTTCAGGTTGGACCGGTgccaccatgaaacggacagccg-3') and N-Gibson-MR (5'-GGCCGATGCTGTACTTCTTGTCaGAGACCgactGGTCTCgcgat-3') were designed. The synthesized Gal4BD sequence was amplified by PCR using PrimeSTARMax DNA Polymerase. The amplification system was as follows: 25 μL PrimeSTAR Max Premix (2×), 1 μL N-Gibson-LF, 1 μL N-Gibson-MR, 1 ng Gal4BD plasmid, and ddH2O was added to 50 μL. The amplification program was as follows: 98°C for 1 min 30 s, 98°C for 10 s + 59°C for 15 s + 72°C for 15 s s (35 cycles), 72 °C 2 min 30 s, 4 °C ∞.

[0042] At the same time, primers N-Gibson-MF (5'-GACAAGAAGTACAGCATCGGCC-3') and N-Gibson-RR (5'-GCCATCTCGTTGCTGAAGATCT-3') were designed to amplify the pX330 blank vector using PrimeSTAR Max DNA Polymerase PCR. The amplification system was: 25 μL PrimeSTAR Max Premix (2×), 1 μL N-Gibson-MF, 1 μL N-Gibson-RR, 1 ng pX330 blank plasmid, and ddH2O was added to 50 μL; the amplification program was: 98°C for 1 min 30 s, 98°C for 10 s + 65°C for 15 s + 72°C for 10 s (35 cycles), 72°C for 2 min 30 s, and 4°C ∞ to obtain the Gal4BD fragment and part of the Cas9 fragment.

[0043] The pX330 empty plasmid was double-digested with AgeI (NEB, R3552S) and BglII (NEB, R0144S) restriction endonucleases. The large fragment of the double-digested backbone plasmid was purified and recovered using an agarose gel purification and recovery kit (Adlai, DR0102). The Gal4BD fragment, part of the Cas9 fragment, and the double-digested large fragment backbone plasmid were ligated using a seamless cloning kit (Quanshijin, CU101-02) according to the instructions to construct the pX330-Gal4 / Cas9-Blank plasmid in which the Gal4BD was fused to the N-terminus of the Cas9 protein ( Figure 2 Middle B).

[0044] The pX330-Gal4 / Cas9-Blank plasmid was then digested with BsaI (NEB, R3733S), and the digested products were recovered using a PCR product purification kit (Adela, DR0202). At the same time, primers containing a 32 aa linker sequence, N-Gal4-linker 32 aa-F (5′-ATCGTCTGGAGGATCTAGCGGAGGATCCTCTGGCAGCGAGACACCAGGAACAAGCGAGTCAGCAACACCAGAGAGCAGTGGCGGCAGCAGCGGCGGCAGC-3′) and N-Gal4-linker 32 aa-R (5′-TGTCGCTGCCGCCGCTGCTGCCGCCACTGCTCTCTGGTGTTGCTGACTCGCTTGTTCCTGGTGTCTCGCTGCCAGAGGATCCTCCGCTAGATCCTCCAGA-3′) were designed.

[0045] Referring to step 2, construction of pX459-MSTN sgRNA plasmid, phosphorylate and anneal primers N-Gal4-linker 32 aa-F and N-Gal4-linker 32 aa-R, and clone them into the pX330-Gal4 / Cas9-Blank plasmid digested with BsaI using T4 ligase. This constructs the pX330-Gal4 / Cas9 plasmid in which the Gal4BD is fused to the N-terminus of the Cas9 protein via a 32 aa (SGGS × 2-XTEN-SGGS × 2) linkage.

[0046] The structure of the pX330-Gal4 / Cas9 plasmid is described as follows: a recombinant vector obtained by inserting a DNA fragment having a sequence of positions 948-1043 of SEQ ID No: 7 between the BsaI restriction sites of the backbone vector pX330, while keeping the other sequences of the backbone vector pX330 unchanged.

[0047] 2) According to the method described in step 2, the MSTN crRNA designed in step 1 was ligated into the commercial pX330 plasmid (Addgene plasmid #42230, Figure 2 (A) to obtain the pX330-MSTN sgRNA plasmid.

[0048] The structure of the pX330-MSTN sgRNA plasmid is described as follows: a recombinant vector is obtained by inserting a DNA fragment with the sequence 5'-ggtttgcttggtgcacaaga-3' between the two BbsI restriction sites of the backbone vector pX330, while keeping the other sequences of the backbone vector pX330 unchanged.

[0049] 3) According to the method described in step 2, the MSTN crRNA designed in step 1 was ligated into the pX330-Gal4 / Cas9 plasmid constructed above using T4 ligase ( Figure 2 In Figure 2B, Gal4 / BD (438 bp encoding 146 aa, in which base G at position 9, base T at position 138, and base A at position 222 were replaced with bases A, A, and G, respectively) was fused to the N-terminus of Cas9 through a flexible linker (32 aa: SGGS×2-XTEN-SGGS×2) to obtain the pX330-Gal4 / Cas9-MSTN sgRNA gene targeting plasmid.

[0050] The structure of the pX330-Gal4 / Cas9-MSTN sgRNA gene targeting plasmid is described as follows: a recombinant vector is obtained by inserting a DNA fragment representing positions 8430-8449 of SEQ ID No: 7 between two BbsI restriction sites in the backbone vector pX330-Gal4 / Cas9, while maintaining the remaining sequences of the backbone vector pX330-Gal4 / Cas9 unchanged.

[0051] 4) Construction of Donor-1 kb HA-mCherry homology repair plasmid The left homology arm amplification primers Left HA-F / Left HA-R and the right homology arm amplification primers Right HA-F / Right HA-R were designed with 3 bp upstream of the PAM of the MSTN / crRNA target site (5'-ggtttgcttggtgcacaaga-3') as the interval, and the length of the left and right homology arms were both 1000 bp.

[0052] Left HA-F: 5'-tattaccgccatgcattagttatgatgtattcctcagaattttcca-3'; Left HA-R: 5'-gaccccgtaattgattactattaagatgggtatgaggatacttttg-3'; Right HA-F: 5'-ttgtccaaactcatcaatgtatctgtgcaccaagcaaaccccaaag-3'; Right HA-R: 5'-aacgcttacaatttacgccttaattatttcatcctaaaagctgcag-3'.

[0053] Design PCR primers mCherry-F / mCherry-R for the CMV-mCherry-pA fluorescent expression construct and PCR primers GJ-F / GJ-R for the backbone plasmid pmCherry-N1.

[0054] mCherry-F: 5'-taatagtaatcaattacggggtc-3'; mCherry-R: 5'-gatacattgatgagtttggacaa-3'; GJ-F: 5'-ttaaggcgtaaattgtaagcgtt-3'; GJ-R: 5'-ataactaatgcatggcggtaata-3'.

[0055] PrimeSTAR Max DNA Polymerase (Takara, R045A) and corresponding primers were used to amplify the sheep genome and the commercial pmCherry-N1 vector (Clontech, 632523), respectively. The amplification system was as follows: 25 μL PrimeSTAR Max Premix (2×), 1 μL upstream primer, 1 μL downstream primer, 50 ng sheep genome or 1 ng pmCherry-N1, and ddH2O to 50 μL; the amplification program was as follows: 98°C for 1 min 30 s, 98°C for 10 s + 62°C for 15 s + 72°C for 30 s (35 cycles), 72°C for 2 min 30 s, and 4°C ∞. The four PCR products were then recovered using a DNA purification kit (Tiangen, DP205) and ligated using a seamless cloning kit (Quanshijin, CU101-02) according to the manufacturer's instructions to construct the Donor-1 kb HA-mCherry homology repair plasmid. After transformation, the plasmids were sent to the company for sequencing.

[0056] The nucleotide sequence of the Donor-1 kb HA-mCherry homology repair plasmid is SEQ ID No: 4.

[0057] 5. Preparation of CMV-mCherry-pA donor template with both left and right homology arms of 1 kb Two PCR primers were designed for the Donor-1 kb HA-mCherry homology repair plasmid. One downstream primer carried the UAS sequence (Donor / UAS-R: 5'-cggaaagcttccttccgttatttcatcctaaaagctgcag-3'), and the other did not (Donor-R: 5'-ttatttcatcctaaaagctgcag-3'). The upstream primer was universal (Donor-F: 5'-gatgtattcctcagaattttcca-3').

[0058] PrimeSTAR Max DNA Polymerase (Takara, R045A) and two pairs of primers were used to amplify the Donor-1 kb HA-mCherry vector by PCR. The amplification system was as follows: 25 μL PrimeSTAR Max Premix (2×), 1 μL upstream primer, 1 μL downstream primer, 1 ng Donor-1 kb HA-mCherry, and ddH2O to 50 μL; the amplification program was as follows: 98°C for 1 min 30 s, 98°C for 10 s + 59°C for 15 s + 72°C for 45 s (35 cycles), 72°C for 2 min 30 s, and 4°C ∞.

[0059] Two donor templates, one containing a UAS sequence and the other not containing a UAS sequence, were recovered using a DNA purification kit (Tiangen, DP205).

[0060] 6. Preparation of CMV-mCherry-pA site-directed knock-in sheep monoclonal cell line As described in step 3, 2.5 pmol of pX330-Gal4 / Cas9-MSTN sgRNA + 6 pmol of donor template containing UAS sequence were electroporated into sheep fetal fibroblasts (referred to as Gal4 / Cas9 group), and 2.5 pmol of pX330-MSTN sgRNA + 6 pmol of donor template without UAS sequence were electroporated into sheep fetal fibroblasts (referred to as Cas9 group). The gene knock-in diagram is shown in the figure. Figure 3 As shown in A.

[0061] 48 h after electroporation, single cells from the two samples were sorted into 10 96-well plates using a BD FACSAriaTM III flow cytometer ( Figure 3 In middle B), the basal culture medium remained DMEM / F12, and FBS was increased to 20%.

[0062] After sorting, the 96-well plates were placed in a cell culture incubator for culture. Ten days later, observations under a conventional / fluorescence microscope revealed that the Gal4 / Cas9 group grew 97 clones with a formation rate of 10.10%, of which 17 clones expressed red fluorescence; the Cas9 group grew 98 clones with a formation rate of 10.21%, of which 8 clones expressed red fluorescence ( Figure 3 Middle B).

[0063] 7. PCR verification of monoclonal red fluorescence expression PCR primers were designed (Detection-F: 5'-ccctgaacctgaaacataaaatg-3', Detection-R: 5'-tcacgaacccataagtgaatgct-3'). PCR validation was performed for red fluorescence-positive clones. Cell lysis buffer was prepared: 2 ml of Tris-HCl (1 M, pH 8.0), 0.45 ml of Triton X-100, 0.45 ml of NP-40, and 0.02 g of Proteinase K. Dissolve the solution in deionized water and adjust the volume to 50 ml. The solution was filtered through a 0.22 μm filter and stored at 4°C. Eighteen red fluorescence-positive clones were trypsinized, half of which were cultured and frozen, and the other half were lysed using cell lysis buffer. The lysate was amplified using PrimeSTAR Max DNA Polymerase (Takara) using the following system: 25 μL PrimeSTAR Max Premix (2×), 1 μL Dection-F, 1 μL Dection-R, 1 μL lysate, 22 μL ddH2O; the amplification program was as follows: 98°C for 1 min 30 s, 98°C for 10 s + 65°C for 15 s + 72°C for 10 s (35 cycles), 72°C for 2 min 30 s, 4°C ∞. After amplification, the band size was observed by running the gel ( Figure 3 Middle C).

[0064] PCR results showed: 8 mCherry + Among the monoclonal cell lines, 5 cells underwent site-directed integration at the MSTN locus of the genome, and the knock-in efficiency of large-fragment mCherry genes was 5.10%; 17 mCherry +Among the monoclonal cell lines, 13 cells underwent site-specific integration at the MSTN locus of the genome, and the knock-in efficiency of the large-fragment mCherry gene reached 12.37% ( Figure 3 Middle B), the gene knock-in efficiency increased by 2.42 times.

[0065] 8. Subculture and expansion of monoclonal cell lines with strong red fluorescence expression Under a fluorescence microscope, we screened the Gal4 group for monoclonal cell lines that strongly expressed red fluorescence. We selected a monoclonal cell line with good growth, normal morphology, and positive PCR test results and named it SFF-MSTN / mCherry. Sanger sequencing results showed that the exogenous mCherry gene had indeed been successfully integrated into the sheep MSTN site ( Figure 3 (Center D). Continued subculture and expansion have now reached the 20th generation, with normal morphology, demonstrating the successful construction of the CRISPR-mediated red fluorescent-labeled sheep fibroblast cell line.

[0066] Example 2: Application of CRISPR-mediated red fluorescent labeling of sheep fibroblast cell lines 1. Construction of CasMINI-Puro plasmid for co-expression of CasMINI, sgRNA, and Puro First, the CasMINI and U6 / tracrRNA (containing two BsmBI restriction sites) gene sequences were sent to the company for synthesis and cloned into the pUC57 backbone plasmid (Qingke Bio) to obtain pUC57-CasMINI and pUC57-U6 / tracrRNA;.

[0067] Subsequently, primers hU6-F: 5′-ttaccgccatgcattagttatTAATgagggcctatttcccatgatt-3′ and hU6-R: 5′-ccccgtaattgattactattaATaaaaaaaagagacgatatatcgt-3′ were designed, and PrimeSTARMax DNA Polymerase (Takara) was used to amplify the pUC57-U6 / tracrRNA plasmid. The system was as follows: 25 μL PrimeSTARMax Premix (2×), 1 μL hU6-F, 1 μL hU6-R, 1 ng pUC57-U6 / tracrRNA, 22 μL ddH2O; the amplification program was as follows: 98°C for 1 min 30 s, 98°C for 10 s + 62°C for 15 s + 72°C for 10 s (35 cycles), 72°C for 2 min 30 s, 4°C for 5 min 30 s, ∞, after amplification, the PCR product was recovered using a DNA purification kit (Tiangen, DP205). At the same time, the commercial pEGFP-N1 plasmid (Clontech, 60851) was digested with AseI (NEB, R0526S), and the digestion product was recovered using a DNA purification kit (Tiangen, DP205).

[0068] The U6 / tracrRNA fragment was ligated into the pEGFP-N1 backbone plasmid after single enzyme digestion using a seamless cloning kit (Quanshijin, CU101-02) according to the instructions to form the pEGFP-N1-U6 / tracrRNA plasmid.

[0069] The structure of the pEGFP-N1-U6 / tracrRNA plasmid is described as follows: a recombinant vector is obtained by inserting a DNA fragment with a sequence of SEQ ID No: 8 between the AseI restriction sites of the starting vector pEGFP-N1, while keeping the other sequences of the vector pEGFP-N1 unchanged.

[0070] Primers CasMINI-Gibson-LF: 5′-tctcgagctcaagcttcgaattcgccaccatgggacccaagaaaaaac-3′ and CasMINI-Gibson-MR: 5′-tgccctctccactgccgaattcgtctagtttaacgcgtttggca-3′, as well as primers CasMINI-Gibson-MF: 5′-gaattcggcagtggagagggca-3′ and CasMINI-Gibson-RR: 5′-tgattatgatctagagtcgcggccgctcaggcaccgggcttgcgggtc-3′ were designed and amplified using PrimeSTAR Max DNA Polymerase (Takara) for pUC57-CasMINI plasmid and commercial pX459 plasmid, respectively. The system was as follows: 25 μL PrimeSTAR Max Premix (2×), 1 μL CasMINI-Gibson-LF or CasMINI-Gibson-MF, 1 μL CasMINI-Gibson-MR or CasMINI-Gibson-RR, 1 ng pUC57-CasMINI or pX459 plasmid, 22 μL ddH2O; amplification program was as follows: 98°C for 1 min 30 s, 98°C for 10 s + 62°C for 15 s + 72°C for 30 s (CasMINI fragment, 35 cycles) or 72°C for 15 s (T2A-Puro fragment, 35 cycles), 72°C for 2 min 30 s, 4°C for 5 min After amplification, the two PCR products were recovered using a DNA purification kit (Tiangen, DP205) and ligated with the T2A-Puro fragment amplified from the commercial pX459 plasmid using a seamless cloning kit (Quanshijin, CU101-02) into the pEGFP-N1-U6 / tracrRNA plasmid that had been double-digested with EcoRI (NEB, R3101S) and NotI (NEB, R3189S) to construct the CasMINI-Puro plasmid that co-expresses CasMINI, sgRNA, and Puro ( Figure 4 Middle A).

[0071] The structure of the CasMINI-Puro plasmid is described as follows: a recombinant vector is obtained by inserting a DNA fragment with the sequence SEQ ID No: 9 between the EcoRI and NotI restriction sites of the starting vector pEGFP-N1-U6 / tracrRNA, while keeping the other sequences of the vector pEGFP-N1-U6 / tracrRNA unchanged.

[0072] 2. Construction of large fragment knockout plasmids for Cas9 and CasMINI systems Two Cas9 / sgRNAs were designed targeting the 5' and 3' flanking sequences of the mChery gene in the sheep genome: Cas9 mCherry sgRNA1: 5'-taataatgactccttgcggt-3'; Cas9 mCherry sgRNA2: 5'-actgtgaaattatgtaccac-3'( Figure 4 Middle B).

[0073] The primers for constructing the pX459-mCherry sgRNA large fragment gene knockout plasmid (Cas9mCherry sgRNA1-F: 5'-caccgtaataatgactccttgcggt-3', SEQ ID No: 10; Cas9 mCherrysgRNA1-R: 5'-aaacaccgcaaggagtcattattac-3', SEQ ID No: 11; Cas9 mCherry sgRNA2-F: 5'-caccgactgtgaaattatgtaccac-3', SEQ ID No: 12; Cas9 mCherry sgRNA2-R: 5'-aaacgtggtacataatttcacagtc-3', SEQ ID No: 13) were sent to the company for synthesis.

[0074] Design 2 CasMINI / sgRNA: CasMINI mCherry sgRNA1: 5'-ataatgactccttgcggtaggag-3'; CasMINI mCherry sgRNA2: 5'-aaactgtgaaattatgtaccacg-3'( Figure 4 Middle B).

[0075] Primers for constructing the CasMINI-Puro-mCherry sgRNA large fragment gene knockout plasmid (CasMINImCherry sgRNA1-F: 5'-GCAACataatgactccttgcggtaggag-3', SEQ ID No: 14; CasMINImCherry sgRNA1-R: 5'-aaaactcctaccgcaaggagtcattatg-3', SEQ ID No: 15; CasMINImCherry sgRNA2-F: 5'-GCAACaaactgtgaaattatgtaccacg-3', SEQ ID No: 16; CasMINImCherry sgRNA2-R: 5'-aaaacgtggtacataatttcacagtttg-3', SEQ ID No: 17).

[0076] According to the method described in step 2 of Example 1, the annealed products were ligated into the pX459 plasmid digested with BbsI (NEB, R3539M) and the CasMINI-Puro plasmid digested with BsmBI (NEB, R0739S), respectively, to obtain pX459-mCherry sgRNA1 and pX459-mCherry sgRNA2, as well as CasMINI-Puro-mCherry sgRNA1 and CasMINI-Puro-mCherry sgRNA2 large fragment gene knockout plasmids.

[0077] The structure of pX459-mCherry sgRNA1 is described as follows: a recombinant vector is obtained by inserting a DNA fragment with the sequence SEQ ID No: 18 between the BbsI restriction sites of the starting vector pX459, while keeping the other sequences of the vector pX459 unchanged.

[0078] The structure of pX459-mCherry sgRNA2 is described as follows: a recombinant vector is obtained by inserting a DNA fragment with the sequence SEQ ID No: 19 between the two BbsI restriction sites of the starting vector pX459, while keeping the other sequences of the vector pX459 unchanged.

[0079] The structure of CasMINI-Puro-mCherry sgRNA1 is described as follows: a recombinant vector is obtained by inserting a DNA fragment with a sequence of SEQ ID No: 20 between the BsmBI restriction sites of the starting vector CasMINI-Puro, while keeping the other sequences of the vector CasMINI-Puro unchanged.

[0080] The structure of CasMINI-Puro-mCherry sgRNA2 is described as follows: a recombinant vector is obtained by inserting a DNA fragment with a sequence of SEQ ID No: 21 between the two BsmBI restriction sites of the starting vector CasMINI-Puro, while keeping the other sequences of the vector CasMINI-Puro unchanged.

[0081] 3. Comparison of large fragment knockout efficiency between Cas9 and CasMINI systems Four large-fragment gene knockout plasmids were extracted using an endotoxin-free plasmid extraction kit (Tiangen, DP117). According to the method described in step 3 of Example 1, 15 μg of pX459-mCherry sgRNA1+pX459-mCherrysgRNA2 plasmid and 15 μg of CasMINI-Puro-mCherry sgRNA1+CasMINI-Puro-mCherry sgRNA2 plasmid were electroporated into the SFF-MSTN / mCherry sheep cell line. After resistance selection with 900 ng / μL puromycin (Gibco, A1113803), the adherent and surviving cells were fixed with paraformaldehyde (Biyuntian, P0099) and the cell nuclei were stained with DAPI staining solution (Biyuntian, Cat. No.: C1006).

[0082] Observation results under a fluorescence microscope showed that the large-fragment gene knockout efficiency of the classic Cas9 system was 34.77%, while the large-fragment gene knockout efficiency of the CasMINI system was 11.83% ( Figure 4 C and D), indicating that various conditions need to be further optimized to achieve efficient gene editing in sheep based on the new gene editing tool enzyme CasMINI.

[0083] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes that depart from the disclosed scope in this application and are made using conventional techniques known in the art.

Claims

1. A method for constructing a CRISPR-mediated red fluorescently labeled sheep fibroblast cell line, characterized in that: The steps include: Step 1: Construct a site-directed knockout plasmid containing the Cas9 target sequence of the MSTN gene; Step 2: Construct the plasmid Donor-1 kb HA-mCherry containing the homology arms of the MSTN gene: The 1 kb upstream sequence of the MSTN gene is set as the left homology arm, and the 1 kb downstream sequence is set as the right homology arm; the Donor-1 kb HA-mCherry homology repair plasmid is constructed by connecting four DNA fragments, namely the left homology arm, the CMV-mCherry-pA expression structure, the right homology arm, and the pmCherry-N1 plasmid, using seamless cloning technology; The nucleotide sequence of the CMV-mCherry-pA expression construct is positions 1008-2628 of SEQ ID No: 4; Step 3: Construct donor DNA containing the fluorescent protein mCherry expression cassette: The Donor-1 kb HA-mCherry obtained in step 3 is amplified using primers to obtain a fluorescent protein mCherry expression cassette donor DNA with a UAS sequence; the nucleotide sequence of the UAS sequence is positions 3622-3638 of SEQ ID No: 5; Step 4: Transfection of red fluorescent labeled sheep fibroblast cell line: The donor DNA containing the fluorescent protein mCherry expression cassette was co-transfected with the site-directed knockout plasmid described in step 1 into the sheep fibroblast cell line to obtain a red fluorescently labeled sheep fibroblast cell line.

2. The method according to claim 1, wherein: The nucleotide sequence of the plasmid Donor-1 kb HA-mCherry is shown in SEQ ID No:

4.

3. The method according to claim 1 or 2, characterized in that: The method for constructing the site-directed knockout plasmid in step 1 is: Step (1), annealing the single-stranded DNA to form double-stranded DNA; The DNA sequences shown in SEQ ID No: 2 and SEQ ID No: 3 are dissolved respectively, then mixed and placed in a PCR instrument for annealing to obtain an annealing mix; Step (2), digest the pX330-Gal4 / Cas9 plasmid with BsmBI; The pX330-Gal4 / Cas9 plasmid contains a Gal4 / BD fragment, the nucleotide sequence of which is SEQ ID No: 6; the Gal4 / BD fragment is fused to the N-terminus of the Cas9 protein via a flexible linker (32 aa: SGGS×2-XTEN-SGGS×2); Step (3): ligating the annealed Mix and the enzyme digestion product of step (2) using a T4 DNA ligase kit to obtain the site-directed knockout plasmid described in step 1.

4. The site-directed knockout plasmid in the method of claim 3.

5. The plasmid Donor-1 kb HA-mCherry in the method according to claim 2.

6. Use of the method according to claim 3 in preparing a fluorescently labeled sheep fibroblast cell line.

7. Use of the method according to claim 3 in improving the efficiency of site-directed knock-in of the mCherry gene in a sheep fibroblast cell line.

8. The stably fluorescently labeled sheep fibroblast cell line constructed according to the method of claim 1 or 2.

9. Use of the stably fluorescently labeled sheep fibroblast cell line according to claim 8 in sheep gene editing research.

Citation Information

Patent Citations

  • CRISPER-Cas9-system-mediated sheep MSTN (myostatin) gene knock-out and exogenous gene site-specific integration method

    CN105671080A

  • CRISPR-assisted trans-enhancer activation gene expression method based on a GAL4-UAS system and application thereof

    CN109929865A

  • Method for improving CRISPR / Cas 9-mediated homologous repair efficiency

    CN111793606A