CRISPR-mediated red fluorescent marker sheep fibroblast cell line and application thereof

Abstract

The present invention relates to a CRISPR-mediated red fluorescently labeled sheep fibroblast cell line and its application in the field of mutation or genetic engineering. The construction and application of the CRISPR-mediated red fluorescently labeled sheep fibroblast cell line of the present invention include the following steps: step 1, constructing a Cas9 site-directed knockout plasmid containing the MSTN gene target sequence; step 2, constructing a plasmid Donor-1 kb HA-mCherry containing the MSTN gene homology arm; step 3, constructing a donor DNA containing a fluorescent protein mCherry expression cassette; step 4, co-transfecting the donor DNA containing the fluorescent protein mCherry expression cassette and the site-directed knockout plasmid described in step 1 into the sheep fibroblast cell line to obtain a red fluorescently labeled sheep fibroblast cell line.

Description

TECHNICAL FIELD

[0001] The application relates to a CRISPR-mediated red fluorescently labeled sheep fibroblast cell line and application thereof in the field of variation or genetic engineering. BACKGROUND

[0002] The CRISPR / Cas9 system is a genome-targeting editing technology developed in 2012, which is composed of three parts of Cas9 endonuclease, CRISPR RNA (crRNA, the same as the sequence of the target site of the genome) and trans-activating CRISPR RNA (tracrRNA). The crRNA and the tracrRNA can be fused to simplify a single guide RNA (sgRNA). The Cas9 protein can scan the PAM sequence (5'-NGG-3') in the genome under the guidance of the sgRNA, recognize and cut the DNA single strand which is the same as and complementary to the sequence of the crRNA, so as to induce a DNA double-strand break at the target site, activate the non-homologous end joining (NHEJ) and homology-directed repair (HDR) two repair mechanisms to realize the precise editing of the target gene. In the following years, on the basis of Cas9, scientists have successively excavated Cas12a / Cas12b / Cas14a and other single / double-stranded DNA editing tool enzymes, and Cas13a and other RNA editing tool enzymes, and further developed CBE and ABE single-base editing, PE guided editing, CRISPRa gene activation, CRISPRi gene interference, CRISPR whole-genome knockout / activation / interference and other various derivative gene editing systems based on the above Cas tool enzymes. Up to now, new types of Cas tool enzymes and their derivative systems are still being developed. These classic and new CRISPR systems have the characteristics of convenient operation and high efficiency, and are widely used in the researches in the fields of biology, medicine and agriculture.

[0003] The advent of CRISPR gene editing system has greatly promoted the research and application of genetically modified large animals (sheep) in human disease models, improved production traits, disease-resistant breeding, and bioreactors. However, in the current research of sheep and goat gene editing, there are still some problems in evaluating the gene editing efficiency of the CRISPR system, such as complicated experimental steps, long cycle, high cost, etc. For example, CasMINI is a newly discovered CRISPR system (529 aa) that is currently the smallest known CRISPR system. Compared with Cas9 and Cas12a, it is easier to deliver into cells through various delivery vectors such as AAV or LNP. In sheep cells, if you want to verify the gene editing effect of this new Cas tool enzyme, there are currently three main detection methods: T7E1 enzyme digestion, Sanger sequencing, and NGS. After transfecting the relevant gene targeting plasmid to the sheep cells at the specific gene target site in the genome, these traditional methods first need to extract the cell genome, then design primers upstream and downstream of the target site to carry out PCR amplification and DNA product purification, and finally through (1) T7E1 enzyme digestion + gel running, (2) TA cloning + transformation + plating + shaking + plasmid extraction + Sanger sequencing, or (3) sending to the company for deep sequencing + bioinformatics analysis, etc. Complex experimental procedures can determine the precise gene editing efficiency.

[0004] Fetal skin fibroblasts are a common primary tool cell in sheep CRISPR gene editing research, and also a nuclear donor cell for sheep somatic cell cloning. In the genome of sheep fetal fibroblasts, a fluorescent gene is knocked in at a specific site, and this is used as a tool cell (100% of cells emit fluorescence), and the proportion of fluorescently labeled cells is used to evaluate the gene editing effect of the CRISPR system (such as after gene editing on the fluorescent gene in the genome, only 60% of cells emit fluorescence under fluorescence microscopy or flow cytometry, indicating an editing efficiency of 40%). This is a simple, fast, and one-time method. Professor Liu Dongjun's team at Inner Mongolia University, Professor Wang Zhigang's team, and Academician Xuriday's team have successfully constructed transgenic sheep and goat fetal fibroblast cell lines that can stably express red fluorescent protein through G418 screening. However, in these positive monoclonal cells, the red fluorescent gene is randomly integrated into the genome, and is affected by the regulation of upstream and downstream genes. Random insertion of the red fluorescent gene may cause gene silencing. In addition, this random insertion method may affect the expression of genes at the insertion site or their upstream and downstream genes in the signal pathway, which brings many inconveniences to the subsequent application of red fluorescent labeled sheep cell lines.

[0005] The applicant team previously successfully prepared a single clone of sheep fetal fibroblast cell lines with mCherry gene site-specific integration into the MSTN safe site by electroporating Cas9 plasmid and mCherry donor template, combined with adding p53 protein small molecule compound agonists RITA and Nutlin3, under the conditions of no fluorescence and antibiotic enrichment. The positive rate was 7.45%. However, this construction method has two shortcomings: first, under the condition of no enrichment, the red fluorescent gene site-specific integration efficiency is still not too high; second, the p53 gene regulates cell cycle, cell proliferation, differentiation, apoptosis, DNA damage repair and many other cell life processes through a fine multi-pathway and multi-level molecular mechanism. Adding p53 protein agonists, i.e. activating the p53 signaling pathway, using this mCherry labeled sheep fetal fibroblast cell line may affect the evaluation of the gene editing effect of the CRISPR system (such as cell apoptosis, cell cycle arrest affecting editing efficiency, etc.). Therefore, it still has important research and application value to create a red fluorescent labeled sheep fetal fibroblast cell line with high gene knock-in efficiency and without affecting the normal transduction of the p53 signaling pathway.

[0006] Numerous studies have shown that increasing the local concentration of donor templates at the site of double-strand breaks induced by the CRISPR / Cas system is a strategy that can significantly improve the efficiency of HDR. Gal4 is a transcriptional activator of yeast, with a size of 881 aa, mainly composed of a DNA binding domain (BD) and an activation domain (AD). These two domains are structurally separate and functionally independent. The BD is a 1-147 peptide segment at the N terminus, which can recognize and specifically bind to the upstream activation sequence (UAS) of the Gal4 effector gene (such as Gal1, Gal2, and Gal7 galactose metabolism enzyme gene) promoter region. The UAS sequence is relatively conserved, usually a 17 bp long sequence: 5'-CGGRNNRCYNYNYNCNCCG-3'.

[0007] The team of Professor Xu Kun of Northwest A&F University fused Gal4 / BD to the C terminus of the Cas9 protein through GGS5 (5 repeated GGS sequences) as a linker, combined with the use of a donor template containing a UAS sequence (5'-AGGAAGACTCTCCTCCG-3') at the 5' end, and the gene knock-in efficiency of a super short DNA fragment (a few bp) at three gene sites in the tumor cell line 293T was increased by 20% under the condition of puromycin enrichment. SUMMARY

[0008] The main problem to be solved by the present application is how to solve the problems of complex experimental steps, long cycle and high cost in the evaluation of gene editing effect of the new CRISPR gene editing tool enzyme at the level of sheep cells, the problem of random insertion of red fluorescent gene in the creation of red fluorescent sheep fibroblast cells, and the problems of low efficiency of red fluorescent gene site-directed knock-in and activation of p53 signaling pathway.

[0009] To solve the above problems, the present application provides an MSTN / sgRNA safe site for efficient site-directed knock-in of exogenous genes in the sheep genome, and a construction method and application of a CRISPR-mediated red fluorescent labeled sheep fibroblast cell line, which provides a tool cell with safe integration site, high preparation efficiency and no influence on the normal transduction of p53 signaling pathway for sheep CRISPR gene editing research.

[0010] The present application first provides a construction method of a CRISPR-mediated red fluorescent labeled sheep fibroblast cell line, comprising the following steps:

[0011] Step one, constructing a Cas9 site-directed knock-out plasmid containing the target sequence of the MSTN gene;

[0012] Step two, constructing a plasmid Donor-1 kb HA-mCherry containing the homologous arm of the MSTN gene:

[0013] The sequence of 1 kb upstream of the MSTN gene is set as the left homologous arm, and the sequence of 1 kb downstream of the MSTN gene is set as the right homologous arm; the Donor-1 kb HA-mCherry homologous repair plasmid is constructed by connecting the four DNA fragments of the left homologous arm, the CMV-mCherry-pA expression structure, the right homologous arm and the pmCherry-N1 plasmid through seamless cloning technology;

[0014] The nucleotide sequence of the CMV-mCherry-pA expression structure is 1008-2628 of SEQ ID No: 4;

[0015] Step three, constructing a donor DNA containing a fluorescent protein mCherry expression frame:

[0016] The Donor-1 kb HA-mCherry obtained in step three is amplified with primers to obtain a fluorescent protein mCherry expression frame donor DNA of UAS sequence; the nucleotide sequence of the UAS sequence is 3622-3638 of SEQ ID No: 5;

[0017] Step four, preparation of a red fluorescent labeled sheep fibroblast cell line:

[0018] Further, the sequence of the plasmid Donor-1 kb HA-mCherry is shown as SEQ ID No: 4.

[0019] Further, the Cas9 site-specific knockout plasmid containing the MSTN gene target sequence can be pX459-MSTN sgRNA or pX330-MSTN sgRNA and pX330-Gal4 / Cas9-MSTN sgRNA.

[0020] The MSTN gene target sequence is 5'-ggtttgcttggtgcacaaga-3'.

[0021] The pX459-MSTN sgRNA is used for detecting the efficiency of MSTN gene target site gene knockout, and the detection steps can be specifically as follows: the pX459-MSTN sgRNA plasmid is transfected into sheep fibroblasts, and after the genome is extracted, the knockout efficiency of the MSTN sgRNA is detected by PCR amplification combined with TA cloning.

[0022] Further, the construction method of the pX330-Gal4 / Cas9-MSTN sgRNA is as follows steps (1)-(3):

[0023] Step (1), annealing single-stranded DNA to form double-stranded DNA;

[0024] The DNA sequences shown as SEQ ID No: 2 and SEQ ID No: 3 are dissolved respectively, then mixed and placed in a PCR instrument for annealing to obtain annealing Mix;

[0025] Step (2), the pX330-Gal4 / Cas9 plasmid is cut with BsmBI enzyme;

[0026] The pX330-Gal4 / Cas9 plasmid contains a Gal4 / BD fragment, and the nucleotide sequence of the Gal4 / BD fragment is SEQ ID No: 6; the Gal4 / BD fragment is fused to the N-terminal of the Cas9 protein through a flexible linker (32 aa: SGGSx2-XTEN-SGGSx2);

[0027] Step (3), the annealing Mix and the enzyme cutting product of step (2) are subjected to a ligation reaction with a T4 DNA ligase kit to obtain the site-specific knockout plasmid pX330-Gal4 / Cas9-MSTN sgRNA of step one.

[0028] The application also provides the site-specific knockout plasmid as described above.

[0029] The application further provides the plasmid Donor-1 kb HA-mCherry in the method described above. The sequence of the plasmid Donor-1 kb HA-mCherry is shown in SEQ ID No: 4; wherein the 8-1007th of SEQ ID No: 4 is the genomic left homologous arm sequence of the MSTN gene, the 1008-2628th of SEQ ID No: 4 is the CMV-mCherry-pA expression structure, and the 2629-3628th of SEQ ID No: 4 is the genomic right homologous arm sequence of the MSTN gene.

[0030] The application further provides the use of the method described above in the preparation of a fluorescently labeled sheep fibroblast cell line.

[0031] The application further provides the use of the method described above in the improvement of the site-specific integration efficiency of the mCherry gene in a sheep fibroblast cell line.

[0032] The application further provides the stably transfected fluorescently labeled sheep fibroblast cell line constructed in the method described above.

[0033] The application further provides the use of the stably transfected fluorescently labeled sheep fibroblast cell line described above in sheep gene editing research.

[0034] After screening under a fluorescence microscope, PCR identification and sequencing verification, under the condition of no fluorescent enrichment and antibiotic screening, the large fragment mCherry gene knock-in efficiency in the Gal4 / Cas9 group reached 12.37% (12 / 97), which was 2.42 times higher than that of the Cas9 group (5.10%) (5 / 98).

[0035] The use of the sheep genome integration target site (MSTN / sgRNA) provided by the application can efficiently create a fluorescent gene site-knocking-in sheep monoclonal cell strain that does not affect the normal transduction of the p53 signaling pathway based on the CRISPR / Cas9-Gal4 system, thereby improving the preparation efficiency, shortening the preparation period, and avoiding the risk of random insertion of exogenous genes.

[0036] The SFF-MSTN / mCherry sheep fibroblast monoclonal cell strain created by the application has the characteristics of normal morphology and good growth state, and has the advantage of high expression of red fluorescence, which can provide important tool cell lines for sheep gene editing research such as optimization of gene knockout / point mutation conditions, verification or development of new CRISPR gene editing systems, etc. BRIEF DESCRIPTION OF DRAWINGS

[0037] Figure 1 Figure 1 shows the design map of sheep MSTN / sgRNA target sites, the structure map of pX459 plasmid and the schematic diagram of gene knockout base mutation types. A, the structure map of sheep MSTN gene and the designed crRNA target sites; B, the structure map of commercial pX459 plasmid containing a puromycin (Puro) resistance gene; C, the base mutation types and mutation efficiency of target sites after electroporation of pX459-MSTN sgRNA gene knockout plasmid into sheep fibroblasts.

[0038] Figure 2 Figure 2 shows the structure maps of commercial pX330 and constructed pX330-Gal4 / Cas9 plasmids. A, the structure map of pX330 vector, which does not contain fluorescent and drug screening markers; B, the structure map of pX330-Gal4 / Cas9 vector, in which Gal4BD is fused to the N-terminus of Cas9 protein through a flexible linker.

[0039] Figure 3 Figure 3 shows the schematic diagram of mCherry gene knock-in, the statistical table of positive monoclonal preparation and the PCR and sequencing verification map. A, the schematic diagram of mCherry gene knock-in. The structure of the donor template is a 1621 bp CMV-mCherry-pA fluorescent expression structure and 1000 bp homologous arms on both sides, and the 3' end of the donor template of the Gal4 / Cas9 group also carries a 17 bp UAS sequence; B, the statistical table of positive monoclonal preparation. The control group is transfected with pX330-MSTN sgRNA+mCherry donor template, and the experimental group is transfected with pX330-Gal4 / Cas9-MSTN sgRNA+mCherry / UAS donor template; C, the 3' end PCR positive detection map of monoclonal cell strains. The 3' ends of 8 and 17 red fluorescent positive monoclonals screened from the control group and the experimental group under the fluorescence microscope are further subjected to PCR positive verification; D, the Sanger sequencing map of the MSTN knock-in site of the mCherry gene knock-in positive monoclonal cell strain.

[0040] Figure 4Figure A, CasMINI-Puro plasmid structure diagram, containing Puro resistance gene. B, Schematic diagram of Cas9 and CasMINI large fragment gene knockout in SFF-MSTN / mCherry sheep tool cell line, 2 Cas9-mCherry sgRNAs and 2 CasMINI-mCherry sgRNAs were designed for the 5' and 3' flanking of the mCherry gene in the genome, respectively. C, Red fluorescence proportion under fluorescence microscope after Cas9 and CasMINI gene editing, Knock-in: unedited SFF-MSTN / mCherry control group. D, Statistical diagram of Cas9 and CasMINI large fragment gene knockout efficiency, ** P<0.01. DETAILED DESCRIPTION

[0041] The application will be further described in conjunction with the specific embodiments. The examples given are only to illustrate the application, and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those skilled in the art, and do not in any way constitute a limitation on the application.

[0042] The experimental methods in the following examples are all routine methods, unless otherwise specified, which are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained commercially.

[0043] The quantitative tests in the following examples, unless otherwise specified, are set up with three repeated experiments, and the results are averaged.

[0044] The sheep primary fetal fibroblasts in the following examples have been described in: Yan Li, Di Lian, Jiahao Wang, Yue Zhao, Yao Li, Guoshi Liu, Sen Wu, Shoulong Deng, Xuguang Du, and Zhengxing Lian; MDM2 antagonists promote CRISPR / Cas9-mediated precise genome editing in sheep primary cells; Molecular Therapy-Nucleic Acids; Vol. 31, 309-323. The biological material can be obtained from the applicant, which is only used for repeating the experiments of the application, and cannot be used for other purposes.

[0045] Example 1. CRISPR-mediated red fluorescent labeled sheep fibroblast cell line and its construction method

[0046] 1. crRNA design of sheep MSTN gene

[0047] Log in to the NCBI database (www.ncbi.nlm.nih.gov), search and download the sheep MSTN gene sequence (GeneID: 443449, updated on May 12, 2024). The sheep MSTN gene is 6757 bp long and consists of 3 exons and 2 introns ( Figure 1 A in the middle). Based on the sgRNA design principles such as "the length is generally 20 nt; the GC content is preferably between 40-60%, and it should not end with more than 4 Ts; if a U6 promoter-driven sgRNA expression vector is constructed, it is necessary to consider that the 5' base of the sgRNA is G or GG to improve its transcription efficiency", a crRNA with a length of 20 nt and a GC content of 50% was artificially designed for the third exon (CDS-3) of the MSTN gene. The specific sequence is crRNA: 5'-ggUUUgcUUggUgcacaaga-3' (SEQ ID No: 1) ( Figure 1 Middle A).

[0048] 2. Construction of pX459-MSTN sgRNA plasmid

[0049] The primers crRNA-F: 5'-caccgggtttgcttggtgcacaaga-3' (SEQ ID No: 2) and crRNA-R: 5'-aaactcttgtgcaccaagcaaaccc-3' (SEQ ID No: 3) were sent to the company for synthesis and construction of the pX459-MSTN sgRNA gene knockout plasmid.

[0050] After synthesis, the primers were first phosphorylated. A 10 μL system consisted of: 1 μL upstream primer (100 μM), 1 μL downstream primer (100 μM), 1 μL T4 ligation buffer (10×; NEB, M0202S), 1 μL T4 PNK (NEB, M0202S), and 6 μL ddH2O. Annealing was then performed using the following conditions: 37°C for 30 min, followed by a temperature decrease from 95°C to 25°C at a rate of 5°C / min. The commercial pX459 empty plasmid (Addgene plasmid #48139, Figure 1After the gel was cut and purified, the phosphorylated and annealed upstream and downstream primers and the pX459 empty plasmid recovered by gel purification were connected using T4 ligase (NEB, M0202S) under the following conditions: 1 μL annealing Mix, 1 μL pX459 enzyme digestion product, 1 μL T4 ligation buffer (10 ×), 1 μL T4 ligation, 6 μL ddH2O, 16 ℃ metal bath overnight connection. Finally, the ligation product was transformed using DH5α competent cells (Tiangen, CB101), and after 12 h of plating, single colonies were picked and the plasmid was extracted and sent to the company for sequencing to verify whether the connection was correct, obtaining the pX459-MSTN sgRNA plasmid.

[0051] The structure of the pX459-MSTN sgRNA plasmid is described as follows: a DNA fragment with the sequence of SEQ ID No 1 is inserted between the two BbsI enzyme digestion sites of the backbone vector pX459, and the other sequences of the backbone vector pX459 remain unchanged to obtain a recombinant vector.

[0052] 3. Detection of MSTN gene knockout efficiency of pX459-MSTN sgRNA plasmid in sheep primary fetal fibroblasts

[0053] The constructed pX459-MSTN sgRNA plasmid was subjected to large-scale extraction using the Endo-Free Plasmid Miniprep Kit (Tiangen, DP117), and the concentration was required to be above 1000 ng / μL to be qualified.

[0054] The sheep primary fetal fibroblasts preserved by the research group were recovered and subcultured, and the basic culture medium was DMEM / F12 (Gibco, 11320033) supplemented with 10% FBS (Gibco, A5669701) and 1% double antibody (Gibco, 15070063). After stable growth, 1 × 10 6 cells were trypsinized, and the Nucleofector TM 2b electroporation instrument of Lonza Company, A033 electroporation program, and the Basic Nucleofector ® Kit for Primary Mammalian Fibroblasts (VPI-1002) electroporation liquid reagent kit were used to electroporate 15 μg of pX459-MSTN sgRNA plasmid into sheep fetal fibroblasts. After 48 h of electroporation, 900 ng / μL of puromycin (Gibco, A1113803) was added to the culture medium, and after 72 h of drug selection, the genomic DNA of the remaining adherent living cells was extracted using the kit (Takara, 9765).

[0055] Primers were designed upstream and downstream of MSTN crRNA (MSTN-TA-F: 5'-gaagcttttggatgggattggat-3', MSTN-TA-R: 5'-actctaggcttatagcccgtggt-3'), and the genomic DNA of live cells was amplified by PCR using PrimeSTAR Max DNA Polymerase (Takara, R045A). The amplification system was as follows: 25 μL PrimeSTAR Max Premix (2x), 1 μL MSTN-TA-F, 1 μL MSTN-TA-R, 50 ng genomic DNA, and ddH2O to 50 μL. The amplification procedure was as follows: 98 ℃ 1 min 30 s, 98 ℃ 10 s + 56 ℃ 15 s + 72 ℃ 10 s (35 cycles), 72 ℃ 2 min 30 s, and 4 ℃ ∞.

[0056] According to the instructions, the PCR product was ligated to a blunt-ended T vector (Aidley, CV2101) and transformed using DH5α competent cells (Tiangen, CB101). After 12 h of plating, the bacterial plate was sent to the company to pick 37 single colonies for plasmid extraction and Sanger sequencing.

[0057] The results showed that 18 of the 37 single colonies carried MSTN gene mutation sequences (Table 1), i.e., the designed MSTN / sgRNA had a knockout efficiency of 48.65% (18 / 37) in the sheep genome. Figure 1 C), i.e., the designed MSTN / sgRNA had a knockout efficiency of 48.65% (18 / 37) in the sheep genome.

[0058] 4. Construction of pX330-Gal4 / Cas9 fusion co-expression plasmid, pX330-MSTN sgRNA and pX330-Gal4 / Cas9-MSTN sgRNA gene knockout plasmid, and Donor-1 kb HA-mCherry homologous repair plasmid

[0059] 1) Construction of pX330-Gal4 / Cas9 plasmid

[0060] The Gal4BD sequence synthesized by the company (SEQ ID No: 6, containing 2 Bsal enzyme cutting sites at the 3' end) was amplified by PCR using the primers N-Gibson-LF (5'-CTTTTTTTCAGGTTGGACCGGTgccaccatgaaacggacagccg-3') and N-Gibson-MR (5'-GGCCGATGCTGTACTTCTTGTCaGAGACCgactGGTCTCgcgat-3') and PrimeSTAR Max DNA Polymerase, and the amplification system was as follows: 25 μL PrimeSTAR Max Premix (2 ×), 1 μL N-Gibson-LF, 1 μL N-Gibson-MR, 1 ng Gal4BD plasmid, and ddH2O to 50 μL; the amplification program was as follows: 98 ℃ 1 min 30 s, 98 ℃ 10 s + 59 ℃ 15 s + 72 ℃ 15 s (35 cycles), 72 ℃ 2 min 30 s, and 4 ℃ ∞.

[0061] Meanwhile, the primers N-Gibson-MF (5'-GACAAGAAGTACAGCATCGGCC-3') and N-Gibson-RR (5'-GCCATCTCGTTGCTGAAGATCT-3') were designed, and pX330 blank vector was amplified by PCR using PrimeSTAR Max DNA Polymerase, and the amplification system was as follows: 25 μL PrimeSTAR Max Premix (2 ×), 1 μL N-Gibson-MF, 1 μL N-Gibson-RR, 1 ng pX330 blank plasmid, and ddH2O to 50 μL; the amplification program was as follows: 98 ℃ 1 min 30 s, 98 ℃ 10 s + 65 ℃ 15 s + 72 ℃ 10 s (35 cycles), 72 ℃ 2 min 30 s, and 4 ℃ ∞, thereby obtaining the Gal4BD fragment and part of the Cas9 fragment.

[0062] The pX330 empty plasmid was double digested with Age I (NEB, R3552S) and Bgl II (NEB, R0144S) restriction enzymes, and the large fragment of the double-digested backbone plasmid was purified using an agarose gel purification recovery kit (Aidley, DR0102). The Gal4BD fragment, the partial Cas9 fragment, and the double-digested large fragment of the backbone plasmid were ligated according to the instructions of a seamless cloning kit (Quawell, CU101-02), thereby constructing the pX330-Gal4 / Cas9-Blank plasmid in which Gal4BD was fused to the N terminus of the Cas9 protein. Figure 2 B).

[0063] The pX330-Gal4 / Cas9-Blank plasmid was then single digested with Bsa I (NEB, R3733S), and the digested product was recovered using a PCR product purification recovery kit (Aidley, DR0202). Meanwhile, primers N-Gal4-linker 32 aa-F (5'- ATCGTCTGGAGGATCTAGCGGAGGATCCTCTGGCAGCGAGACACCAGGAACAAGCGAGTCAGCAACACCAGAGAGCAGTGGCGGCAGCAGCGGCGGCAGC-3') and N-Gal4-linker 32 aa-R (5'- TGTCGCTGCCGCCGCTGCTGCCGCCACTGCTCTCTGGTGTTGCTGACTCGCTTGTTCCTGGTGTCTCGCTGCCAGAGGATCCTCCGCTAGATCCTCCAGA-3') containing a 32 aa linker sequence were designed.

[0064] The primers N-Gal4-linker 32 aa-F and N-Gal4-linker 32 aa-R were phosphorylated and annealed as described in the step "2, Construction of pX459-MSTN sgRNA plasmid" and cloned into the Bsa I single-digested pX330-Gal4 / Cas9-Blank plasmid using T4 ligase, thereby constructing the pX330-Gal4 / Cas9 plasmid in which Gal4BD was fused to the N terminus of the Cas9 protein via a 32 aa (SGGSx2-XTEN-SGGSx2) linker.

[0065] The structure of the pX330-Gal4 / Cas9 plasmid is described as follows: a DNA fragment of SEQ ID No: 7, 948-1043, was inserted between the Bsa I digestion sites of the backbone vector pX330, and the other sequences of the backbone vector pX330 were maintained, thereby obtaining a recombinant vector.

[0066] 2) MSTN crRNA designed in step 1 was ligated to the commercialized pX330 plasmid (Addgene plasmid #42230, http: / / www.addgene.org / plasmid / 42230 / ) by T4 ligase according to the method described in step 2, obtaining pX330-MSTN sgRNA plasmid. Figure 2

[0067] The structure of pX330-MSTN sgRNA plasmid is described as follows: a DNA fragment with the sequence of 5'-ggtttgcttggtgcacaaga-3' was inserted between the two Bbsl enzyme cutting sites of the backbone vector pX330, and the other sequences of the backbone vector pX330 were kept unchanged, obtaining the recombinant vector.

[0068] 3) MSTN crRNA designed in step 1 was ligated to the pX330-Gal4 / Cas9 plasmid constructed above by T4 ligase according to the method described in step 2, Figure 2

[0069] The structure of pX330-Gal4 / Cas9-MSTN sgRNA gene targeting plasmid is described as follows: a DNA fragment with the sequence of SEQ ID No: 7 at positions 8430-8449 was inserted between the two Bbsl enzyme cutting sites of the backbone vector pX330-Gal4 / Cas9, and the other sequences of the backbone vector pX330-Gal4 / Cas9 were kept unchanged, obtaining the recombinant vector.

[0070] 4) Construction of Donor-1 kb HA-mCherry homologous repair plasmid

[0071] The left homologous arm amplification primer Left HA-F / Left HA-R and the right homologous arm amplification primer Right HA-F / Right HA-R were designed with 3 bp upstream of the PAM of the MSTN / crRNA target site (5'-ggtttgcttggtgcacaaga-3') as the interval, and the length of the left and right homologous arms was 1000 bp.

[0072] Left HA-F: 5'-tattaccgccatgcattagttatgatgtattcctcagaattttcca-3'; ​​

[0073] Left HA-R: 5'-gaccccgtaattgattactattaagatgggtatgaggatacttttg-3';

[0074] Right HA-F: 5'-ttgtccaaactcatcaatgtatctgtgcaccaagcaaaccccaaag-3';

[0075] Right HA-R: 5'-aacgcttacaatttacgccttaattatttcatcctaaaagctgcag-3'.

[0076] PCR primers mCherry-F / mCherry-R for designing CMV-mCherry-pA fluorescent expression construct and PCR primers GJ-F / GJ-R for backbone plasmid pmCherry-Nl.

[0077] mCherry-F: 5'-taatagtaatcaattacggggtc-3';

[0078] mCherry-R: 5'-gatacattgatgagtttggacaa-3';

[0079] GJ-F: 5'-ttaaggcgtaaattgtaagcgtt-3';

[0080] GJ-R: 5'-ataactaatgcatggcggtaata-3'.

[0081] Sheep genome and pmCherry-N1 commercial vector (Clontech, 632523) were amplified by PCR using PrimeSTAR Max DNA Polymerase (Takara, R045A) and corresponding primers, respectively. The amplification system was as follows: 25 μL PrimeSTAR Max Premix (2 ×), 1 μL upstream primer, 1 μL downstream primer, 50 ng sheep genome or 1 ng pmCherry-N1, and ddH2O to 50 μL. The amplification procedure was as follows: 98 ℃ 1 min 30 s, 98 ℃ 10 s + 62 ℃ 15 s + 72 ℃ 30 s (35 cycles), 72 ℃ 2 min 30 s, 4 ℃ ∞. The four PCR products were recovered using a DNA purification kit (Tiangen, DP205), and the four PCR fragments were ligated to construct the Donor-1 kb HA-mCherry homologous repair plasmid using a seamless cloning kit (Quazolink, CU101-02) according to the instructions. After transformation and plating, the plasmid was sequenced by the company.

[0082] The nucleotide sequence of the Donor-1 kb HA-mCherry homologous repair plasmid is SEQ ID No: 4.

[0083] 5. Preparation of CMV-mCherry-pA donor template with 1 kb left and right homologous arms

[0084] Two PCR primers were designed for the Donor-1 kb HA-mCherry homologous repair plasmid. One downstream primer carried a UAS sequence (Donor / UAS-R: 5'-cggaaagcttccttccgttatttcatcctaaaagctgcag-3'), and the other did not (Donor-R: 5'-ttatttcatcctaaaagctgcag-3'). The upstream primer was universal (Donor-F: 5'-gatgtattcctcagaattttcca-3').

[0085] PCR amplification of Donor-1 kb HA-mCherry vector using PrimeSTAR Max DNA Polymerase (Takara, R045A) and two pairs of primers, the amplification system is: 25 μL PrimeSTAR Max Premix (2 ×), 1 μL upstream primer, 1 μL downstream primer, 1 ng Donor-1 kb HA-mCherry, add ddH2O to 50 μL; the amplification program is: 98℃ 1 min 30 s, 98℃ 10 s + 59℃ 15 s + 72℃ 45 s (35 cycles), 72℃ 2 min 30 s, 4℃ ∞.

[0086] Recover the two donor templates containing UAS sequence and not containing UAS sequence using DNA purification kit (Tiangen, DP205).

[0087] 6. Preparation of CMV-mCherry-pA site-directed knock-in sheep monoclonal cell strain

[0088] According to the method described in step 3, 2.5 pmol of pX330-Gal4 / Cas9-MSTN sgRNA + 6 pmol of donor template containing UAS sequence were electroporated into sheep fetal fibroblasts (referred to as Gal4 / Cas9 group), and 2.5 pmol of pX330-MSTN sgRNA + 6 pmol of donor template not containing UAS sequence were electroporated into sheep fetal fibroblasts (referred to as Cas9 group), and the schematic diagram of gene knock-in is shown in Figure 3 A of FIG. 1.

[0089] After 48 h of electroporation, single cells of the two samples were each sorted into 10 96-well plates using a BD FACSAriaTM III flow cytometer (FIG. 1 Figure 3 B), the basic culture medium is still DMEM / F12, and the FBS is increased to 20%.

[0090] After sorting, the 96-well plates were placed in the cell incubator for culture, and after 10 days, it was found under a general / fluorescence microscope that: the Gal4 / Cas9 group grew 97 monoclonal cells, with a formation rate of 10.10%, of which 17 expressed red fluorescence; the Cas9 group grew 98 monoclonal cells, with a formation rate of 10.21%, of which 8 expressed red fluorescence (FIG. 1 Figure 3 B).

[0091] 7. PCR verification of red fluorescence expressing monoclonal cells

[0092] PCR primers for detection were designed (Detection-F: 5'-ccctgaacctgaaacataaaatg-3', Detection-R: 5'-tcacgaacccataagtgaatgct-3'), and PCR verification was further carried out for red fluorescent positive monoclonal. Cell lysis solution was prepared: Tris-HCl (1M, pH=8.0) 2 ml, Triton X-100 0.45 ml, NP-40 0.45 ml, proteinase K 0.02 g, dissolved with deionized water and constant volume to 50 ml, 0.22 μm filter, 4 ℃. Eighteen red fluorescent positive monoclonal cell strains were trypsinized, half of which were cultured and the other half were lysed with cell lysis solution. PrimeSTAR Max DNA Polymerase (Takara) was used to amplify the lysate, and the system was as follows: 25 μL PrimeSTAR Max Premix (2 ×), 1 μL Dection-F, 1 μL Dection-R, 1 μL lysate, 22 μL ddH2O; the amplification program was as follows: 98 ℃ 1 min 30 s, 98 ℃ 10 s + 65 ℃ 15 s + 72 ℃ 10 s (35 cycles), 72 ℃ 2 min 30 s, 4 ℃ ∞. After amplification, the band size was observed by running the gel Figure 3 C).

[0093] PCR results showed that: Cas9 group 8 mCherry + Among the monoclonal cell strains, 5 had site-specific integration of the genomic MSTN site, and the large fragment mCherry gene knock-in efficiency was 5.10%; Gal4 / Cas9 group 17 mCherry + Among the monoclonal cell strains, 13 had site-specific integration of the genomic MSTN site, and the large fragment mCherry gene knock-in efficiency was 12.37% (C). Figure 3 B), and the gene knock-in efficiency was improved by 2.42 times.

[0094] 8. Red fluorescent strong expression monoclonal cell strain subculture and expansion culture

[0095] The red fluorescent strong expression monoclonal cell strain in the Gal4 group was screened under the fluorescence microscope, and one strain with good growth state, normal morphology and positive PCR detection was selected and named SFF-MSTN / mCherry. Sanger sequencing results showed that the exogenous mCherry gene was successfully integrated into the sheep MSTN site (C). Figure 3D). Continue to carry out subculture expansion, and currently has been cultured to the 20th generation, and the morphology is normal, indicating that the CRISPR-mediated red fluorescently labeled sheep fibroblast cell line is successfully constructed.

[0096] Example 2, Application of CRISPR-mediated red fluorescently labeled sheep fibroblast cell line

[0097] 1. CasMINI, sgRNA and Puro co-expression CasMINI-Puro plasmid construction

[0098] First, the company was sent to synthesize CasMINI and U6 / tracrRNA (containing two BsmBI enzyme cutting sites) gene sequences, and cloned into pUC57 backbone plasmid (Qingke Biology) by the company, to obtain pUC57-CasMINI, pUC57-U6 / tracrRNA.

[0099] Subsequently, the primers hU6-F: 5'-ttaccgccatgcattagttatTAATgagggcctatttcccatgatt-3' and hU6-R: 5'-ccccgtaattgattactattaATaaaaaaaagagacgatatatcgt-3' were designed, and the pUC57-U6 / tracrRNA plasmid was amplified using PrimeSTARMax DNA Polymerase (Takara), with the following system: 25 μL PrimeSTARMax Premix (2 ×), 1 μL hU6-F, 1 μL hU6-R, 1 ng pUC57-U6 / tracrRNA, 22 μL ddH2O; The amplification program is as follows: 98 ℃ 1 min 30 s, 98 ℃ 10 s + 62 ℃ 15 s + 72 ℃ 10 s (35 cycles), 72 ℃ 2 min 30 s, 4 ℃ ∞, and after amplification, the PCR product was recovered using a DNA purification kit (Tiangen, DP205), and a commercial pEGFP-N1 plasmid (Clontech, 60851) was single-enzyme cut using AseI (NEB, R0526S). After enzyme cutting, the enzyme cutting product was recovered using a DNA purification kit (Tiangen, DP205).

[0100] The U6 / tracrRNA fragment was ligated into the single-enzyme cut pEGFP-N1 backbone plasmid using a seamless cloning kit (Quanjingjin, CU101-02) according to the instructions, to form the pEGFP-N1-U6 / tracrRNA plasmid.

[0101] The structure of the pEGFP-N1-U6 / tracrRNA plasmid is described as follows: a DNA fragment with the sequence of SEQ ID No: 8 is inserted between the Ase I enzyme cutting sites of the starting vector pEGFP-N1, and the other sequences of the vector pEGFP-N1 remain unchanged to obtain a recombinant vector.

[0102] The primers CasMINI-Gibson-LF: 5'-tctcgagctcaagcttcgaattcgccaccatgggacccaagaaaaaac-3' and CasMINI-Gibson-MR: 5'-tgccctctccactgccgaattcgtctagtttaacgcgtttggca-3', and primers CasMINI-Gibson-MF: 5'-gaattcggcagtggagagggca-3' and CasMINI-Gibson-RR: 5'-tgattatgatctagagtcgcggccgctcaggcaccgggcttgcgggtc-3' were used to amplify the pUC57-CasMINI plasmid and the commercial pX459 plasmid, respectively, using PrimeSTAR Max DNA Polymerase (Takara), and the system was as follows: 25 μL PrimeSTAR Max Premix (2 ×), 1 μL CasMINI-Gibson-LF or CasMINI-Gibson-MF, 1 μL CasMINI-Gibson-MR or CasMINI-Gibson-RR, 1 ng pUC57-CasMINI or pX459 plasmid, 22 μL ddH2O; the amplification program was as follows: 98 ℃ 1 min 30 s, 98 ℃ 10 s + 62 ℃ 15 s + 72 ℃ 30 s (CasMINI fragment, 35 cycles) or 72 ℃ 15 s (T2A-Puro fragment, 35 cycles), 72 ℃ 2 min 30 s, 4 ℃ ∞, after amplification, the two PCR products were recovered using a DNA purification kit (Tiangen, DP205), and the CasMINI fragment and the T2A-Puro fragment amplified from the commercial pX459 plasmid were connected to the pEGFP-N1-U6 / tracrRNA plasmid digested with EcoRI (NEB, R3101S) and NotI (NEB, R3189S) using a seamless cloning kit (Quazimod, CU101-02) to construct the CasMINI-Puro plasmid for co-expression of CasMINI, sgRNA and Puro. Figure 4 A).

[0103] The structure of the CasMINI-Puro plasmid is described as follows: a DNA fragment with the sequence of SEQ ID No: 9 is inserted between the EcoRI and NotI enzyme cutting sites of the starting vector pEGFP-N1-U6 / tracrRNA, and the other sequences of the vector pEGFP-N1-U6 / tracrRNA remain unchanged to obtain a recombinant vector.

[0104] 2. Construction of Cas9 and CasMINI system large fragment knockout plasmids

[0105] Two Cas9 / sgRNAs are designed for the 5' and 3' flanking sequences of the mCherry gene in the sheep genome:

[0106] Cas9 mCherry sgRNA1: 5'-taataatgactccttgcggt-3';

[0107] Cas9 mCherry sgRNA2: 5'-actgtgaaattatgtaccac-3' Figure 4 B).

[0108] The primers for synthesizing and constructing the pX459-mCherry sgRNA large fragment gene knockout plasmid are sent to the company (Cas9 mCherry sgRNA1-F: 5'-caccgtaataatgactccttgcggt-3', SEQ ID No: 10; Cas9 mCherry sgRNA1-R: 5'-aaacaccgcaaggagtcattattac-3', SEQ ID No: 11; Cas9 mCherry sgRNA2-F: 5'-caccgactgtgaaattatgtaccac-3', SEQ ID No: 12; Cas9 mCherry sgRNA2-R: 5'-aaacgtggtacataatttcacagtc-3', SEQ ID No: 13).

[0109] Two CasMINI / sgRNAs are designed:

[0110] CasMINI mCherry sgRNA1: 5'-ataatgactccttgcggtaggag-3';

[0111] CasMINI mCherry sgRNA2: 5'-aaactgtgaaattatgtaccacg-3' Figure 4 B).

[0112] Primers for constructing CasMINI-Puro-mCherry sgRNA large fragment gene knockout plasmid (CasMINImCherry sgRNA1-F: 5'-GCAACataatgactccttgcggtaggag-3', SEQ ID No: 14; CasMINImCherry sgRNA1-R: 5'-aaaactcctaccgcaaggagtcattatg-3', SEQ ID No: 15; CasMINImCherry sgRNA2-F: 5'-GCAACaaactgtgaaattatgtaccacg-3', SEQ ID No: 16; CasMINImCherry sgRNA2-R: 5'-aaaacgtggtacataatttcacagtttg-3', SEQ ID No: 17).

[0113] According to the method described in step 2 of Example 1, the annealed product was respectively ligated into the BbsI (NEB, R3539M) single enzyme cut pX459 plasmid and the BsmBI (NEB, R0739S) single enzyme cut CasMINI-Puro plasmid, to obtain pX459-mCherry sgRNA1 and pX459-mCherry sgRNA2, and CasMINI-Puro-mCherry sgRNA1 and CasMINI-Puro-mCherry sgRNA2 large fragment gene knockout plasmids.

[0114] The structure of pX459-mCherry sgRNA1 is described as follows: a DNA fragment with the sequence of SEQ ID No: 18 is inserted between the BbsI enzyme cut sites of the starting vector pX459, and the other sequences of the vector pX459 remain unchanged to obtain a recombinant vector.

[0115] The structure of pX459-mCherry sgRNA2 is described as follows: a DNA fragment with the sequence of SEQ ID No: 19 is inserted between the two BbsI enzyme cut sites of the starting vector pX459, and the other sequences of the vector pX459 remain unchanged to obtain a recombinant vector.

[0116] The structure of CasMINI-Puro-mCherry sgRNA1 is described as follows: a DNA fragment with the sequence of SEQ ID No: 20 is inserted between the BsmBI enzyme cut sites of the starting vector CasMINI-Puro, and the other sequences of the vector CasMINI-Puro remain unchanged to obtain a recombinant vector.

[0117] The structure of CasMINI-Puro-mCherry sgRNA2 is described as follows: a DNA fragment with the sequence of SEQ ID No: 21 is inserted between the two BsmBI enzyme cutting sites of the starting vector CasMINI-Puro, and the other sequences of the vector CasMINI-Puro remain unchanged to obtain a recombinant vector.

[0118] 3. Comparison of large fragment knockout efficiency of Cas9 and CasMINI systems

[0119] The four large fragment gene knockout plasmids were extracted using a plasmid maxi kit (Tiangen, DP117), and 15 μg of pX459-mCherry sgRNA1+pX459-mCherry sgRNA2 plasmid and 15 μg of CasMINI-Puro-mCherry sgRNA1+CasMINI-Puro-mCherry sgRNA2 plasmid were respectively electroporated into the SFF-MSTN / mCherry sheep cell line according to the method described in step 3 of Example 1. After resistance screening with 900 ng / μL of puromycin (Gibco, A1113803), the adherent surviving cells were fixed with paraformaldehyde (Bi Yun Tian, P0099), and the cell nucleus was stained with DAPI staining solution (Bi Yun Tian, Catalog No: C1006).

[0120] The observation results under the fluorescence microscope show that the large fragment gene knockout efficiency of the classic Cas9 system is 34.77%, and the large fragment gene knockout efficiency of the CasMINI system is 11.83% (P < 0.05, t-test). Figure 4 C and D), indicating that further optimization of various conditions is needed to achieve efficient gene editing in sheep based on the new gene editing tool enzyme CasMINI.

[0121] The above has been described in detail. For those skilled in the art, without departing from the purpose and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wide range of equivalent parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that further improvements can be made to the present application. In general, according to the principle of the present application, this application intends to include any changes, uses or improvements of the present application, including changes made by conventional techniques known in the art, which are outside the scope disclosed in the present application.

Claims

1. A method for constructing a CRISPR-mediated red fluorescently labeled sheep fibroblast cell line, characterized in that: The steps include: Step 1: Construct a site-directed knockout plasmid containing the Cas9 target sequence of the MSTN gene; The construction method of the site-directed knockout plasmid is: Step (1), annealing the single-stranded DNA to form double-stranded DNA; The DNA sequences shown in SEQ ID No: 2 and SEQ ID No: 3 are dissolved respectively, then mixed and placed in a PCR instrument for annealing to obtain an annealing mix; Step (2), digest the pX330-Gal4 / Cas9 plasmid with BsmBI; The pX330-Gal4 / Cas9 plasmid contains a Gal4 / BD fragment, the nucleotide sequence of which is SEQ ID No: 6; the Gal4 / BD fragment is fused to the N-terminus of the Cas9 protein via a flexible linker; the flexible linker is 32 aa: SGGS×2-XTEN-SGGS×2; Step (3), ligating the annealed Mix and the digested product of step (2) using a T4 DNA ligase kit to obtain the site-directed knockout plasmid described in step 1; Step 2: Construct the plasmid Donor-1 kb HA-mCherry containing the homology arms of the MSTN gene: The 1 kb upstream sequence of the MSTN gene is set as the left homology arm, and the 1 kb downstream sequence is set as the right homology arm; the Donor-1 kb HA-mCherry homology repair plasmid is constructed by connecting four DNA fragments, namely the left homology arm, the CMV-mCherry-pA expression structure, the right homology arm, and the pmCherry-N1 plasmid, using seamless cloning technology; The nucleotide sequence of the CMV-mCherry-pA expression construct is positions 1008-2628 of SEQ ID No: 4; Step 3: Construct donor DNA containing the fluorescent protein mCherry expression cassette: The Donor-1 kb HA-mCherry obtained in step 2 is amplified using primers to obtain a fluorescent protein mCherry expression cassette donor DNA with a UAS sequence; the nucleotide sequence of the UAS sequence is positions 3622-3638 of SEQ ID No: 5; Step 4: Transfection of red fluorescent labeled sheep fibroblast cell line: The donor DNA containing the fluorescent protein mCherry expression cassette was co-transfected with the site-directed knockout plasmid described in step 1 into the sheep fibroblast cell line to obtain a red fluorescently labeled sheep fibroblast cell line.

2. The method according to claim 1, wherein: The nucleotide sequence of the plasmid Donor-1 kb HA-mCherry is shown in SEQ ID No:

4.

3. The site-directed knockout plasmid in the method of claim 1.

4. Use of the method according to claim 1 or 2 in preparing a fluorescently labeled sheep fibroblast cell line.

5. Use of the method according to claim 1 or 2 in improving the efficiency of site-specific knock-in of the mCherry gene in a sheep fibroblast cell line.

Images