Gnras and their use in the construction of a new strain of carassius carassius with high levels of 1 alpha, 25-dihydroxyvitamin d3

Abstract

This invention discloses gRNA and its application in constructing a new carp strain with high 1α,25-dihydroxyvitamin D3 levels. Belonging to the field of genetic engineering technology, it provides a gRNA, the nucleotide sequence of which is shown in SEQ ID NO.1. The invention also discloses the application of gRNA in constructing a new carp strain with high 1α,25-dihydroxyvitamin D3 levels, specifically in constructing a fast-growing and disease-resistant carp strain with high 1α,25-dihydroxyvitamin D3 levels. Specifically, this invention designs a highly specific target site for the carp cyp24a1 gene, synthesizes gRNA in vitro, and rapidly knocks out the cyp24a1 gene that degrades 1α,25(OH)2D3, resulting in a new carp strain with high 1α,25-dihydroxyvitamin D3 levels. 1α,25(OH)2D3 promotes fish growth and enhances fish immunity, making this fish strain of significant application value.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, and in particular relates to gRNA and its application in constructing new carp strains with high 1α,25-dihydroxyvitamin D3 levels. Background Technology

[0002] A deficiency of 1α,25-dihydroxyvitamin D3 (1α,25(OH)2D3) in the human body not only affects growth and development but also impairs immune function and inflammatory responses, increasing the risk of various diseases. Due to insufficient dietary intake of 1α,25(OH)2D3, a widespread population suffers from 1α,25(OH)2D3 deficiency.

[0003] Carp are freshwater fish belonging to the genus *Cyprinus* of the family Cyprinidae in the order Cypriniformes. They have elongated, laterally compressed bodies; rounded bellies; and relatively small heads. Their backs are grayish-black or yellowish-brown, their sides are golden-yellow, and their bellies are grayish-white. The bases of their dorsal and caudal fins are slightly black, the lower lobe of the caudal fin is red, and their paired and anal fins are pale red, although the colors often vary depending on the body of water they inhabit. Carp are delicious and nutritious, making them a staple dish at fish banquets in inland regions. Growth traits are a key yield trait of concern in aquaculture. Recent research evidence indicates that a deficiency of 1α,25(OH)₂D₃ can significantly affect the growth and metabolism of fish. Furthermore, infectious diseases in farmed animals caused by bacteria and viruses have resulted in significant losses for the aquaculture industry and have become one of the bottlenecks restricting its sustainable development. Recent studies have also shown that adding 1α,25(OH)₂D₃ to feed can significantly enhance the resistance of aquatic animals to viruses and bacteria. These results suggest that 1α,25(OH)₂D₃ may participate in the regulation of growth and immune performance in farmed aquatic animals. Therefore, providing a new carp strain with high 1α,25(OH)2D3 levels and excellent traits of rapid growth and disease resistance is of great significance to the development of the industry. Summary of the Invention

[0004] To address the aforementioned technical problems, this invention proposes gRNA and its application in constructing a new carp strain with high 1α,25-dihydroxyvitamin D3 levels. Based on the principles of gene editing technology, a highly specific target site for the carp cyp24a1 gene is designed. gRNA is synthesized in vitro to rapidly knock out the cyp24a1 gene that degrades 1α,25(OH)2D3, thereby enriching the carp with 1α,25(OH)2D3.

[0005] To achieve the above objectives, the present invention provides a gRNA, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0006] This invention also provides the application of the gRNA in constructing a new carp strain with high 1α,25-dihydroxyvitamin D3 levels.

[0007] Preferably, the gRNA targets the carp cyp24a1 gene, the nucleotide sequence of which is shown in SEQ ID NO.6.

[0008] More preferably, the gRNA increases the level of 1α,25-dihydroxyvitamin D3 in carp by targeting and knocking out the cyp24a1 gene, thereby obtaining a new carp strain with high 1α,25-dihydroxyvitamin D3 levels.

[0009] This invention also provides the application of the gRNA in constructing a new fast-growing, disease-resistant carp strain with high 1α,25-dihydroxyvitamin D3 levels.

[0010] The present invention also provides specific primers for the gRNA, wherein the nucleotide sequence of the upstream primer of the gRNA is shown in SEQ ID NO.4 and the nucleotide sequence of the downstream primer of the gRNA is shown in SEQ ID NO.5.

[0011] The present invention also provides the application of the specific primers of the gRNA in constructing a new carp strain with high 1α,25-dihydroxyvitamin D3 levels. The specific primers of the gRNA increase the 1α,25-dihydroxyvitamin D3 level in carp by targeting and knocking out the cyp24a1 gene in carp, thereby obtaining a new carp strain with high 1α,25-dihydroxyvitamin D3 levels.

[0012] This invention also provides a method for constructing a new carp strain with high 1α,25-dihydroxyvitamin D3 levels, comprising the following steps:

[0013] (1) Design of gRNA targeting the cyp24a1 gene based on CRISPR / Cas9 technology;

[0014] (2) Construct an expression vector containing the gRNA described in step (1), and transcribe it in vitro to obtain gRNA;

[0015] (3) The gRNA and Case9 protein obtained in step (2) were injected into wild-type single-cell carp embryos to obtain the injected carp embryos.

[0016] (4) The carp embryos obtained after injection in step (3) are bred into P0 generation carp. The P0 generation carp are genotyped and screened to obtain P0 generation mutant carp with cyp24a1 gene knockout where gRNA target sites on both the sense and antisense strands are simultaneously mutated.

[0017] (5) Select female mutants from the P0 generation mutant carp described in step (4) and mate them with wild-type male carp. Perform genotyping and screen to obtain F1 generation mutant female carp with simultaneous mutations of the gRNA target sites on the sense and antisense strands and knockout of the cyp24a1 gene.

[0018] (6) Select the male mutant of the P0 generation mutant carp described in step (4) and mate it with the F1 generation mutant female carp described in step (5) to obtain F2 generation embryos, raise them to sexual maturity, and screen to obtain F2 generation cyp24a1 gene knockout homozygous mutants, that is, obtain a new carp strain with high 1α,25-dihydroxyvitamin D3 level.

[0019] Preferably, the nucleotide sequence of the gRNA in step (1) is shown in SEQ ID NO.1.

[0020] Preferably, the nucleotide sequence of the cyp24a1 gene in step (1) is shown in SEQ ID NO.6.

[0021] Compared with the prior art, the present invention has the following advantages and technical effects:

[0022] The principle of this invention: Vitamin D3 (VD3), as a prohormone, is inactive on its own. It needs to be converted into 25(OH)D3 by 25-hydroxylase encoded by the CYP2R1 gene in the liver. Then, it is hydroxylated a second time by 1α-hydroxylase encoded by CYP27B1, forming the biologically active 1α,25-dihydroxyvitamin D3 (1α,25(OH)2D3). 1α,25(OH)2D3 and excess 25(OH)D3 are further metabolized by 24-hydroxylase encoded by the cyp24a1 gene into inactive 23-hydroxylated products or 24-hydroxylated products (such as...). Figure 1 The cyp24a1 gene is located on chromosome 6 and has 12 exons. Knocking out the cyp24a1 gene in carp can block the hydroxylation of 25(OH)D3 and 1α,25(OH)2D3, maintaining a high level of 1α,25(OH)2D3 in the fish.

[0023] This invention, based on the principles of gene editing technology, designs a highly specific target gRNA for the cyp24a1 gene in carp. The gRNA is synthesized in vitro, and Cas9 protein and gRNA are thoroughly mixed. This mixture is then injected into single-celled wild-type carp embryos. Newly hatched fry are sequenced to verify the effectiveness of the target. Tail clipping and sequencing are performed on appropriately sized carp to screen for the carp mutant P0. P0 mutants are backcrossed with wild-type carp to obtain the F1 generation, from which heterozygous mutants are selected. The male and female F1 heterozygous mutants are self-crossed, and sequencing is used to obtain the F2 generation of homozygous mutants with the cyp24a1 gene deletion. This construction method can rapidly knock out the cyp24a1 gene that degrades 1α,25(OH)2D3, enriching the carp with 1α,25(OH)2D3. Since 1α,25(OH)2D3 promotes fish growth and enhances immunity, this fish has significant industrial application value.

[0024] The construction method described in this invention yields a new carp strain with high 1α,25-dihydroxyvitamin D3 levels, providing people with a new dietary source of 1α,25(OH)2D3, which will help solve the increasingly serious problem of 1α,25(OH)2D3 deficiency. Attached Figure Description

[0025] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0026] Figure 1 This refers to the activation and metabolism of vitamin D3.

[0027] Figure 2 Results of gRNA efficacy assay for the cyp24a1 gene target;

[0028] Figure 3 This is a P0 generation cyp24a1 gene knockout mutant carp;

[0029] Figure 4 Results of efficacy assay for gRNA targeting the cyp24a1 gene in the F1 generation;

[0030] Figure 5 The carp is a homozygous mutant of the F2 generation cyp24a1 gene knockout. Detailed Implementation

[0031] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0032] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0033] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0034] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0035] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0036] Example 1

[0037] I. Methods for constructing new carp strains with high 1α,25-dihydroxyvitamin D3 levels

[0038] 1. Target design

[0039] Based on the carp cyp24a1 gene sequence (Ensembl accession number ENSCCRG00000023843, SEQ ID NO. 6), a target site for the cyp24a1 gene was designed using the CRISPR / Cas9 target design website (https: / / www.crisprscan.org / sequence / ) and in accordance with the target site design principles. A site was selected in the second exon region to obtain the gRNA.

[0040] The nucleotide sequence of the gRNA is SEQ ID NO.1: GAGGCTCTTTACAGGAAGGAGG.

[0041]

[0042] 2. Design detection primers

[0043] Design target-specific gRNA PCR primers. Primers were designed using Primer 5.0 software based on the genomic sequence of the carp cyp24a1 gene. The upstream gRNA primer CC-cyp24a1-F: AGCTGGGCTCTTTTGAATCG (SEQ ID NO.4); and the downstream gRNA primer CC-cyp24a1-R: CTCGCATGTCTCTGTAGGCTT (SEQ ID NO.5) were used to test the effectiveness of target knockout.

[0044] 3. gRNA DNA template design

[0045] The gRNA DNA template sequence consists of the T7 promoter sequence, the sequence encoding the target-specific gRNA, and the constant region of crRNA / tracrRNA. The gRNA is obtained by PCR amplification using the pGH-T7-zCas9 plasmid as a template and primers with nucleotide sequences as shown in SEQ ID NO. 2 and SEQ ID NO. 3, followed by transcription. The T7 promoter sequence is ligated to the gRNA target sequence as a template, and PCR amplification is performed using universal T7 promoter primers. The amplification system is shown in Table 1, and the amplification program is shown in Table 2.

[0046] SEQ ID NO. 2: TAATACGACTCACTATAGGAGGCTCTTTACAGGA.

[0047] SEQ ID NO. 3: TTCTAGCTCTAAAACCCTCCTTCCTGTAAAGAGC.

[0048] Table 1 Amplification System

[0049]

[0050] Table 2 Amplification Procedure

[0051]

[0052] 4. Transcription to generate gRNA

[0053] The transcription system is shown in Table 3.

[0054] Table 3 Transcription System

[0055]

[0056] Prepare the system according to Table 3, mix well, centrifuge, and incubate at 37°C for 3 hours. Immediately after the transcription reaction, add 1 µL of deoxyribonuclease and incubate at 37°C for 15 minutes.

[0057] 5. gRNA purification

[0058] The in vitro transcribed gRNA was purified using a kit (purchased from Thermo Fisher, catalog number A29377). The purification procedure was as follows: first, add enzyme-free water to make the total volume 200µL. Add 100µL of binding buffer and mix by pipetting; then add 300µL of anhydrous ethanol and mix by pipetting; transfer the mixture to a GeneJET™ RNA purification column fitted with a collection tube, centrifuge at 14000 rpm for 60 seconds at room temperature, and discard the liquid; add 700µL of Wash Buffer 1 (ensuring dilution with 13mL >96% anhydrous ethanol), centrifuge at 14000 rpm for 60 seconds at room temperature, and discard the liquid; add 700µL of Wash Buffer 2 (ensuring dilution with 30mL >96% anhydrous ethanol), centrifuge at 14000 rpm for 60 seconds at room temperature, and discard the liquid; add another 700µL of Wash Buffer 2, centrifuge at 14000 rpm for 60 seconds at room temperature, and discard the liquid; centrifuge the empty tube at 14000 rpm for 60 seconds at room temperature (residual anhydrous ethanol in the RNA sample will inhibit the downstream enzyme reaction); then transfer the column to a new 1.5mL... Add 15µL of enzyme-free water to the EP tube and centrifuge at 14000rpm for 60s at room temperature. Add the centrifuged solution back into the column tube and centrifuge again at 14000rpm for 60s (to improve recovery rate). Finally, measure the concentration using a micro spectrophotometer. Store the stock solution in a liquid nitrogen tank and store the diluent at -80℃ for later use.

[0059] 6. Injection of Cas9 protein and gRNA into carp embryos

[0060] Dilute Cas9 protein to 5000 ng / µL, take 1 µL of Cas9 protein and mix it with 1 µL of gRNA (concentration of 1000 ng / µL); adjust the microinjection instrument parameters. Select normal wild-type carp embryos that have developed to the single-cell stage, arrange them neatly on the injection mold, and microinject the mixture into the yolk of the embryos, with an injection volume of 2 nL per embryo; immediately place the injected embryos in aerated water and continue to incubate and culture at 28℃.

[0061] 7. Detection of the effectiveness of the cyp24a1 gene target site

[0062] After the carp fry ruptured, 24 carp fry were randomly selected from those that had undergone "carp embryo injection of Cas9 protein and gRNA," one fry per tube. 20 µL of lysis buffer was added, and the fry were lysed in a PCR instrument to extract cDNA. Amplification was performed using a 25 µL system. The PCR reaction system consisted of: PCR Taq Mix, 12.5 µL; upstream and downstream primers (SEQ ID NO.4 and SEQ ID NO.5), 1 µL each; genomic cDNA, 2 µL; ddH2O, 8.5 µL; and 39 cycles. The amplified PCR products were sequenced, and the peak patterns were used to determine if there were any mutations at the target site.

[0063] SEQ ID NO. 4: AGCTGGGCTCTTTTGAATCG.

[0064] SEQ ID NO. 5: CTCGCATGTCTCTGTAGGCTT.

[0065] 8. Screening for P0 mutants of the cyp24a1 gene in carp

[0066] The injected P0 embryos were raised to three months of age, anesthetized, tail clipped, and P0 carp genomes were extracted using the method described above. After PCR amplification, the genomes were sequenced (e.g., ...). Figure 2 (As shown). If the sequencing results show a double peak at the target site, it indicates the presence of a mutant of the cyp24a1 gene in carp, i.e., obtaining a P0 mutant with cyp24a1 gene knockout (e.g., ...). Figure 3 (As shown).

[0067] 9. Screening of F1 generation mutants of the carp cyp24a1 gene

[0068] The P0 mutant was crossed with wild-type carp. After the offspring were raised to a suitable size, they were anesthetized, their tails clipped, and their genomes extracted using the method described above. The genomes were then amplified by PCR and sequenced. If the sequencing results showed a double peak at the target site, it indicated F1 generation carp with the cyp24a1 gene deletion (e.g., ...). Figure 4 (as shown), and raise them until sexually mature.

[0069] 10. Screening of homozygous mutants of the F2 generation of the carp cyp24a1 gene

[0070] The tails of sexually mature F1 generation carp were cut off one by one, and their genomes were extracted and sequenced. F1 generation female and male carp with the same type of cyp24a1 gene knockout were self-crossed to obtain F2 generation embryos, which were then raised to sexual maturity. F2 generation cyp24a1 gene knockout homozygous mutants (e.g., ...) were selected. Figure 5 As shown in the figure, this led to the successful construction of a new carp strain with high 1α,25(OH)2D3 level by knocking out the cyp24a1 gene.

[0071] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A gRNA, characterized in that, The nucleotide sequence of the gRNA is shown in SEQ ID NO.

1.

2. The application of the gRNA as described in claim 1 in constructing a new carp strain with high 1α,25-dihydroxyvitamin D3 levels.

3. The application according to claim 2, characterized in that, The gRNA targets the carp cyp24a1 gene, the nucleotide sequence of which is shown in SEQ ID NO.

6.

4. The application according to claim 3, characterized in that, The gRNA targets and knocks out the cyp24a1 gene in carp, increasing the level of 1α,25-dihydroxyvitamin D3 in carp and obtaining a new carp strain with high 1α,25-dihydroxyvitamin D3 levels.

5. A method for constructing a new carp strain with high levels of 1α,25-dihydroxyvitamin D3, characterized in that, Includes the following steps: (1) Design of gRNA targeting the cyp24a1 gene based on CRISPR / Cas9 technology; (2) Construct an expression vector containing the gRNA described in step (1), and transcribe it in vitro to obtain gRNA; (3) The gRNA and Case9 protein obtained in step (2) were injected into wild-type single-cell carp embryos to obtain the injected carp embryos. (4) The carp embryos obtained after injection in step (3) are bred into P0 generation carp. The P0 generation carp are genotyped and screened to obtain P0 generation mutant carp with cyp24a1 gene knockout where gRNA target sites on both the sense and antisense strands are simultaneously mutated. (5) Select female mutants from the P0 generation mutant carp described in step (4) and mate them with wild-type male carp. Perform genotyping and screen to obtain F1 generation mutant female carp with simultaneous mutations of the gRNA target sites on the sense and antisense strands and knockout of the cyp24a1 gene. (6) Select the male mutant of the P0 generation mutant carp described in step (4) and mate it with the F1 generation mutant female carp described in step (5) to obtain F2 generation embryos, raise them to sexual maturity, and screen to obtain F2 generation cyp24a1 gene knockout homozygous mutants, that is, obtain a new carp strain with high 1α,25-dihydroxyvitamin D3 level. The nucleotide sequence of the gRNA described in step (1) is shown in SEQ ID NO.

1.

6. The method for constructing a new carp strain with high 1α,25-dihydroxyvitamin D3 levels according to claim 5, characterized in that, The nucleotide sequence of the cyp24a1 gene described in step (1) is shown in SEQ ID NO.6.

Images