Multivalent DNA (deoxyribonucleic acid) nano material as well as preparation method and application thereof

Abstract

The invention discloses a multivalent DNA nano-material as well as a preparation method and application thereof. The cancer immunotherapy effect can be enhanced through a simple DNA nano-structure (DNAB). By accurately regulating and controlling the proportion of two aptamers (a T cell aptamer A8 and an OCI-LY8 cell aptamer sgd5) in the DNA nanostructure, the proportion of a T cell to an OCI-LY8 cell can be regulated and controlled to be n: 1. Experimental results show that the immune response is remarkably enhanced through proportional regulation, the immunotherapy effect can be effectively improved by regulating the proportion of the aptamer under the condition that the immune response is weak or not ideal, and particularly, a remarkable immune enhancement effect is shown in a low immune response environment.

Description

Technical Field

[0001] The present invention belongs to the technical field of DNA nanomaterials, and in particular relates to a multivalent DNA nanomaterial and a preparation method and application thereof. Background Art

[0002] DNA is not only a repository of genetic information, but also has unique chemical and physical properties that can be used to construct complex functional nanostructures. This theoretical basis has promoted the rise of DNA nanotechnology, which uses DNA as an engineering material to create nanoscale structures with precisely defined shapes and sizes.

[0003] At the core of DNA nanotechnology lies the self-assembly ability of DNA molecules. By strategically designing DNA sequences, researchers can predictably assemble a variety of structures, ranging from simple two-dimensional patterns to highly complex three-dimensional structures. The versatility of these nanostructures stems from the inherent programmability of DNA, which allows for precise customization to suit a variety of applications, such as drug delivery systems, biosensors, and intracellular molecular machines. Due to their excellent biocompatibility and programmable precision, DNA nanomaterials have great potential in biomedical applications. They can serve as drug carriers to deliver therapeutic drugs to target disease sites with high specificity; as biosensors capable of detecting specific biomarkers in the body; and as tissue engineering scaffolds to promote regeneration and repair.

[0004] Despite the success of DNA nanomaterials in laboratory settings, their translation into clinical applications faces several challenges. First, the synthesis and purification of DNA nanomaterials often involve complex procedures, resulting in high production costs. Scaling up production to meet clinical needs requires more cost-effective methods. Second, DNA molecules are easily degraded under physiological conditions, especially in environments rich in nucleases. Therefore, to ensure the efficacy and safety of DNA nanomaterials in vivo, their stability in complex biological environments must be improved. In addition, the clinical translation of DNA nanomaterials faces many obstacles, including pharmacokinetic analysis, immunogenicity, and regulatory compliance. Ensuring the safety and efficacy of these materials is crucial for their successful integration into clinical practice.

[0005] DNA nanomaterials are currently being widely used to address major medical challenges, including cancer treatment. Nanomaterials play a key role in the treatment of non-solid tumors, such as lymphomas. Diffuse large B-cell lymphoma (DLBCL) is one of the most common types of non-Hodgkin's lymphoma in adults, characterized by high heterogeneity and aggressiveness. Although the standard R-CHOP regimen (rituximab combined with cyclophosphamide, doxorubicin, vincristine, and prednisone) has become the cornerstone of first-line treatment, a significant proportion of patients still experience relapse or disease progression, resulting in a poor prognosis. The main challenge in treating DLBCL is the lack of specificity of traditional chemotherapy and radiotherapy, which can lead to severe side effects and compromise patients' quality of life and long-term survival. In recent years, the development of immunotherapy and targeted therapies has brought new hope for the treatment of DLBCL. However, these novel therapies also face challenges such as drug resistance and a narrow therapeutic window. In light of these challenges, nanotechnology offers an innovative solution aimed at overcoming the limitations of existing therapies and improving their efficacy and safety. Summary of the Invention

[0006] The purpose of this section is to summarize some aspects of the embodiments of the present invention and briefly introduce some preferred embodiments. Some simplifications or omissions may be made in this section and the abstract and title of this application to avoid obscuring the purpose of this section, the abstract and the title of the invention, and such simplifications or omissions should not be used to limit the scope of the present invention.

[0007] In view of the above problems and / or the problems existing in the prior art, the present invention is proposed.

[0008] Therefore, the purpose of the present invention is to overcome the deficiencies in the prior art and provide a multivalent DNA nanomaterial.

[0009] In order to solve the above technical problems, the present invention provides the following technical solution: the multivalent DNA nanomaterial is DNAB, which is composed of repeating units, one of which includes:

[0010] The aptamer sgd5, whose nucleotide sequence is shown in SEQ ID NO. 6, is used to specifically recognize and bind to OCI-LY8 cells;

[0011] The aptamer A8, whose nucleotide sequence is shown in SEQ ID NO.7, is used to recognize T lymphocytes;

[0012] The random sequence X, which does not have a specific recognition function, is used to impart structural spatial flexibility and improve the overall configuration stability;

[0013] The sequence of the repeating unit is sgd5+X1+A8+X2+A8+......+X m +A8, the ratio of aptamer sgd5 to aptamer A8 is 1:n.

[0014] As a preferred embodiment of the multivalent DNA nanomaterial of the present invention, the DNAB tightly recruits T cells through its multivalent aptamer structure.

[0015] As a preferred embodiment of the multivalent DNA nanomaterial of the present invention, the DNAB assists T cells in directly killing OCI-LY8 cells through a granzyme-mediated pathway.

[0016] As a preferred embodiment of the multivalent DNA nanomaterial of the present invention, the stability structure of the DNAB is maintained for >24 hours under simulated in vivo conditions.

[0017] Another object of the present invention is to provide an application of a multivalent DNA nanomaterial in capturing T cells and OCI-LY8 cells, wherein the concentration of DNAB used to capture T cells and OCI-LY8 cells is 20 ng / μL compared to the concentration of DNAB in the co-culture system of cells.

[0018] Another object of the present invention is to provide a multivalent DNA nanomaterial for use in preparing a drug for treating non-solid tumors.

[0019] Another object of the present invention is to provide a method for preparing a multivalent DNA nanomaterial.

[0020] In order to solve the above technical problems, the present invention provides the following technical solutions: comprising:

[0021] Four single-stranded DNA oligonucleotides T1, T2, L1, and L2 whose nucleotide sequences are shown in SEQ ID NO. 1 to SEQ ID NO. 4 are mixed in an equal molar ratio to obtain a mixture;

[0022] The mixture is denatured, controlled annealed, and incubated in sequence, and then T4 DNA ligase is added thereto for ligation reaction to generate a circular DNA template solution;

[0023] BstDNA polymerase is used to amplify the circular DNA template to generate extended linear single-stranded DNA. DNAB is obtained after the reaction is completed.

[0024] As a preferred embodiment of the method for preparing the multivalent DNA nanomaterial of the present invention, the reaction of the mixture includes:

[0025] First, denature at approximately 90–100°C for 2–5 minutes; then cool from approximately 90–95°C to approximately 70–75°C at a rate of 1–3°C per 1–3 minutes; further reduce the temperature to approximately 60–70°C at a rate of 0.5–1.5°C per 3–7 minutes, and incubate at approximately 60–70°C for 10–30 minutes; then continue to reduce the temperature to approximately 30–40°C at a rate of 1–3°C per 1–3 minutes, and incubate at approximately 30–40°C for 5–15 minutes.

[0026] As a preferred embodiment of the method for preparing the multivalent DNA nanomaterial of the present invention, the 30 μL reaction system of the amplification reaction includes: 1×BstDNA polymerase buffer, 5 mM MgSO4, 735 ng / μL circular DNA template, 10 μM RCA primer, 0.3 mM dNTPs mixture and 8 units of BstDNA polymerase.

[0027] As a preferred embodiment of the method for preparing the multivalent DNA nanomaterial of the present invention, the reaction temperature of the amplification reaction is 60-65°C, and the reaction time is 6-8 hours.

[0028] Beneficial effects of the present invention:

[0029] The present application provides a multivalent DNA nanomaterial, its preparation method and application, which can enhance the effect of cancer immunotherapy through a simple DNA nanostructure (DNAB). By precisely regulating the ratio of two aptamers (T cell aptamer A8 and OCI-LY8 cell aptamer sgd5) in the DNA nanostructure, the ratio of T cells to OCI-LY8 cells can be regulated to n:1. Experimental results show that this ratio regulation significantly enhances the immune response. Under conditions where the immune response is weak or undesirable, adjusting the aptamer ratio can effectively improve the effect of immunotherapy, especially in an environment with low immune response, showing a significant immune enhancement effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for describing the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. Those skilled in the art can also derive other drawings based on these drawings without inventive effort. Among them:

[0031] Figure 1 This is a design flow chart of the DNA antibody (DNAB) in Example 1 of the present invention.

[0032] Figure 2 This is a diagram showing the characterization results of the DNA antibody (DNAB) in Example 1 of the present invention.

[0033] Figure 3 This is a graph showing the results of DNA antibody (DNAB) enrichment of immune T cells and human diffuse large B-cell lymphoma cells (OCI-LY8 strain) in Example 2 of the present invention.

[0034] Figure 4 This is a graph showing the results of DNA antibody (DNAB) enhancing T cell cytotoxicity in Example 3 of the present invention.

[0035] Figure 5 This is a graph showing the stability results of the DNA antibody (DNAB) in Example 4 of the present invention. DETAILED DESCRIPTION

[0036] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with the embodiments of the specification.

[0037] In the following description, many specific details are set forth to facilitate a full understanding of the present invention. However, the present invention may also be implemented in other ways different from those described herein. Those skilled in the art may make similar generalizations without violating the connotation of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0038] Secondly, the term "one embodiment" or "embodiment" herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The phrase "in one embodiment" appearing in various places throughout this specification does not necessarily refer to the same embodiment, nor does it refer to a separate or selective embodiment that is mutually exclusive of other embodiments.

[0039] Unless otherwise specified, all raw materials used in the present invention are commercially available in the art. Among them, all DNA oligonucleotides were ordered from Sangon Biotechnology (Shanghai) Co., Ltd.

[0040] The methods for obtaining T lymphocytes and OCI-LY8 cells used in the present invention are as follows:

[0041] T lymphocytes were isolated from normal human blood, and OCI-LY8 cells were isolated from patients with diffuse large B-cell lymphoma (DLBCL). T lymphocytes and OCI-LY8 cells were cultured in RPMI1640 medium supplemented with 15% fetal bovine serum (FBS) and 1% penicillin-streptomycin in a humidified incubator at 37°C and 5% CO2 until use.

[0042] The gene sequences involved in the specific embodiments of the present invention are shown in Table 1.

[0043] Table 1

[0044]

[0045] Example 1

[0046] Reference Figure 1 , demonstrated a method for synthesizing DNAB by rolling circle amplification (RCA), specifically:

[0047] Four single-stranded DNA oligonucleotides (T1, T2, L1, and L2) were mixed in an equimolar ratio (1:1:1:1:1) to obtain a mixture with a final concentration of 2.5 μM for each strand;

[0048] The mixture was first denatured at 95°C for 5 minutes and then subjected to a controlled annealing process: cooling from 93°C to 71°C at a rate of 2°C per 2 minutes, then cooling from 70°C to 65°C at a rate of 1°C per 5 minutes, and then incubating at 65°C for 20 minutes; then the solution was cooled from 65°C to 37°C at a rate of 2°C per 2 minutes, and then incubated at 37°C for 10 minutes;

[0049] T4 DNA ligase was then added, and the ligation reaction was carried out at 16°C for 10 hours to generate a circular DNA template solution (R1); the circular DNA template contained the antisense complementary sequence of the T cell aptamer A8, and the corresponding primer contained the sequence of the aptamer sgd5;

[0050] The circular DNA template was amplified using BstDNA polymerase to generate extended linear single-stranded DNA. The 30μL reaction system included: 1×BstDNA polymerase buffer, 5mM MgSO4, 735ng / μL circular DNA template, 10μM RCA primer, 0.3mM dNTPs mixture and 8 units of BstDNA polymerase. The reaction was carried out at 60°C for 6 hours to obtain DNAB.

[0051] In this step, due to the suboptimal binding efficiency between the initial template and the DNA primer, it was necessary to optimize the concentration ratio. At a 1:1 ratio of primer chain to circular template, RCA amplification required 46 hours, while optimizing the ratio to 2:1 shortened the time to 6 hours, indicating that the preparation conditions of DNAB in this step were optimal.

[0052] The DNAB obtained in this example was obtained by rolling circle amplification (RCA) and mainly includes three functional modules: first, it contains the aptamer sgd5 shown in SEQ ID NO.6, which can specifically recognize and bind to OCI-LY8 cells; second, it contains the aptamer A8 shown in SEQ ID NO.7, which has the ability to recognize T lymphocytes; finally, it is connected to a random sequence without specific recognition function to give the structure a certain spatial flexibility and improve the overall configuration stability.

[0053] One repeating unit of DNAB prepared in this example has 148 nucleotides, and its nucleotide sequence consists of random sequence X1+A8+random sequence X2, as shown in SEQ ID NO.15: TAGGAACATC AAACGACAGCCATCCCTCTATGATCCCTCTATGCTCATCCAGAGTGACGC AGCAGCTCGATCGTATAGCCGTGACGCAGCTTGAAATGGGATCGCGTCCACAGTTTTGGACACGGTGGCTTAGTGGTACTTGGTACTT.

[0054] This modular design enables synergistic recognition and targeting of two cell types, significantly enhancing the functional performance of the multivalent aptamer. The ratio of aptamer sgd5 to aptamer A8 within the repeating unit is 1:n. Store at -20°C.

[0055] The molecular weight of DNAB and its materials was characterized by agarose gel electrophoresis. Specifically, the samples were analyzed in 1×TAE buffer using 3% agarose gel at a constant voltage of 10 V / cm. The results were captured by the Alphalmager HP imaging system. Figure 2 As shown in A, Figure 2 A, right, demonstrates the successful synthesis of DNAB by RCA.

[0056] The structure of DNAB was characterized using atomic force microscopy (AFM). Specifically, the sample was purified with isopropanol and redissolved in magnesium-free ddH2O to 200 ng / μl. To facilitate subsequent analysis, an equal volume of 10 mM MgSO4 was added to the solution, and the mixture was thoroughly mixed.

[0057] The mica sheet was taped to the holder, and the DNAB solution was evenly spread on the mica surface. The sample was exposed to ultraviolet (UV) light for 3 minutes to fix the DNAB, and then rinsed twice with 200 μL ddH2O to remove unbound substances. The mica was then air-dried at room temperature. For imaging, the samples were analyzed using a NanoscopeIV multimode atomic force microscope (AFM) (Digital Instruments, Santa Barbara, CA) in tapping mode.

[0058] Figure 2 Figures B and 2C show the AFM analysis of DNAB. Two AFM samples were prepared at two concentrations: 37.8 ng / μL and 82.5 ng / μL. Figure 2As shown in B, at a higher concentration (82.5 ng / μL), spherical and network structures appeared in both the 5 μM and 2 μM regions. The height of the spherical structure did not exceed 9.3 nm, and the average width was 47.6 nm, indicating that increasing concentration causes the linear multivalent compound structure to condense into spheres, thereby forming a higher-order structure.

[0059] At a lower concentration (37.8 ng / μL), Figure 2 As shown in C, DNAB is evenly distributed in the 5μM and 2μM regions, showing a coiled structure, and aggregates in areas with higher magnesium ion concentrations. The average height is about 2nm and the average width is 36.6nm. Considering that the width of double-stranded DNA is about 2nm and the width of single-stranded DNA is about 1nm, 37.8ng / μL of DNAB is not a single-stranded linear structure. Due to the presence of short palindromic sequences in the aptamer, the higher the concentration of DNAB, the more high-order structures are formed. In practical applications, the concentration of DNAB is about 10ng / μL. In theory, DNAB is designed as a linear multivalent aptamer structure. After co-culturing DNAB with T cells, it is observed under an inverted microscope ( Figure 2 D) DNAB can effectively recruit T cells under physiological conditions. The cells exhibit a regular linear arrangement, indicating that DNAB can tightly recruit cells through its multivalent aptamer structure.

[0060] Example 2 DNAB enrichment of immune T cells and OCI-LY8 cells

[0061] This example is used to verify the ability of DNAB to capture T lymphocytes and OCI-LY8 cells. Specifically:

[0062] DNAB was fixed on a confocal culture dish to simulate the recruitment of T cells and OCI-LY8 cells in vivo. A mixture containing T lymphocytes and OCI-LY8 cells was added and co-cultured for 24 hours. The results are shown in Figure 2. Figure 3 shown.

[0063] Figure 3 A shows the results of phalloidin staining. The distribution ratio of OCI-LY8 cells and T cells is consistent with our design. The number of T cells captured by DNAB is significantly higher than that of OCI-LY8 cells. The dotted lines in the figure indicate that DNAB can recruit cells and promote their linear arrangement. Yellow arrows indicate T cells based on their morphology, and red arrows indicate OCI-LY8 cells, confirming that DNAB can effectively capture both cell types.

[0064] To further verify this conclusion, CD20 and CD8a were used as markers of OCI-LY8 cells and T cells, respectively, in the co-culture samples. Figure 3As shown in B, colocalization of CD8a / CD20 was observed in the yellow area of ​​the zoomed image, indicating that T cells were enriched around OCI-LY8 cells under the influence of DNAB.

[0065] To determine the optimal DNAB concentration for effective capture of T cells and OCI-LY8 cells, flow cytometry analysis was performed. DNAB was co-cultured with cells for 24 hours. Subsequently, the cells were treated with CD20 and CD8a antibodies. Subsequently, 488 goat anti-mouse IgG and 594 goat anti-rabbit secondary antibodies were diluted 1:100 at an initial concentration of 2 mg / mL and the cells were incubated for another hour at room temperature in the dark. The cell samples were then analyzed by flow cytometry. The results are shown in Figure 2. Figure 3 Figure C shows that the proportion of cells in the Q2 region increased significantly after adding DNAB compared to the control group. When the DNAB concentration reached 20 ng / μL, the proportion of CD20+ and CD8a+ cell populations reached a maximum. These results demonstrate for the first time that DNAB can capture both cell types, providing conditions for effective T cell killing of OCI-LY8 cells. Furthermore, 4 μg of DNAB was found to achieve the highest capture efficiency.

[0066] Example 3 DNAB enhances T cell cytotoxicity

[0067] This example is used to verify the role of DNAB in enhancing T cell-mediated cytotoxicity, specifically:

[0068] DNAB was fixed to the bottom of the confocal microplate using UV crosslinking, and the staining protocol used Annexin V-AbFluor TM Double staining with 488 and propidium iodide (PI) was performed to detect different stages of cell apoptosis. TM 488 marks early apoptotic cells by binding to phosphatidylserine (PS) on the cell membrane and TM 488 for fluorescence labeling (excitation / emission wavelengths are 496 / 516 nm). PI is used to label late apoptotic or necrotic cells, generating red fluorescence through its binding to cellular DNA.

[0069] When performing fluorescence observation under a confocal laser scanning microscope, use a microscope equipped with FITC excitation / emission filters (ExEm-496 / 516 nm) to excite AbFluor TM488, observe the green fluorescence signal to identify early apoptotic cells; at the same time, the red fluorescence of PI (excitation wavelength 535nm, emission wavelength 617nm) is used to mark late apoptotic or necrotic cells. Through this double staining technique, the different death states of cells can be clearly distinguished, making it easier to compare the differences in apoptosis in different groups. A mixture of T cells and OCI-LY8 cells was then added to verify that DNAB can enhance the cytotoxicity of T cells.

[0070] The results are as follows Figure 4 As shown in A, confocal microscopy revealed that OCI-LY8 cells were surrounded by T cells, with most OCI-LY8 cells dying or undergoing apoptosis. DAPI-stained DNAB material formed a blue meshwork surrounding the cells, indicating that DNAB effectively captured T cells and OCI-LY8 cells, forming a cross-linked network that resulted in OCI-LY8 cells being surrounded by a large number of T cells, consistent with our design.

[0071] Furthermore, DNAB was fixed in a confocal culture dish, and T cells and OCI-LY8 cells were co-cultured. After 24 hours, the culture medium was removed and the cells were blocked with 5% goat serum albumin for 1 hour at room temperature; CD8a and granzyme B antibodies were added and incubated at 4°C overnight. Then, 488 goat anti-mouse IgG and 594 goat anti-rabbit IgG secondary antibodies with an initial concentration of 2 mg / mL were diluted 1:100 and incubated with cells at room temperature in the dark for 1 hour. Under the same conditions as the experimental group, a control group without DNAB was prepared, and the cells were observed using a laser confocal scanning microscope;

[0072] The results are as follows Figure 4 As shown in B, fluorescent labeling of granzyme B showed that T cells gathered around OCI-LY8 cells and released a large amount of granzyme B, indicating that T cells killed OCI-LY8 cells by releasing granzyme B.

[0073] These experimental results indicate that DNAB facilitates the simultaneous recruitment of T cells and OCI-LY8 cells, eliminating the need for T cells to wander around in search of OCI-LY8 cells. DNAB shortens the distance between cells and promotes T cell-mediated apoptosis of OCI-LY8 cells through the granzyme pathway.

[0074] To investigate whether DNAB affects the cytotoxicity of T lymphocytes against OCI-LY8 cells, DNAB was co-cultured with cells for 24 h and Annexin V-AbFluor TM 488 / PI cell apoptosis flow cytometry. Figure 4As shown in C, at the same T cell concentration, the total proportion of cells in the Q1, Q2, and Q3 regions of the DNAB group was significantly higher than that of the control group, indicating an increase in the number of dead and apoptotic cells. 3 Increased to 1×10 4 However, when the T cell concentration increased to 5×10 4 There was no significant difference in the proportion of late apoptotic and dead cells between the DNAB group and the control group. Figure 4 D. This indicates that DNAB can enhance T cell cytotoxicity under conditions of low immune response.

[0075] In summary, under conditions of low immune response, DNAB can simultaneously capture T cells and OCI-LY8 cells, effectively enhancing T cell-mediated cytotoxicity. Therefore, we believe that DNAB may play a synergistic role in the treatment of hematological malignancies, rapidly enhancing the efficacy of circulating T cells.

[0076] Finally, qRT-PCR was used to evaluate the expression levels of TNF-α and IFN-γ genes in T cells and OCI-LY8 cells. Specifically, total RNA from the control and experimental groups was extracted using TRIzol RNA reagent, and cDNA was synthesized using HiScript IV RT Super Mix for qPCR (+ gDNA wiper) (Nanjing Wozyme Biotechnology Co., Ltd.);

[0077] Real-time quantitative PCR was performed using TaqPro Universal SYBR qPCR Master Mix (Nanjing BGI Biotechnology Co., Ltd.). The primer sequences used for PCR were synthesized by Sangon Biotechnology (Shanghai) Co., Ltd. The primer sequences are detailed in Table 1.

[0078] The results are as follows Figure 4 As shown in Figure E, the t-test results showed that there was no significant difference in the expression of TNF-α and IFN-γ between the control group and the DNAB-treated group. This indirectly proves that DNAB mainly assists T cells in directly killing OCI-LY8 cells through the granzyme-mediated pathway.

[0079] Example 4 Stability of DNAB

[0080] This example is used to evaluate the stability of DNAB. The stability of DNAB in serum is used to characterize its persistence under nuclease treatment. Specifically:

[0081] Testing stability in fetal bovine serum (FBS)

[0082] Fetal bovine serum (FBS) contains plasma proteins, lipids, peptides, carbohydrates, growth factors, hormones, and inorganic substances. Given the complex biological environment, evaluating the stability of DNA in serum requires a comprehensive assessment. DNAB was incubated with 50% FBS at 37°C. At different digestion times, the reaction was immediately terminated by heating at 95°C for 5 minutes. DNAB degradation was evaluated using 3% agarose gel electrophoresis. The results are shown in Figure 2. Figure 5 As shown in A, DNAB showed good stability after culture in 50% FBS for 0, 3, 6, and 18 hours.

[0083] Testing stability in whole blood

[0084] Whole blood, composed of blood cells and plasma, performs multiple important functions in the body. Its complex biological environment is key to assessing DNA stability and can more accurately simulate in vivo conditions. DNAB was mixed with whole blood at a ratio of 1:29 and incubated at 37°C and 4°C, respectively. After different digestion times, the samples were first centrifuged at 2000 rpm for 30 minutes to obtain the supernatant. After removing the supernatant, the samples were centrifuged at 12000 rpm for 30 minutes, and the precipitate was collected and evaluated for DNAB degradation using 3% agarose gel electrophoresis.

[0085] The results are as follows Figure 5 As shown in B, DNAB remained stable after 24 hours. Figure 5 A and 5B demonstrate the stability of DNAB.

[0086] In summary, the present application provides a multivalent DNA nanomaterial, a preparation method and an application thereof, which can enhance the effect of cancer immunotherapy through a simple DNA nanostructure (DNAB). By precisely regulating the ratio of the two aptamers (T cell aptamer A8 and OCI-LY8 cell aptamer sgd5) in the DNA nanostructure, the ratio of T cells to OCI-LY8 cells can be regulated to n:1. The experimental results show that the ratio regulation significantly enhances the immune response. Under conditions where the immune response is weak or undesirable, adjusting the aptamer ratio can effectively improve the effect of immunotherapy, especially in an environment with low immune response, showing a significant immune enhancement effect.

[0087] This application explores the potential of DNABs as a therapeutic approach for non-solid tumors. The simplicity, cell aggregation ability, and high stability of DNABs make them a cost-effective therapeutic option, particularly for hematological malignancies. The DNABs described in this study utilize a linear structure, offering significant design flexibility and ease of synthesis. Specific sequences can be customized to target different cell populations, depending on the therapeutic goal.

[0088] Compared to complex proteins or other DNA nanotherapeutics, DNABs are simpler to synthesize. By designing DNA sequences that precisely target tumor and T cell surface markers, DNABs are being evaluated for the treatment of non-solid tumors. This approach allows cancer cells to approach T cells for direct interaction. Thus, DNABs act as a bridge, enhancing the immune response against cancer cells, which is crucial for non-solid tumors due to their widespread distribution. This approach minimizes off-target effects on healthy tissues.

[0089] The DNAB synthesized by the present invention also has high stability and can maintain its structure for up to 24 hours under simulated in vivo conditions. Its simple linear structure and stability bring potential benefits to the clinic. In addition, compared with traditional DNA nanoantibodies, DNAB is simpler in design, synthesis, production and storage, and therefore has significant cost advantages, making it an economical and effective option for developing economical therapies. In contrast, although antibody drugs are effective, their high cost limits their use in resource-limited environments. DNAB has higher cost-effectiveness, especially in the long-term treatment of non-solid tumors.

[0090] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, which should all be included in the scope of the claims of the present invention.

Claims

1. A multivalent DNA nanomaterial, characterized by: The multivalent DNA nanomaterial is DNAB, which is composed of repeating units, wherein one of the repeating units includes: The aptamer sgd5, whose nucleotide sequence is shown in SEQ ID NO. 6, is used to specifically recognize and bind to OCI-LY8 cells; The aptamer A8, whose nucleotide sequence is shown in SEQ ID NO.7, is used to recognize T lymphocytes; The random sequence X, which does not have a specific recognition function, is used to impart structural spatial flexibility and improve the overall configuration stability; The sequence of the repeating unit is sgd5+X1+A8+X2+A8+......+X m +A8, the ratio of aptamer sgd5 to aptamer A8 is 1:n.

2. The multivalent DNA nanomaterial according to claim 1, wherein: The DNAB tightly recruits T cells through its multivalent aptamer structure.

3. The multivalent DNA nanomaterial according to claim 2, wherein: The DNAB assists T cells in directly killing OCI-LY8 cells through a granzyme-mediated pathway.

4. The multivalent DNA nanomaterial according to claim 3, wherein: The stability structure of the DNAB is maintained for >24 hours under simulated in vivo conditions.

5. Use of the multivalent DNA nanomaterial according to any one of claims 1 to 4 in capturing T cells and OCI-LY8 cells, characterized in that: The concentration of DNAB used to capture T cells and OCI-LY8 cells was approximately 20 ng / μL compared to the concentration in the DNAB and cell co-culture system.

6. Use of the multivalent DNA nanomaterial according to claim 5 in the preparation of a drug for treating non-solid tumors.

7. The method for preparing a multivalent DNA nanomaterial according to any one of claims 1 to 4, wherein: include, Four single-stranded DNA oligonucleotides T1, T2, L1, and L2 whose nucleotide sequences are shown in SEQ ID NO. 1 to SEQ ID NO. 4 are mixed in an equal molar ratio to obtain a mixture; The mixture is denatured, controlled annealed, and incubated in sequence, and then T4 DNA ligase is added thereto for ligation reaction to generate a circular DNA template solution; BstDNA polymerase is used to amplify the circular DNA template to generate extended linear single-stranded DNA. DNAB is obtained after the reaction is completed.

8. The method for preparing the multivalent DNA nanomaterial according to claim 7, wherein: Reactions of the mixture include, First, denature at approximately 90–100°C for 2–5 minutes; then cool from approximately 90–95°C to approximately 70–75°C at a rate of 1–3°C per 1–3 minutes; further reduce the temperature to approximately 60–70°C at a rate of 0.5–1.5°C per 3–7 minutes, and incubate at approximately 60–70°C for 10–30 minutes; then continue to reduce the temperature to approximately 30–40°C at a rate of 1–3°C per 1–3 minutes, and incubate at approximately 30–40°C for 5–15 minutes.

9. The method for preparing the multivalent DNA nanomaterial according to claim 7, wherein: The 30 μL reaction system of the amplification reaction includes: 1×BstDNA polymerase buffer, 5 mM MgSO4, 735 ng / μL circular DNA template, 10 μM RCA primer, 0.3 mM dNTPs mixture and 8 units of BstDNA polymerase.

10. The method for preparing a multivalent DNA nanomaterial according to claim 9, wherein: The reaction temperature of the amplification reaction is 60-65°C, and the reaction time is 6-8 hours.

Images