Cas12a protein ssDNA aptamer Cas12a-03 and application thereof

Through multiple rounds of screening and high-throughput sequencing, the Cas12a-03 protein ssDNA nucleic acid aptamer was screened, solving the problem of insufficient affinity and specificity of the Cas12a protein nucleic acid aptamer, and achieving high sensitivity detection and biosensor application.

CN120555439APending Publication Date: 2025-08-29SHENZHEN SECOND PEOPLES HOSPITAL (SHENZHEN INST OF TRANSLATIONAL MEDICINE)
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510705843.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-29
Publication Date
2025-08-29

AI Technical Summary

Technical Problem

In the prior art, Cas12a protein nucleic acid aptamers lack high affinity and specificity, which affects the sensitivity and specificity of the detection technology.

Method used

Enriched libraries were obtained through multiple rounds of screening, high-throughput sequencing was performed, and multiple monoclonal Cas12a protein ssDNA nucleic acid aptamer Cas12a-03 were selected. SPR was used for single concentration initial screening, and monoclonals with excellent binding ability were screened out.

Benefits of technology

The obtained Cas12a-03 protein ssDNA nucleic acid aptamer has excellent binding ability and is suitable for protein detection and nucleic acid detection, promoting the development of biosensors.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120555439A_ABST
    Figure CN120555439A_ABST
Patent Text Reader

Abstract

The invention provides a Cas12a protein ssDNA nucleic acid aptamer Cas12a-03 and application of the Cas12a protein ssDNA nucleic acid aptamer Cas12a-03, and belongs to the technical field of genetic resource detection. According to the present invention, the sequence of the nucleic acid aptamer Cas12a-03 of the Cas12a protein ssDNA is represented by SEQ TD NO: 1, and the sequence of the nucleic acid aptamer Cas12a-03 is specifically as follows: CACGCATAACCCACCCATCTG TCCCGTCCCCTGCTGTGTCCCTCGAG TTATGCGTG, and the sequence of the nucleic acid aptamer Cas12a-03 of the present invention is represented by SEQ TD NO: 1; the Cas12a protein ssDNA nucleic acid aptamer Cas12a-03 obtained through screening has excellent binding capacity, can bring excellent development prospects for protein detection, nucleic acid detection and the like, can be used for preparing biosensors and provides benefits for progress of the treatment effect of patients.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of genetic resource detection technology, and in particular to a Cas12a protein ssDNA nucleic acid aptamer Cas12a-03 and applications thereof. Background Art

[0002] Cas12a nuclease is a class 2, type V endonuclease in the CRISPR system, which plays an important role in the adaptive immune system of bacteria and archaea. Unlike the Cas9 nuclease, Cas12a only needs a crRNA guide to target the target DNA. It has a simplified guide system and has obvious advantages in applications with limited space. In addition, the Cas12a system relies on T-rich PAM, which is different from the G-rich PAM sequence recognized by Cas9, broadening the targeting range of gene editing. In addition, activated Cas12a has incidental cutting activity and can cut single-stranded DNA (ssDNA) in parallel. It can be used for signal amplification and achieve high-sensitivity detection of specific nucleic acid sequences. It shows great application potential in fields such as gene editing and disease diagnosis.

[0003] Aptamers, also known as "chemical antibodies," are single-stranded nucleic acid (RNA or ssDNA) sequences with molecular recognition capabilities, obtained through in vitro screening. Compared to traditional antibodies, aptamers offer advantages such as rapid synthesis, excellent stability, high biocompatibility, ease of modification, and minimal batch-to-batch variability. Aptamers hold broad application prospects in disease diagnosis and treatment.

[0004] Aptamers are usually screened in vitro through the systematic evolution of ligands by exponential enrichment (SELEX). After more than 30 years of innovation and improvement, various new and efficient aptamer screening methods have been developed and applied, such as the screening strategy based on target fixation, in which the target is fixed on the surface of carriers such as nanomagnetic beads and resin materials, and the free aptamer sequence is bound and sorted by fixing the target; the screening strategy based on library fixation, in which nanomaterials with fixed library sequences are prepared, and nucleic acid nanomaterials that bind to the target are obtained by sorting; there are also screening methods that allow the target molecule and the nucleic acid library to interact in a free state, such as capillary electrophoresis (CE)-SELEX. The development of these technologies provides technical support for the screening of Cas12a protein ssDNA nucleic acid aptamers.

[0005] With the widespread application of Cas12a proteins in gene editing, nucleic acid detection and other fields, the demand for ssDNA aptamers that specifically bind to them is also increasing. Screening for high-affinity and high-specificity Cas12a protein ssDNA aptamers will help further optimize Cas12a-related detection technologies, improve detection sensitivity and specificity, and provide key components for the development of new Cas12a-based biosensors and gene therapy vectors, thereby promoting the development and application of related biotechnologies.

[0006] Based on this, providing a novel Cas12a protein ssDNA nucleic acid aptamer has important practical significance. Summary of the Invention

[0007] The present invention aims to provide a Cas12a protein ssDNA nucleic acid aptamer Cas12a-03, which aims to solve the technical problem of the lack of Cas12a protein nucleic acid aptamers in the prior art.

[0008] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0009] The present invention provides a Cas12a protein ssDNA nucleic acid aptamer Cas12a-03, the nucleotide sequence of which is shown in SEQ TD NO: 1.

[0010] Furthermore, the SEQ TD NO: 1 is specifically: CACGCATAACCCACCCCATCTGTCCCGTCCCCCTGCTGTGTCCCTCGAGTTATGCGTG.

[0011] The present invention also provides a derivative of the Cas12a protein ssDNA nucleic acid aptamer Cas12a-03 described in the above technical solution, wherein the derivative is a derivative derived from or modified from the skeleton of the Cas12a protein ssDNA nucleic acid aptamer Cas12a-03 described in claim 1.

[0012] The present invention also provides the application of the Cas12a protein ssDNA nucleic acid aptamer Cas12a-03 described in any one of the above technical solutions in nucleic acid detection.

[0013] The present invention also provides the application of the Cas12a protein ssDNA nucleic acid aptamer Cas12a-03 described in any one of the above technical solutions in protein detection.

[0014] The present invention also provides the use of the Cas12a protein ssDNA nucleic acid aptamer Cas12a-03 described in any one of the above technical solutions in a biosensor.

[0015] Compared with the prior art, the technical solution of the present invention has the following beneficial effects:

[0016] The present invention obtains enrichment library by multiple rounds of screening, and the obtained library has very strong affinity, and then carries out high-throughput sequencing, selects out multiple monoclonal to be detected, uses SPR to carry out single concentration primary screening, successfully obtains multiple monoclonal binding amount greater than 30RU, has good binding ability, and finally carries out KD detection.The Cas12a protein ssDNA nucleic acid aptamer Cas12a-03 obtained by the present invention screening has excellent binding ability, can bring excellent development prospect for protein detection, nucleic acid detection etc., and can be used to prepare biosensor, for the progress of patient treatment effect provides benefit. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is an analysis chart of the retention rate of each round of screening in multiple rounds of screening of the present invention;

[0018] Figure 2 This is a diagram of the SPR measurement results of the present invention;

[0019] Figure 3 This is a graph showing the affinity results of the library obtained from four rounds of screening in the present invention;

[0020] Figure 4 This is a standard diagram for high-throughput sequencing of the present invention;

[0021] Figure 5 This is a diagram of the high-throughput sequencing results of the present invention;

[0022] Figure 6 This is a diagram showing the binding of the monoclonal antibody of the present invention to the Cas12a protein;

[0023] Figure 7 This is a diagram showing the binding of the monoclonal antibody of the present invention to other proteins with his-tag;

[0024] Figure 8 This is a graph showing the concentration gradient detection results of the monoclonal Cas12a-02 of the present invention;

[0025] Figure 9 This is a graph showing the concentration gradient detection results of the monoclonal Cas12a-03 of the present invention;

[0026] Figure 10 This is a graph showing the concentration gradient detection results of the monoclonal Cas12a-05 of the present invention;

[0027] Figure 11 This is a graph showing the concentration gradient detection results of the monoclonal Cas12a-06 of the present invention;

[0028] Figure 12This is a graph showing the concentration gradient detection results of monoclonal Cas12a-28 of the present invention. DETAILED DESCRIPTION

[0029] The present invention provides a Cas12a protein ssDNA nucleic acid aptamer Cas12a-03, the nucleotide sequence of which is shown in SEQ TD NO: 1.

[0030] In the present invention, the SEQ TD NO: 1 is specifically: CACGCATAACCCACCCC ATCTGTCCCGTCCCCCTGCTGTGTCCCTCGAGTTATGCGTG.

[0031] 1. The Cas12a protein ssDNA nucleic acid aptamer Cas12a-03 of the present invention was screened by the following method:

[0032] First round of screening:

[0033] (1) Carboxyl magnetic beads immobilize BSA protein

[0034] Take 300uL carboxyl magnetic beads, wash them 4 times with 200uL ultrapure water, fish the beads with a magnet, and remove the supernatant;

[0035] Take 100uL of prepared NHS and 100uL of EDC, slowly thaw at room temperature, add NHS to EDC, mix thoroughly, and then add to the magnetic beads from the previous step. Incubate on a shaker at room temperature for 20 minutes (if the beads aggregate, shake occasionally during this time). Pour the beads onto a magnet, remove the supernatant, and wash twice with 200uL of DPBS.

[0036] Take 10 μL of BSA protein (concentration: 10 mg / mL), add 80 μL of NaAc solution (pH 4.2), mix thoroughly, and add to the magnetic beads from the previous step. Incubate on a shaker at room temperature for 60 minutes. (If the beads aggregate, shake occasionally during this time.) Place the beads on a magnet and discard the supernatant.

[0037] Add 100 μL of 1 M ethanolamine, pH 8.5, to the magnetic beads from the previous step. Incubate on a shaker at room temperature for 10 minutes. Remove the beads from the magnet, discard the supernatant, and wash four times with 200 μL of DPBS. This will be used later as MB-BSA. Note: After coupling the BSA beads, place them in a refrigerator at 4°C and use 50 μL for each round of screening.

[0038] (2) Carboxyl magnetic beads fix Cas12a protein

[0039] Take 50uL carboxyl magnetic beads, wash them 4 times with 200uL ultrapure water, fish the beads with a magnet, and remove the supernatant;

[0040] Take 50uL of the prepared NHS and 50uL of EDC, slowly thaw at room temperature, add the NHS to the EDC, mix thoroughly, and then add to the magnetic beads from the previous step. Incubate on a shaker at room temperature for 20 minutes (if the beads aggregate, shake occasionally during this time). Fish the beads with a magnet, remove the supernatant, and wash twice with 200uL of DPBS.

[0041] Take 5 μL of Cas12a protein (concentration: 2 mg / ml), add 10 μL of pH 4.2 NaAC, and add to the magnetic beads in the previous step. Incubate on a shaker at room temperature for 1 hour (if the magnetic beads aggregate, shake them occasionally during this period). Fish the magnetic beads with a magnet and remove the supernatant.

[0042] Take 100uL 1M ethanolamine pH 8.5 and add it to the magnetic beads in the previous step. Incubate on a shaker at room temperature for 10 minutes (if the magnetic beads aggregate, shake them occasionally). Fish the magnetic beads with a magnet, remove the supernatant, and wash them 4 times with 200uL DPBS. Label them as MB-Cas12a.

[0043] (3) Screening

[0044] Take a tube of lib3-76nt library powder, centrifuge at 14,000g for 10 minutes, add 137µL of DPBS, vortex to dissolve the powder, centrifuge at 14,000g for 10 minutes, and aliquot into PCR tubes. Place in a PCR instrument for denaturation and renaturation. The program is 95°C for 10 minutes, followed by an immediate ice-water bath for 5 minutes, and equilibrate to room temperature.

[0045] Take 10uL*0.1mg / ml 6His peptide and add it to the denatured library, mix well; then add it to 50uL MB-BSA, mix it by slowly pipetting with a pipette, and incubate it on a shaker at room temperature for 40min; use a magnet to fish the magnetic beads, and use a pipette tip to aspirate the supernatant and record it as pool-;

[0046] Rinse the magnetic beads with 200uL DPBS, fish the magnetic beads with a magnet, and record the supernatant as wash1-; rinse the magnetic beads with 200uL DPBS, fish the magnetic beads with a magnet, and record the supernatant as wash2-; rinse the magnetic beads with 200uL DPBS, fish the magnetic beads with a magnet, and record the supernatant as wash3-; rinse the magnetic beads with 200uL DPBS, fish the magnetic beads with a magnet, and record the supernatant as wash4-; add 200uL ultrapure water to the magnetic beads and boil them in a boiling water bath for 10 minutes, fish the magnetic beads with a magnet, and record the supernatant as Elution-;

[0047] Add pool- to 50uL MB-Cas12a, mix slowly with a gun, and incubate on a shaker at room temperature for 40min; rinse the magnetic beads with 200uL DPBS, fish the magnetic beads with a magnet, and the supernatant is recorded as wash1+; rinse the magnetic beads with 200uL DPBS, fish the magnetic beads with a magnet, and the supernatant is recorded as wash2+; rinse the magnetic beads with 200uL DPBS, fish the magnetic beads with a magnet, and the supernatant is recorded as wash3+; rinse the magnetic beads with 200uLDPBS, fish the magnetic beads with a magnet, and the supernatant is recorded as wash4+; add 100uL ultrapure water to the magnetic beads and boil in a boiling water bath for 10min, fish the magnetic beads with a magnet, and the supernatant is recorded as Elution+; take Roche 8-strip PCR tubes, add 30uL Q-PCR mix to each well, and then add 1uL of Elution- and Elution+ respectively, and perform fluorescent quantitative PCR program: 95℃2min; 95℃0.5min, 60℃0.5min, 72℃0.5min 25cycle;

[0048] The Q-PCR mix was prepared using the reagents shown in Table 1:

[0049] Table 1 Q-PCR mix preparation reagents

[0050] Reagents Total volume 1040 μL ddH2O 866μL 10*enzyme buffer 100 μL dNTPmix (10mM) 20 μL Lib1S1 (100 μM) 5μL Lib3A2 (100 μM) 5μL TaqPlus enzyme 4μL (50U) EvaGreen 40 μL

[0051] The sequence of Lib1S1 is shown in SEQ TD NO: 2, and the specific sequence of SEQ TD NO: 2 is GGGACCAGCACACGCATAAC;

[0052] The sequence of Lib3A2 is shown in SEQ TD NO: 3, and the specific sequence of SEQ TD NO: 3 is CACGGTAGCACGCATAACTC.

[0053] (4) Preparation of single chain

[0054] Remove 2 mL of ePCR mix from -20°C and add it to the remaining Elution+. Transfer the mixture to a 50 mL centrifuge tube and mix thoroughly. Add 8 mL of EM90 oil and vortex on a high-power vortexer to prepare an emulsion. Aliquot the emulsion into PCR tubes, 90 μL per tube, and perform PCR for 25 cycles. Cycle schedule: 95°C for 2 minutes, 95°C for 1 minute, 60°C for 1 minute, 72°C for 1 minute, and 25 cycles.

[0055] Recover ePCR products;

[0056] Concentrate the ePCR product with n-butanol. Transfer the ePCR product to a 10mL centrifuge tube, fill to the top with n-butanol, mix thoroughly, and centrifuge at 10,000g for 10 minutes. After centrifugation, separate the layers, remove the upper clear layer, and transfer the lower amplified product to a small EP tube (approximately 100µL). Transfer 90µL to a small centrifuge tube, add 100µL of Urea loading buffer, mix thoroughly, and heat in a PCR instrument at 95°C for 10 minutes.

[0057] Separate single strands by denaturing PAGE electrophoresis (electrophoresis, gel cutting, and gel boiling). Concentrate ssDNA with n-butanol. Dialyze ssDNA overnight in DPBS using a 3.5 kDa dialysis bag and determine concentration using a micro-UV microscope.

[0058] The ePCR mix is ​​prepared using the reagents shown in Table 2;

[0059] Table 2 ePCR mix synthesis reagents

[0060] Reagents Total volume 1000 μL ddH2O 866μL 10*enzyme buffer 100 μL dNTPmix (10mM) 20 μL Lib1S1-FAM (100 μM) 5μL Lib3A2-ployA (100 μM) 5μL TaqPlus enzyme 4μL (50U)

[0061] The Lib1S1-FAM sequence is shown in SEQ TD NO: 4, and the specific sequence of SEQ TD NO: 4 is: GGGACCAGCACACGCATAAC;

[0062] The sequence of the Lib3A2-ployA is shown in SEQ TD NO: 5, which is specifically AAAAAAAAAAAAAAAAAAAAAAAAACACGGTAGCACGCAT AACTC; wherein the middle position contains a spacer, specifically AAAAAAAAAAAAAAAAAA AAAAAAAA-Spacer18-CACGGTAGCACGCATAACTC.

[0063] The screening was conducted four times, with the screening conditions changed each time. The other steps were the same as the first screening. The conditions changed in the subsequent screening rounds are shown in Table 3 ;

[0064] Table 3 Screening condition changes

[0065]

[0066] The screening results are shown in Table 4;

[0067] Table 4 Screening results

[0068]

[0069] The analysis of the retention rate in each round of screening is as follows: Figure 1 shown; based on Figure 1As shown in Table 1, the positive screen retention rate increased with each round, while the negative screen retention rate showed a downward trend, indicating a good screening effect. The amplification curve no longer decreased, and the library capacity was small, allowing affinity determination.

[0070] 2. Using SPR to detect library affinity

[0071] (1) Chip coupling

[0072] The SPR chip was changed to a new CM5 chip, and the Running buffer was replaced with PBS; the chip was washed twice with a 50mM NaOH solution containing SDS, and then washed once with 50mM NaOH; NHS and EDC storage solutions were taken, thawed on ice and immediately mixed in equal volumes, SPR injection: flow rate 5uL / min, injection 10min; Cas12a protein was diluted to 250ug / ml with sodium acetate (10mM, pH4.0), SPR injection: flow rate 5uL / min, injection 2min. Coupled to the Fc2 channel; Cas13a protein was diluted to 250ug / mL with sodium acetate (10mM, pH4.0), SPR injection: flow rate 5ul / mi n, injection 2min. Coupled to the Fc1 channel; 100uL ethanolamine (1M, pH8.5) was taken for blocking, SPR injection: flow rate 5uL / min, injection 5min

[0073] (2) Library affinity determination

[0074] Dilute pool 2, pool 3, and pool 4 with DPBS to 500 nM in 100 μL, incubate at 95°C for 10 min, and immediately place in an ice-water bath for 5 min.

[0075] SPR injection (Fc2-1): flow rate 10 μL / min, injection (PBS) 1 min, waiting time 3 min, regeneration (2 M NaCl) 1 min;

[0076] SPR injection (Fc2-1): flow rate 10 μL / min, injection (pool 2) 1 min, waiting time 3 min, regeneration (2 M NaCl) 1 min;

[0077] SPR injection (Fc2-1): flow rate 10 μL / min, injection (pool 3) 1 min, waiting time 3 min, regeneration (2 M NaCl) 1 min;

[0078] SPR injection (Fc2-1): flow rate 10 μL / min, injection (pool 4) 1 min, waiting time 3 min, regeneration (2 M NaCl) 1 min;

[0079] The results of SPR assays were as follows Figure 2 As shown, based on Figure 2It can be seen that the coupling amount of Cas13a protein is 10097.8RU; the coupling amount of Cas12a protein is 11731.6Ru;

[0080] The affinity results of the library obtained after four rounds of screening are as follows Figure 3 As shown, based on Figure 3 It can be seen that with the increase of screening rounds, the binding ability of the library becomes stronger, and the fourth round library has a very strong affinity.

[0081] 3. High-throughput sequencing

[0082] (1) The single-stranded template was added to 400 μL of PCR mix at a concentration of (0.5 μM * 10 μL), and the mixture was dispensed into eight PCR tubes in a row, with 100 μL per well. PCR amplification was performed on a Bio-rad instrument for 25 cycles. The PCR program was as follows: 95°C pre-denaturation for 1 min, 95°C denaturation for 60 s, 60°C for 60 s, and 72°C for 60 s.

[0083] (2) Library information and index primer information

[0084] The initial library information is shown in SEQ ID NO: 6, and the specific SEQ ID NO: 6 is GGGACCAGCACACGCATAACNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNGAGTTATGCGTGCTACCGTG;

[0085] The forward primer tag sequence information is shown in Table 5;

[0086] Table 5 Forward primer tag sequence information

[0087] Index primer name Index primer sequence (5' to 3') Corresponding library SEQ ID NO: 7 acggggGGGACCAGCACACGCATAAC P2 SEQ ID NO: 8 actggtGGGACCAGCACACGCATAAC P3 SEQ ID NO: 9 agagtaGGGACCAGCACACGCATAAC P4 SEQ ID NO: 10 agcgtcGGGACCAGCACACGCATAAC Aerosol

[0088] The reverse primer tag sequence is shown in SEQ ID NO: 11, and the specific SEQ ID NO: 11 is CACGGTAGCACGCATAACTC.

[0089] (3) After the PCR is completed, 20 μL of each sample is taken for storage and electrophoresis detection. The remaining mixture is divided into two 15 ml centrifuge tubes and concentrated with n-butanol to a volume of about 100 μL.

[0090] (4) Recover the double-stranded oligonucleotide using the UNIQ-10 oligonucleotide purification kit

[0091] Binding buffer = 1:10 (0.1 ml sample, 1 mL binding buffer), mix well. Use a pipette to draw 550 μL of sample into each of the two adsorption columns and centrifuge at 8000 rpm for 1 minute. Repeat the filtrate loading and centrifugation three times.

[0092] Rinse the adsorption column three times with washing buffer (check that the correct amount of anhydrous ethanol has been added to the wash solution before first use) using 500 μL of the wash buffer and centrifuge at 10,000 rpm for 1 minute. Discard the waste solution from the collection tube, place the adsorption column in the same collection tube, and centrifuge at 14,000 rpm for 2 minutes.

[0093] Transfer the mixture to the adsorption column, place it at room temperature for 2 minutes, and centrifuge it at 8000 rpm for 2 minutes. Pour out the liquid in the collection tube and place the adsorption column in the same collection tube.

[0094] Place the adsorption column in a clean 1.5mL centrifuge tube and add 100µL of elution buffer (Tris-EDTA, 2.5mM Tris-HCl, pH 8.5) to the center of the adsorption membrane. TE or water (pH > 7.0) can be substituted for the elution buffer and preheated to 60°C to further improve the yield. Allow to stand at room temperature for 5 minutes, then centrifuge at 12,000 rpm for 1 minute. Repeat the elution twice and measure the concentration. After centrifugation, add the liquid from adsorption columns 2, 3, and 4 to adsorption column 1 and elute again to obtain the DNA, which is the monoclonal detection sample.

[0095] The obtained dsDNA solution was recorded as Cas12a, with a mass concentration of 738ug / ml*100uL, and high-throughput sequencing was performed. The sequencing standard was as follows Figure 4 The result is shown as Figure 5 As shown, from left to right are: aerosol, p2, p3, p4, marker and Cas12a.

[0096] 4. Selection of Synthetic Monoclonal

[0097] The raw sequencing results were extracted using analysis software using the tag primers. A total of 2,539,700 sequences were obtained, including 1,048,576 sequence types. Note: The extracted results are random sequences, i.e., the primer regions at both ends are removed. When synthesizing, the primer sequences must be added before and after the extracted sequences.

[0098] The obtained sequences are analyzed, the sequences to be tested are selected, and monoclonal clones are synthesized. The library is a closed-loop library. When synthesizing monoclonal clones, the open-loop regions at both ends of the library are removed.

[0099] 5. Clonal Single Concentration Binding Ability and Specificity Testing

[0100] (1) Chip coupling

[0101] Replace the SPR chip with a new CM5 chip and the Running buffer with PBS.

[0102] The chip was washed twice with 50 mM NaOH solution containing SDS and then once with 50 mM NaOH;

[0103] Thaw NHS and EDC stock solutions on ice and immediately mix equal volumes. Activate Fc1 and Fc3 channels using SPR injection: flow rate 5 μL / min, injection 10 min.

[0104] The Cas12a protein was diluted to 20 μg / mL using sodium acetate (10 mM, pH 4.0), and the SPR injection was coupled to the Fc3 channel: the flow rate was 5 μL / min, the injection time was 10 min, and 3553.9 RU of Cas12a protein was attached;

[0105] 100 μL of ethanolamine (1 M, pH 8.5) was used for blocking, and the Fc1 and Fc2 channels were blocked by SPR injection: flow rate 5 μL / min, injection time 5 min;

[0106] Fc4 is linked to other proteins (with his-tag) as a control

[0107] (2) Monoclonal binding ability determination

[0108] Dilute the monoclonal clone to 1uM with PBS, 200uL volume, and set the injection program;

[0109] First inject PBS once, flow rate 30uL / min; inject for 3 minutes, wait for 1 minute, regenerate (2M NaCl) for 1 minute;

[0110] Inject samples sequentially according to the monoclonal number: flow rate 30uL / min; injection 3min, wait 1min, regeneration (2M NaCl) 1min;

[0111] (3) All monoclonal binding curves include: monoclonal binding to Cas12a protein, monoclonal binding to other proteins with his-tag, as shown in Figure 2. Figure 6 and Figure 7 As shown;

[0112] The binding and stability values ​​of all monoclonal clones were counted, and the results are shown in Table 6;

[0113] Table 6 Statistics of monoclonal binding values ​​and stability values

[0114]

[0115]

[0116]

[0117]

[0118]

[0119] By analyzing the high-throughput sequencing results, 96 monoclonal clones to be tested were selected and screened at a single concentration using SPR. The binding amount (binding value) of many monoclonal clones was successfully obtained to be greater than 30RU, which preliminarily determined that these monoclonal clones had good binding ability.

[0120] VI. Monoclonal Concentration Gradient KD Detection

[0121] (1) Chip coupling

[0122] Replace the SPR chip with a CM5 chip and the running buffer with PBS;

[0123] The chip was washed twice with 50 mM NaOH solution containing SDS and then once with 50 mM NaOH;

[0124] Thaw NHS and EDC stock solutions on ice and immediately mix equal volumes. Activate Fc1 and Fc2 channels using SPR injection: flow rate 5 uL / min, injection 5 min;

[0125] The Cas12a protein was diluted to 50 μg / mL using sodium acetate (10 mM, pH 4.0), and the SPR injection was coupled to the Fc2 channel: the flow rate was 10 μL / min, the injection time was 5 min, and 10379 RU of Cas12a protein was attached;

[0126] 100 μL of ethanolamine (1 M, pH 8.5) was taken for blocking, and all channels were blocked during SPR injection: flow rate 5 μL / min, injection 5 min;

[0127] (2) Monoclonal concentration gradient detection

[0128] Monoclonal Cas12a-02, Cas12a-03, Cas12a-05, Cas12a-06, and Cas12a-28 were diluted with PBS to 6 concentrations of 1000 nM, 500 nM, 250 nM, 125 nM, 62.5 nM, and 31.25, with a volume of 200 uL for each concentration, and the injection program was set;

[0129] First inject PBS once: channel Fc2-Fc1, flow rate 30uL / min; inject for 3 minutes, wait for 5 minutes, regenerate (2M NaCl) for 1 minute;

[0130] Inject samples sequentially according to the monoclonal sample number: channel Fc2-Fc1, flow rate 30uL / min; inject for 3 minutes, wait for 2 minutes, regenerate (2M NaCl) for 1 minute.

[0131] The sequence of Cas12a-02 is shown in SEQ ID NO: 12, and the specific sequence of SEQ ID NO: 12 is CACGCATAACCACGTCCGTCCCCCTCACCGCTGCGTCCCCCTC ATCGAGTTATGCGTG;

[0132] The sequence of the Cas12a-05 is shown in SEQ ID NO: 13, and the SEQ ID NO: 13 is specifically CACGCATAACCACACCACCGTACTCCCACCTTTGCTGCGTCCC CCAGAGTTATGCGTG;

[0133] The sequence of the Cas12a-06 is shown in SEQ ID NO: 14, and the SEQ ID NO: 14 is specifically CACGCATAACCATGCACCCTAAATACGCCCCGGATTTTGCCG AAGTGAGTTATGCGTG;

[0134] The sequence of the Cas12a-28 is shown in SEQ ID NO: 15, and the SEQ ID NO: 15 is specifically CACGCATAACCCCAACACCGACCCCGGTCAGGCAACAGAGG TATCGGAGTTATGCGTG.

[0135] (3) The concentration gradient detection results of monoclonal Cas12a-02, Cas12a-03, Cas12a-05, Cas12a-06 and Cas12a-28 are as follows Figure 8 、 9 , 10, 11, 12, based on Figure 8 、 9 , 10, 11, and 12 show that the concentration gradient KD of monoclonal Cas12a-02, Cas12a-03, Cas12a-05, Cas12a-06, and Cas12a-28 are 3.388nM, 3.122nM, 4.099nM, 9.317nM, and 5.971nM, respectively.

[0136] The present invention also provides a derivative of the Cas12a protein ssDNA nucleic acid aptamer Cas12a-03 described in the above technical solution, wherein the derivative is a derivative derived from or modified from the skeleton of the Cas12a protein ssDNA nucleic acid aptamer Cas12a-03 described in claim 1.

[0137] The present invention also provides the application of the Cas12a protein ssDNA nucleic acid aptamer Cas12a-03 described in any one of the above technical solutions in nucleic acid detection.

[0138] The present invention also provides the application of the Cas12a protein ssDNA nucleic acid aptamer Cas12a-03 described in any one of the above technical solutions in protein detection.

[0139] The present invention also provides the use of the Cas12a protein ssDNA nucleic acid aptamer Cas12a-03 described in any one of the above technical solutions in a biosensor.

[0140] In the present invention, unless otherwise specified, the raw materials required for preparation are all commercially available products well known to those skilled in the art.

[0141] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. Cas12a protein ssDNA nucleic acid aptamer Cas12a-03, characterized in that the nucleotide sequence of Cas12a-03 is shown in SEQ TD NO:

1.

2. Cas12a protein ssDNA nucleic acid aptamer Cas12a-03 according to claim 1, is characterized in that, The SEQ TD NO: 1 is specifically: CACGCATAACCCACCCCATCT GTCCCGTCCCCCTGCTGTGTCCCTCGAGTTATGCGTG.

3. A derivative of Cas12a protein ssDNA nucleic acid aptamer Cas12a-03, characterized in that, The derivative is a derivative derived from or modified from the skeleton of the Cas12a protein ssDNA nucleic acid aptamer Cas12a-03 according to claim 1.

4. Application of the Cas12a protein ssDNA nucleic acid aptamer Cas12a-03 described in any one of claims 1 to 2 in nucleic acid detection.

5. Application of the Cas12a protein ssDNA nucleic acid aptamer Cas12a-03 described in any one of claims 1 to 2 in protein detection.

6. Application of the Cas12a protein ssDNA nucleic acid aptamer Cas12a-03 described in any one of claims 1 to 2 in a biosensor.